Método, kit e iniciadores para a identificação genética de micobacterium bovis bcg cepa moreau-rj, método para monitoramento da viabilidade de bcg moreau-rj e expressão de genes, e, produtos com atividade imunobiológica

  • Número do pedido da patente:
  • PI 0604958-3 A2
  • Data do depósito:
  • 23/11/2006
  • Data da publicação:
  • 06/06/2006
Inventores:
  • Classificação:
  • A61P 35/00
    Agentes antineopl?sticos;
    ;
    A61K 39/04
    Prepara??es medicinais contendo ant?genos ou anticorpos; / Ant?genos bacterianos; / Mycobacterium, p. ex. Mycobacterium tuberculosis;
    ;
    G01N 33/50
    Investiga??o ou an?lise de materiais por m?todos espec?ficos n?o abrangidos pelos grupos ; / Material biol?gico, p. ex. sangue, urina; Hemocitr?metros; / An?lise qu?mica de material biol?gico, p. ex. sangue, urina; Testes por m?todos envolvendo a forma??o liga??es bioespec?ficas de ligantes; Testes imunol?gicos;
    ;
    C07H 21/04
    Compostos contendo duas ou mais unidades mononucleot?dicas tendo grupos fosfato ou polifosfato separados, ligados por radicais sacar?deos de grupos nucleos?deos, p. ex. ?cidos nucleicos; / com desoxiribosila como radical sacar?deo;
    ;
    C12N 15/31
    Muta??o ou engenharia gen?tica; DNA ou RNA concernentes ? engenharia gen?tica, vetores, p. ex. plasm?deos ou seu isolamento, preparação ou purifica??o; Uso de seus hospedeiros; / Tecnologia do DNA recombinante; / Fragmentos de DNA ou RNA; Suas formas modificadas; / Genes que codificam prote?nas microbianas, p. ex. enterotoxinas;
    ;
    A61K 39/40
    Prepara??es medicinais contendo ant?genos ou anticorpos; / Anticorpos; Imunoglobulinas; Imunosoro, p. ex. soro antilinfoc?tico; / bacteriano;
    ;

MÉTODO, KIT E INICIADORES PARA A IDENTIFICAÇÃO GENÉTICA DE MICOBACTERIUM BOVIS BCG CEPA MOREAU-RJ, MÉTODO PARA MONITORAMENTO DA VIABILIDADE DE BCG MOREAU-RJ E EXPRESSÃO DE GENES, E, PRODUTOS COM ATIVIDADE IMUNOBIOLOGICA - A presente invenção se refere ao mapeamento de inserções, deleções e mutações pontuais de BCG Moreau a partir da determinação da seqüência genômica de BCG Moreau e a sua comparação com o genoma de outras micobactérias. Além disso, a presente invenção identifica seqüências nucleotídicas e peptídicas que proporcionam metodologias para a verificação genética de BCG Moreau, e para a distinção de BCG Moreau de outras micobactérias, inclusive em amostras biológicas e clínicas. A presente invenção fornece, ainda, métodos e kits para a identificação de tais seqüências, dos produtos da expressão destas seqüências ou de anticorpos gerados a partir desta expressão. A invenção ainda proporciona metodologias para o monitoramento e preparação de vacinas e kits para a verificação da transcrição/expressão gênica de determinados antígenos do bacilo. A partir da presente invenção também são proporcionados produtos secundários com atividade imunomoduladora, por exemplo, no tratamento de câncer de bexiga e asma.

Página de 9

Documento

Tabela 3 - Mostra a seqüência dos oligonucleotídeos da presente invenção

Seq.

No.

INDEL

Nome

Bovis

TB (H37Rv)

Sequencia 5'-3'

Inicio

Fim

Inicio

Fim

47

16

RD237

3200739

3200756

tgccggctttctctcgtc

48

16

RD238

3202391

3202410

acggcgttcacagagaaagt

49

18

RD24 4

377047

3770484

ggcgggaaacctctgttta

50

18

RD24 5

3777932

3777952

gcgtcctcaatgaatggttg

51

22

RD247

4285838

7285855

cacgctggacagagctga

52

22

RD24 9

4296369

4296389

cggttacgctggttaatatg

53

22

RD24 8

4286921

4286941

caccggcaatgaaataatctt

54

22

RD250

4295718

4295737

ccgtgaccaatgaattgatg

55

18

RD24 3

3769255

3769274

gccgaggaagatgagaagaa

56

18

RD246

3777006

3777024

ggcgggaaacctctgttta

57

23

RD.235

4306445

4306463

4370077

4370095

ccgcaggaacattagctga

58

23

RD.236

4307879

4307899

4373918

4373938

cagctccacatgatttacgaa

59

23

RD.316

4371762

4371784

ttgatacggtgcatgaattaaat

60

23

RD.317

4372706

4372723

ccgcgatgctaacatgat

61

23

RD.318

4307236

4307253

4370868

4370855

ccgccgtccgaatgttta

62

8

RD.251

1764434

1764451

atggcgaaggggtttgat

63

8

RD.252

1765302

1765322

acgctctgattctggtttgta

64

8

RD.253

1775275

1775294

gggctctcgagtcactgaat

65

8

RD.254

1773564

1773582

ttctcgtcggctaatgaca


ro

ro


LISTAGEM DE SEQÜÊNCIAS

1)    INFORMAÇÕES GERAIS:

I.a) Requerente: Fundação Oswaldo Cruz

I.b) Endereço:    Av. Brasil, 4365, Castelo Mourisco, sala 05 e

06, Manguinhos - 21045-900 - Rio de Janeiro - RJ

II)    Titulo da Invenção:    MÉTODO, KIT E INICIADORES PARA A

IDENTIFICAÇÃO GENÉTICA DE MICOBACTERIUM BOVIS BCG CEPA MOREAU-RJ, MÉTODO PARA MONITORAMENTO DA VIABILIDADE DE BCG MOREAU-RJ E EXPRESSÃO DE GENES, E, PRODUTOS COM ATIVIDADE IMUNOBIOLOGICA

III)    Número de Seqüências: 65 (sessenta e cinco)

IV)    Formato para leitura em computador:

IV.a) Meio utilizado: CD-ROM.

IV.b) Computador utilizado: compativel com IBM PC.

IV.c) Sistema operacional: WINDOWS.

2)    INFORMAÇÕES GERAIS DAS SEQÜÊNCIAS:

I. a) Número identificador da seqüência: ID SEQ 1

II)    Características da seqüência:

II. a) tamanho: 36 bp

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III)    Posição no genoma:

III. a) posição no mapa: 79594-79594 (inserção)

TCGGCGGTGTGGTGCTTGGGCCTGAGAGATTCTCGGGGAGGAGATTGCTC

CTACGGCGCCTCGACATGGAGGTTCTCCCACATCGCGTCAGCGGCTGTTC

GATTGTGACGGAAAGCAACATACACACCACGCATGTGTTTTGTCACCCTG

CGGTCGCTGGTAGTCGGACGGCCCAATCAGACAGCGCGGGTCATATCACG

CGTTCGTGCACAGTTGGGTGTTTATCCACAGGGGTGCGTTTGTCGGCGGC

TGGCGGGGCGTGGCGGCGATAGCATTCGAATATGAGTTCGATCACGGTGT

CGGTGGACCCGGTGGACCCGGTGGACCCGGTGGACCCGGTGGACCCGGTG

GACCCGGTGGACCCGGTGGACCCGGTGGACCCGGTGGACCCGGTGGACGC

CGTGGTCGCCGCGGGATCAGACGGGCTCACTGTGCCCCGCATCGAGTCCG

AGATCGGGGCCTTGGAGTTCCTGAACGAACTGCGCACTGAACTCAAGAGT

GGACAGTTTCGACCTCAACCGGTGCGGGAACGCAAGATCCCCAAACCGGG

CGGGTTGGGCAAGGTACGGCGGCTGGGGATTCCCACAGTGGCCGACCGGG

TCGTTCAGGCGGCGTTGAAACTGGTGCTAGAACCCATCTTTGAGACCGAC

TTCGAGCCGGTCTCCTACGGGTTTCGGCCCGCGCGACGCGCGCACGACAC

I.a) Número identificador da seqüência: ID SEQ 2

II) Caracteristicas da seqüência:

II.a) tamanho: deleção em M. bovis II.b) tipo: ácido nucléico II.c) conformação da fita: fita senso II.d) topologia: linear

III) Posição no genoma:

III.a) posição no mapa: 79594 - ponto de inserção

atcgc

gtcagcggctgttcgattgtgacggaaagcaacatacac

accacgcatgtgttttgtcaccctgcggtcgctggtagt

cggacggcccaatcagacagcgcgggtcatatcacgcgt

tcgtgcacagttgggtgtttatccacaggggtgcgtttg

tcggcggctggcggggcgtggcggcgatagcattcgaat

1

atg

agt

tcg

ate

acg

gtg

tcg

gtg

gac

ccg

31

gtg

gac

ccg

gtg

gac

ccg

gtg

gac

ccg

gtg

61

-

gac

ccg

gtg

gac

ccg

gtg

gac

gcc

gtg

gtc

91

gcc

gcg

gga

tea

gac

ggg

ctc

act

gtg

gcc

121

-

cgc

ate

gag

tcc

gag

ate

ggg

gcc

ttg

gag

151

-

ttc

ctg

aac

gaa

ctg

cgc

act

gaa

ctc

aag

181

-

agt

gga

cag

ttt

cga

cct

caa

ccg

gtg

cgg

211

-

gaa

cgc

aag

ate

ccc

aaa

ccg

ggc

ggg

ttg

241

ggc

aag

gta

cgg

cgg

ctg

ggg

att

ccc

aca

271

-

gtg

gcc

gac

cgg

gtc

gtt

cag

gcg

gcg

ttg

301

-

aaa

ctg

gtg

cta

gaa

ccc

ate

ttt

gag

acc

331

-

gac

ttc

gag

ccg

gtc

tcc

tac

ggg

ttt

cgg

361

-

ccc

gcg

cga

cgc

gcg

cac

gac

acg

ate

gct

391

gag

att

cac

ttg

ttc

ggc

acc

cag

gag

tat

421

-

cgc

tgg

gtg

ctc

gac

gct

gat

ate

aag

gcg

451

-

tgc

ttt

gac

cgc

ate

gac

cac

gcg

gac

ctg

481

atg

gac

cgg

gtg

cgt

cac

cgg

ate

aaa

gac

511

aag

cgg

gtg

ttg

cgg

ctg

gtg

aac

tgg

cag

541

-

cgc

att

cgg

cat

cgc

tgg

aat

tgg

acc

gac

571

-

gtc

cgc

cgc

tgg

ctc

acc

gac

CCC

acc

ggg

601

-

cgg

tgg

cac

ccc

ate

age

gcg

gac

ggg

ate

631

-

acc

ctg

ttt

aac

ccc

gcc

gcg

gtg

cct

att

661

-

cgg

cga

tac

cgc

tat

cgg

ggc

aac

acg

ate

691

-

ccc

act

ccc

tgg

act

cag

gct

gtc

tga

accaccccatcggcagattccgtgaagagccagatacgg

tgaaagtcgcacgtccggttcgaagggcggccacgggaa

acggacccgcagcaacgcgggcaccgcacccatggtcga

cccaactgccacgcacccggtgaccggtgcgaagtccac

catatcgaccagtgggcaaccggcggctcaaccgatatc

gacaa

I.a) Número identificador da seqüência: ID SEQ 3

II) Caracteristicas da seqüência:

II.a) tamanho: deleção

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II.d) topologia: linear

III) Posição no genoma:

III.a) posição no mapa: 425072 - 425173 Região contia Moreau:

CCGGCATGCATGCACAGACCCTGCGTACCTACGATCGTCTTGGGTTGGTC

AGCCCGCGGCGCACCTCCGGTGGCGGGCGCCGCTATTCCCTGCATGACGT

CGAGTTGCTGCGCCAGGTGCAGCACCTCTCGCAGGACGAGGGGGTCAACT

TGGCCGGCATCAAGCGCATTATTGAACTGACCAGTCAGGTCGAGGCGCTG

CAGTCCAGGTTGCAAGAGATGGCTGAGGAGTTGGCGGTGTTGCGTGCCAA

CCAGCGCCGCGAGGTCGCGGTGGTGCCGAAGAGCACCGCCCTGGTCGTCT

GGAAACCGCGCCGGTGAGCGAGCGCGCGTAGCGGGGGAGTTAGGGTCCGC

TACCGTTGTTGAGGATGCCGGAGAGTCGGGCTCCGTGGTTGCCGAAGCCG

GAGATAAGGGCTTGGGTCGCGAGGTCCAGCATGCTCGTGTTGTAGAAACC

GGAGACGGTATTGCCTAGGTTCGCCCAGCCCGACAGCAGGTTGCCGAAGT

TTTGGAAGCCCGAATTCCCTACGCCGCCAGCATTGAAGAAGCCCGAAGTC

TCGGTGAAGACGTTTCCCAGGCCCGACACGGCGGCTGCGGCGTCGTTGAG

GAAGCCCGATGCGCCACCGGCGCCGGAGTTGAAGAAGCCCGACGACGGGG

I.a) Número identificador da seqüência: ID SEQ 4

II) Caracteristicas da seqüência:

II.a) tamanho: 102 bp

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II.d) topologia: linear

III) Posição no genoma:

III.a) posição no mapa: 425072-425173

Região M. bovis (Bovilist):

1    -    gtggcgggcg    ccgctattcc    ctgcatgacg    tcgagttgct    gcgccaggtg    cagcacctct

61    -    cgcaggacga    gggggtcaac    ttggccggca    tcaagcgcat    tattgaactg    accagtcagg

121    -    tcgaggcgct    gcagtccagg    ttgcaagaga    tggctgagga    gttggcggtg    ttgcgtgcca

181    -    accagcgccg    cgaggtcgcg    gtggtgccga    agagcaccgc    cctggtcgtc    tggaaaccgc

241    -    gccggtgagc    gagcgcgcgt    agcgggggag    cgaacggcgc    agttggcacc    agccggtgag

301    -    cgagcgcgcg    tagcggggga    gcgaacggcg    cagttggcac    cagccggtga    gcgagcgcgc

361    -    gtagcggggg    agttagggtc    cgctaccgtt    gttgaggatg    ccggagagtc    gggctccgtg

421    -    gttgccgaag    ccggagataa    gggcttgggt    cgcgaggtcc    agcatgctcg    tgttgtagaa

481    -    accggagacg    gtattgccta

I.a) Número identificador da seqüência: ID SEQ 5

II)    Características da seqüência:

II.a) tamanho: deleção

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III)    Posição no genoma:

III. a) posição no mapa: 581752-581958

Região contig Moreau

CGGGTTGGCCATCGTCAAACACGTCGCGGCTAATCACGACGGCACCATCC GCGTGTGGAGCAAACÇGGGAACCGGGTCAACGTTCACCTTGGCTCTTCCG GCGTTGATCGAGGCCTATCACGACGACGAGCGACCCGAGCAGGCGCGAGA G C C CG AAC T G C GG T C AAAC AG G T C AC AAC G AG AG G AAG AG C T G AGC C G AT GACCTGCGCCGACGACGATGCAGAGCGTAGCGATGAGGTGGGGGCACCAC CCGCTTGCGGGGGAGAGTGGCGCTGATGACCTGCGCCGACGACGATGCAG AGCGTAGCGATGAGGTGGGGGCACCACCCGCTTGCGGGGGAGAGTGGCGC TGATGACCAGTGTGTTGATTGTGGAGGACGAGGAGTCGCTGGCCGATCCG CTGACGTTTCTGCTGCGCAAGGAGGGCTTTGAGGCCACGGTGGTGACCGA TGGTCCGGCAGCTCTCGCCGAGTTCGACCGGGCCGGCGCCGACATCGTCC TGCTCGATCTGATGCTGCCTGGGATGTCGGGTACCGATGTATGCAAGCAG TTGCGCGCTCGGTCCAGCGTTCCGGTGATCATGGTGACCGCCCGGGATAG CGAGATCGACAAGGTGGTCGGCCTGGAGCTGGGCGCTGACGACTACGTGA

I.a) Número identificador da seqüência: ID SEQ 6

II) Características da seqüência:

II.a) tamanho: 207 pb

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear III) Posição no genoma:

III. a) posição no mapa: 581752-581958

Região M. bovis (Bovilist)

1 -    cgggttggcc    atcgtcaaac    acgtcgcggc    taatcacgac    ggcaccatcc    gcgtgtggag

61- -    caaaccggga    accgggtcaa    cgttcacctt    ggctcttccg    gcgttgatcg    aggcctatca

121 -    cgacgacgag    cgacccgagc    aggcgcgaga    gcccgaactg    cggtcaaaca    ggtcacaacg

181 -    agaggaagag    ctgagccgat    gacctgcgcc    gacgacgatg    cagagcgtag    cgatgaggtg

241 -    ggggcaccac    ccgcttgcgg    gggagagtgg    cgctgatgac    ctgcgccgac    gacgatgcag

301 -    agcgtagcga    tgaggtgggg    gcaccacccg    cttgcggggg    agagtggcgc    tgatgacctg

361 -    cgccgacgac    gatgcagagc    gtagcgatga    ggtgggggca    ccacccgctt    gcgggggaga

421 -    gtggcgctga    tgacctgcgc    cgacgacgat    gcagagcgta    gcgatgaggt    gggggcacca

481 -    cccgcttgcg    ggggagagtg    gcgctgatga    cctgcgccga    cgacgatgca    gagcgtagcg

541 -    atgaggagga    gtggcgctga    tgaccagtgt    gttgattgtg    gaggacgagg    agtcgctggc

601 -    cgatccgctg    gcgtttctgc    tgcgcaagga    gggctttgag    gccacggtgg    tgaccgatgg

661 -    tccggcagct    ctcgccgagt    tcgaccgggc    cggcgccgac    atcgtcctgc    tcgatctgat

721 -    gctgcctggg    atgtcgggta    ccgatgtatg    caagcagttg    cgcgctcggt    ccagcgttcc

781 -    ggtgatcatg    gtgaccgccc    gggatagcga    gatcgacaag    gtggtcggcc    tggagctggg

841 -    cgctgacgac    tacgtgacca    agccctattc    ggcacgcgag    ttgatcgcac    gcatccgcgc

901 -    ggtgctgcgc    cgtggcggcg    acgacgactc    ggagatgagc    gatggcgtgc    tggagtccgg

961 -    gccggttcgc    atggatgtgg    agcgccatgt    cgtctcggtg

I.a) Número identificador da seqüência: ID SEQ 7

II)    Características da seqüência:

II.a) tamanho: deleção

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III)    Posição no genoma:

III. a) posição no mapa: 842369-842417

Região contig Moreau

GGCAGCGGCGGGCCCGGCGCCACCGGCCTCGGCGGGATTGGCGGGGCCGG

CGGAGCCGCCTTGCTCTTCGGCTCCGGCGGGGCCGGCGGAAGCGGTGGTG

CCGGCGCGGTCGGTGGCAATGGCGGGGCCGGCGGCAACGCCGGTGCGCTC

TTGGGCGCCGCCGGGGCCGGCGGGGCCGGTGGTGCCGGCGCGGTCGGTGG

CAATGGCGGGGCCGGCGGTAACGGCGGGCTGTTCGCCAACGGGGGAGCCG

GCGGGCCCGGTGGGTTTGGCAGCCCCGCTGGGGCTGGCGGGATCGGCGGG

GCAGGTGGGAACGGCGGGCTGTTCGGCGCCGGCGGGGCGGGCGGCAACGG

CGGGCTGTTCGGCGCCGGCGGCACCGGCGGCGCCGGCAGCCATAGCACCG

CCGCCGGAGTTTCCGGAGGGGCCGGCGGGGCCGGCGGCGACGCCGGCTTG

CTCTCCCTCGGCGCCTCCGGCGGGGCCGGCGGCAGCGGCGGTTCCAGCCT

GACCGCCGCCGGCGTGGTCGGCGGCATCGGCGGCGCCGGAGGCTTGCTCT

TCGGCTCCGGCGGCGCCGGCGGGAGCGGCGGGTTCAGCAACTCTGGCAAC

GGCGGGGCCGGCGGGGCCGGCGGCGACGCGGGTTTGCTCGTCGGCTCCGG

I.a) Número identificador da seqüência: ID SEQ 8

II) Caracteristicas da seqüência:

II.a) tamanho: 48 pb

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II.d) topologia: linear

III) Posição no qenoma:

III.a) posição no mapa: 842369-842417

Região M. bovis (Bovilist):

1 -    gcgggatctt    gttcggcacc    ggcggcaccg    ggggcagcgg    cgggcccggc    gccaccggcc

61 -    tcggcgggat    tggcggggcc    ggcggagccg    ccttgctctt    cggctccggc    ggggccggcg

121 -    gaagcggtgg    tgccggcgcg    gtcggtggca    atggcggggc    cggcggcaac    gccggtgcgc

181 -    tcttgggcgc    cgccggggcc    ggcggggccg    gtggtgccgg    cgcggtcggt    ggcaatggcg

241 -    gggccggcgg    taacggcggg    ctgttcgcca    acgggggagc    cggcgggccc    ggtgggtttg

301 -    gcagccccgc    tggggctggc    gggatcggcg    gggcaggtgg    gaacggcggg    ctgttcggcg

361 -    ccggcgggac    cggcggggcc    ggcgggggaa    gcaccctcgc    cggcggcgcc    ggcggggcgg

421 -    gcggcaacgg    cgggctgttc    ggcgccggcg    gcaccggcgg    cgccggcagc    catagcaccg

481 -    ccgccggagt    ttccggaggg    gccggcgggg    ccggcggcga    cgccggcttg    ctctccctcg

541 -    gcgcctccgg    cggggccggc    ggcagcggcg    gttccagcct    gaccgccgcc    ggcgtggtcg

601 -    gcggcatcgg    cggcgccgga    ggcttgctct    tcggctccgg    cggcgccggc    gggagcggcg

661 -    ggttcagcaa    ctctggcaac    ggcggggccg    gcggggccgg    cggcgacgcg    ggtttgctcg

721 -    tcggctccgg    cggggccggc    ggggccggcg    cctccgccac    cggcgccgcc    accggcgggg

781 -    acggcggggc    cggcggcaag    tccggagcgt    tcggtctcgg    aggtgacggc    ggcgccggcg

841 -    gcgccaccgg    tttgtccggt    gctttccaca    tcggcggcaa    gggcggcgtc    ggcggcagcg

901 -    ccgtgctgat    cggcaacggc    ggcaacggcg    gcaacggcgg    taacagcggt    aacgccggga

961 -    aatccggggg    tgcacccggc    cccagcggcg    ccggcggcgc

I.a) Número identificador da seqüência: ID SEQ 9

II) Caracteristicas da seqüência:

II.a) tamanho: Deleção

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II.d) topoloqia: linear

III) Posição no genoma:

III.a) posição no mapa: 1192598-1192696

Região contiq Moreau

CCGGCACCGGCGCCGCCGCCGCCACCACCCGTACCACCCTTACCGGAAAT

GCCTAGCTGAGTGTCTGCGCCGTTTCCGCCGGCGGCGCCGTTGCCGCCGG

CGCCGCCGTGGCCGGCGTTACCGCCGTGACCGAACAGCGCGGCGCCGCGT

CCGCCGTTGCCGCCGCCGCCAGCGGTGCCGCCGGTGCCGCCGTTGCCGCC

GTTGCCGCCGAAGATGCCGCCCTCTCCGCCGGCACCGGCGTTGCCGCCGC

CGCCGCCGGTGCCGGCGTCGCCGCCGTTGCCGGACAGCCAGCCGGCCGAC

CCGCCGTCGCCGCCGACGCCGCCGTGGCCGTGGATCCAGCCGCCGGCACC

GCCCGCCCCGCCGGCGCCGGCGTCACCGCCCTTGGTGCCGTCGGCCCCGC

CGATGCCGGCGCCGCCTTGTCCGCCGGCCCCGCCGGCACCGCCGGCACCG

CCGTTGCCGAACAATCCGGCCGATCCCCCGGCCCCGCCGGCACCACCCGC

GACGCCCGGCGCGCCGATGGCTCCGGCGGGGCCGGCGCCGCCGGCGCCGC

CATTGCCGCCGCTGCCGTAGAGCCAGCCGCCGTTGCCGCCCGCGCCGCCG

TTGGCGCCGGCTCCGCCGGCCCCTCCGTTGCCGCCGTTGCCGATCAACCC

I.a) Número identificador da seqüência: ID SEQ 10

II)    Características da seqüência:

II.a) tamanho: 99 pb

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III)    Posição no genoma:

III. a) posição no mapa: 1192598-1192696

Região M. bovis (Bovilist)

1 -    ccaccgacgg    ctgtgatgct    gcttccgccg    tttccgctga    ccgcgccgtt    gccgccagcg

61 -    ccgccgtggc    cggcgttacc    gccgtggccg    aacagcacgg    agcctcgtcc    accgttgccg

121 -    ccgttgccgg    cgttgccgcc    gctaccaccg    ttgccaccgt    caccaccttg    tgcggtgcta

181 -    agcccggggg    caccgatccc    gcctttgccg    gcggcgccgc    cgttgccgcc    gttgccgccg

241 -    gccccgccgt    tgccatacag    cagcccgccg    tcgccgccgg    tgccgccggc    accggcgccg

301 -    ccgccgccac    cacccgtacc    acccttaccg    gaaatgccta    gctgagtgtc    tgcgccgttt

361 -    ccgccggcgg    cgccgttgcc    gccggcgccg    ccgtggccgg    cgttaccgcc    gtgaccgaac

421 -    agcgcggcgc    cgcgtccgcc    gttgccgccg    ccgccagcgg    tgccgccggt    gccgccgttg

481 -    ccgccgttgc    cgccgaagat    gccgccctct    ccgccggcac    cggcgttgcc    gccgccgccg

541 -    ccggtgccgg    cgtcgccgcc    gttgccggac    agccagccgg    ccgacccgcc    gtcgccaccg

601 -    cggccgccgg    cqccgcccgc    tccgccqgcq    qcqccggtgt    cgccgggctc    qccctqqacg

661 -    ccgtccccgc    cctgaccgcc    qqttccqccg    tcqccqccqa    cgccgccgtg    gccgtggatc

721 -    cagccgccgg    caccgcccgc    cccgccggcg    ccggcgtcac    cgcccttggt    gccgtcggcc

781 -    ccgccgatgc    cggcgccgcc    ttgtccgccg    gccccgccgg    caccgccggc    accgccgttg

841 - ccgaacaatc cggccgatcc cccggccccg ccggcaccac ccgcgacgcc cggcgcgccg 901 - atggctccgg cggggccggc gccgccggcg ccgccattgc cgccgctgcc gtagagccag 961 - ccgccgttgc cgcccgcgcc gccgttggcg ccggctccgc

I. a) Número identificador da seqüência: ID SEQ 11

II)    Caracteristicas da seqüência:

II. a) tamanho: Deleção

II. b„) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III)    Posição no genoma:

III. a) posição no mapa: 1284836-1284907 Região contig Moreau:

GAACCGGTGTCGGCGATTACGGTCAACGTGGTCGGTCCGTCCGGATTGAT GTCCGAACGCGGCCGCAGGGTGGCGCTGCCGGACTTTCCCGTGGTCAGGT T CACCCACGTGACGT TCAGCGGCAACCTCTGCACGTCGGCGGGCCCCGGC GTGCCGACGGCCGTGAACACGTAGGCGGTCTGGCCGGGTCCGGGACCGGG CAGCGGGATCTTGGCGGGCCCCGCCACCGACAGCGCGGTCGCGATGGAAT TGCTGCCGTCCGCCACACAATTGGGGCCGATCGAGGGGTACATGAAGTCC TGTGTGGGCGGAGCGGCGGCGCGCGGCGCAGGTGGCGCCGGTGGCGGCCC CGGTACCGCAACCGGTTGGGCTGCGTCAGGTGCTGGTGCCGGCGCGGAAG CCGGCGGCGCGGCGACCGGCGGCGTAACCGTAGGTGCCACAGCGGGTGCG GGGCCCGCGGCGTGGGATGGATCGATGCCGGTCGGAAGATGTGCCTGCAC ACCTGGCTCGGCGCCCAGTGGGGGCACATGCGGCACCGGGATGGCCTCGG GCAGGGCGACACCATGAGGCGCCGGCACACCCAGGGCAGCAGAGTCGGGA TTGGTCGGCTCAGCCACAAACTGGTTCACCGAGGAAGCGACGTTCTTGGA