Método, kit e iniciadores para a identificação genética de micobacterium bovis bcg cepa moreau-rj, método para monitoramento da viabilidade de bcg moreau-rj e expressão de genes, e, produtos com atividade imunobiológica

  • Número do pedido da patente:
  • PI 0604958-3 A2
  • Data do depósito:
  • 23/11/2006
  • Data da publicação:
  • 06/06/2006
Inventores:
  • Classificação:
  • A61P 35/00
    Agentes antineopl?sticos;
    ;
    A61K 39/04
    Prepara??es medicinais contendo ant?genos ou anticorpos; / Ant?genos bacterianos; / Mycobacterium, p. ex. Mycobacterium tuberculosis;
    ;
    G01N 33/50
    Investiga??o ou an?lise de materiais por m?todos espec?ficos n?o abrangidos pelos grupos ; / Material biol?gico, p. ex. sangue, urina; Hemocitr?metros; / An?lise qu?mica de material biol?gico, p. ex. sangue, urina; Testes por m?todos envolvendo a forma??o liga??es bioespec?ficas de ligantes; Testes imunol?gicos;
    ;
    C07H 21/04
    Compostos contendo duas ou mais unidades mononucleot?dicas tendo grupos fosfato ou polifosfato separados, ligados por radicais sacar?deos de grupos nucleos?deos, p. ex. ?cidos nucleicos; / com desoxiribosila como radical sacar?deo;
    ;
    C12N 15/31
    Muta??o ou engenharia gen?tica; DNA ou RNA concernentes ? engenharia gen?tica, vetores, p. ex. plasm?deos ou seu isolamento, preparação ou purifica??o; Uso de seus hospedeiros; / Tecnologia do DNA recombinante; / Fragmentos de DNA ou RNA; Suas formas modificadas; / Genes que codificam prote?nas microbianas, p. ex. enterotoxinas;
    ;
    A61K 39/40
    Prepara??es medicinais contendo ant?genos ou anticorpos; / Anticorpos; Imunoglobulinas; Imunosoro, p. ex. soro antilinfoc?tico; / bacteriano;
    ;

MÉTODO, KIT E INICIADORES PARA A IDENTIFICAÇÃO GENÉTICA DE MICOBACTERIUM BOVIS BCG CEPA MOREAU-RJ, MÉTODO PARA MONITORAMENTO DA VIABILIDADE DE BCG MOREAU-RJ E EXPRESSÃO DE GENES, E, PRODUTOS COM ATIVIDADE IMUNOBIOLOGICA - A presente invenção se refere ao mapeamento de inserções, deleções e mutações pontuais de BCG Moreau a partir da determinação da seqüência genômica de BCG Moreau e a sua comparação com o genoma de outras micobactérias. Além disso, a presente invenção identifica seqüências nucleotídicas e peptídicas que proporcionam metodologias para a verificação genética de BCG Moreau, e para a distinção de BCG Moreau de outras micobactérias, inclusive em amostras biológicas e clínicas. A presente invenção fornece, ainda, métodos e kits para a identificação de tais seqüências, dos produtos da expressão destas seqüências ou de anticorpos gerados a partir desta expressão. A invenção ainda proporciona metodologias para o monitoramento e preparação de vacinas e kits para a verificação da transcrição/expressão gênica de determinados antígenos do bacilo. A partir da presente invenção também são proporcionados produtos secundários com atividade imunomoduladora, por exemplo, no tratamento de câncer de bexiga e asma.

Página de 9

Documento

I.a) Número identificador da seqüência: ID SEQ 12

II) Caracteristicas da seqüência:

II.a) tamanho: 72 pb

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II.d) topologia: linear

III) Posição no genoma:

III.a) posição no mapa: 1284836-1284907

Região M. bovis (Bovilist):

1 -    cgaacctgac    gggaacgagt    tgctgcggcg    gcttaagggg    ttacccggct    tcggtgagca

61 -    gaaggcgcgg    atctttctcg    cgttgcttgg    caagcagtac    ggagtgacgc    cgaagggttg

121 -    gcaggtggca    gccggggagt    tcggtcagcc    cggcacctat    ctatccgtcg    ccgatatcgt

181 -    cgacgccggg    tcgcttgggc    aggtgcgatc    gcacaagagg    caaaggaaag    cggcggccaa

241 -    ggcagaggga    aaggcgccaa    cgtgaagaca    cacctgacgt    gtccgtgcgg    cgaagccatc

301 -    accggcaagg    acgaggacga    gctggtcgag    ctgactcagg    cccaccttgc    cagcgttcat

361 -    cccggcctgg    agtacgaccg    cgacgccata    ttgttcatgg    cgtactgatg    gaccattccc

421 -    gctggtgcta    gggcaccacc    gttgagccga    tcgtcggcat    gaactggcac    tgccggtcct

481 -    tggtggtcac    ctgcccgaag    atcgttgaca    tgatgctgcc    tgaaccggtg    tcggcgatta

541 -    cggtcaacgt    ggtcggtccg    tccggattga    tgtccgaacg    cggccgcagg    gtggcgctgc

601 -    cggactttcc    cgtggtcagg    ttcacccacg    tgacgttcag    cggcaacctc    tgcacgtcgg

661 -    cgggccccgg    cgtgccgacg    gccgtgaaca    cgtaggcggt    ctggccgggt    ccgggaccgg

721 -    gcagcgggat    cttggcgggc    cccgccaccg    acagcgcggt    cgcgatggaa    ttgctgccgt

781 -    ccgccacaca    attggggccg    atcgaggggt    acatgaagtc    ctgtgtgggc    qqagcgtcgg

841 -    cgccgaaqcc    cgaggcaggc    qccggagcgg    ccgctggcgc    cggtgccgcc    qaqgccggcq

901 -    ccggagcqqc    ggcgcgcggc    gcaggtggcg    ccggtggcgg    ccccggtacc    gcaaccggtt

961 -    gggctgcgtc    aggtgctggt    gccggcgcgg    aagccggcgg

I.a) Número identificador da seqüência: ID SEQ 13

II)    Caracteristicas da seqüência:

II.a) tamanho: Deleção

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III)    Posição no genoma:

III. a) posição no mapa: 1764646-1773892

Região contig Moreau:

CGGGACGGCCGTCGCGGATTGACGGTCGGTTCGCCGGCTTGCGCCGCTGG

GACGGCAACACGCGTGCCGAGTACCTGCTGGGGTGAGGCGGGCCCAAAAA

GCTTGATGGCGAAGGGGTTTGATCGCAACTTCGTCTTAATGGCCAGCTCG

CGGGTTCGGGCGGGTGCTGGCCAGGTGGCGAGGACGCACGTCGATGTGGG

GATGTCCAAAGATCTTCGCGGGCGGCGATTCTCACGGATCGTCGTGGTTG

TCCTCGTCGTTGTGGCGTAGCAGCTTCTCGTGGTGGTGGAAGGTGTTGGT

GCGGGGTTGGCCGTGGTCGAGGTGGGGTGGTGGTAGCCATTCGGTGTGGC

CGTGGGTGTTTTTGCGGGTGGTCCAGCCTTTTTCGGCGAGTCGGTTGTCG

GGGTCGCAGGCCAGGGTCAGCTCGGTGATGTCGGTGCGTCCGGTGCTGGT

CCAGCCGGTGACGTGGTGGGCTTGGCTGTGGTAGGCCGGTGCGTCACAGC

CGGGTTTGGTGCAGCCGCGGTCGTTGGCGAACAGCATGATCCGCTGGGCC

GGGGAGGCTAGGCGTTTGGTGTGATACAGCGCCAGGGGTGTGCCGTGGTC

GAAGATCGCCTGGGGGTACCTCCCGCTTGCGGGGGAGTAGTGGTGGGCGT

I. a) Número identificador da seqüência: ID SEQ 14

II)    Características da seqüência:

II. a) tamanho: 9246 pb

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III)    Posição no genoma:

III. a) posição no mapa: 1764646-1773892 Região M. bovis (Bovilist):

Coordenadas do Bovilist (seq muito grande): 1764646-1773892 ORFs envolvidas: Mbl598A, Mbl599, Mbl600, Mbl601, Mbl602c, Mbl603c, Mbl604c, Mbl605c, Mbl606c, Mbl607c, Mbl608c, Mbl609c, Mb1610c, Mbl611c, Mbl612c, Mbl613c

I. a) Número identificador da seqüência: ID SEQ 15

II)    Características da seqüência:

II. a) tamanho: Deleção

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III)    Posição no genoma:

III. a) posição no mapa: 1940956-1941070 Região contig Moreau:

TAGTCGTCAAAGTATTTGGTGCGGACCGCGTTTCCGTACACCATTGCCTG

CGCCACGGCCGGTGAAACGTCCGCGATCGTCGACATGTCGAGTTCACCGT

CCATCATCTTGGTGAACAAATCCAGCCCCACCGCACGGACCAGGGGTTCG

GCGAACGGATCGTTGATCAAACCGCGCGGATCCTTGGTGGCCAGCGCACG

CCCGACCGCGACAATGGTCGCGGTGACGCCGACGCTAGACGTCAGATCCC

AGTTGTCGTCGTCGGTGCGGGCCACCAGCCCACCCTAGTCTGATTGCCCG

GTTCCTCCTCGCGCCGCAAACCAAGCCGGCTGGTGCTGTGCTATTGGCGT

CGGAACAGACGGCCGTGCTGGCTACAGAACCAGGCGATGTTGCCGTCCGG

CCCGCGCACGAAGTTGGAGCGACTGCCGGTGGGCTTGTTGTCGGGTCCAA

GGTCGAGCCCATAGTCGGGCCGATAGAAGGCGAGGCCCAGATTGGCGCTG

TTTTGGCCATCCGGGTTGGCATCGTCGGTGCTCATGCTTCCAGCAAGCTG

GCCGTCCCTGGCCCGGAAGTCGATGACCGTTGTCTCGAGGTCGCCATTTT

GGGCGACTTGCTTGGCGATGTACCGGCCCTCGTAGGGCGCCAGGTCGACG

I.a) Número identificador da seqüência: ID SEQ 16

II) Características da seqüência:

II.a) tamanho: 114 pb

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II.d) topologia: linear

III) Posição no genoma:

III.a) posição no mapa: 1940956-1941070

Região M. bovis (Bovilist):

1 -    ttgccgaatc    cccccagcgg    tggcgttaag    gagatagtcg    tcaaagtatt    tggtgcggac

61 -    cgcgtttccg    tacaccattg    cctgcgccac    ggccggtgaa    acgtccgcga    tcgtcgacat

121 -    gtcgagttca    ccgtccatca    tcttggtgaa    caaatccagc    cccaccgcac    ggaccagggg

181 -    ttcggcgaac    ggatcgttga    tcaaaccgcg    cggatccttg    gtggccagcg    cacgcccgac

241 -    cgcgacaatg    gtcgcggtga    cgccgacgct    agacgtcaga    tcccagttgt    cgtcgtcggt

301 -    gcgggccacc    agcccaccct    agtctgattg    cccggttcct    cctcgcgccg    caaacggcgc

361 -    gcatcgtcac    cgggcg-tcgt    ctgattgccc    ggttcctcct    cgcgccgcaa    acggcgcgca

421 -    tcgtcaccgg    gcgtcgtctg    attgcccggt    tcctcctcgc    gccgcaaacc    aagccggctg

481 -    gtgctgtgct    attggcgtcg    gaacagacgg    ccgtgctggc    tacagaacca    ggcgatgttg

541 -    ccgtccggcc    cgcgcacgaa    gttggagcga    ctgccggtgg    gcttgttgtc    gggtccaagg

601 -    tcgagcccat    agtcgggccg    atagaaggcg    aggcccagat    tggcgctgtt    ttggccatcc

661 -    gggttggcat    cgtcggtgct    catgcttcca    gcaagctggc

I.a) Número identificador da seqüência: ID SEQ 17

II)    Características da seqüência:

II.a) tamanho: Deleção

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso-

II. d) topologia: linear

III)    Posição no genoma:

III. a) posição no mapa: 1980768-1980803

Região contig Moreau:

CCACTCAGCCCGACACCGATCGGACGTCGTGACCGGCGGGACCGAGAACT

GCTCGATCCGCAACAACGCCGCGACGTGGATTGTGTCCCATGGTGAGCTG

TGACTTGGAGTGCGGGTGGTGAGCTGAAGGCCCGTTGTCGACCGAAACGG

GGCGACGTCCGCGACTTCCTGTACAACCTGATGCTCTGGGATTTGGGCTG

CGGATGCGCGGCGGGGGTTCGCTCTGGTGTCGTCGGTGTTCCGCCGCGCT

ACGTCAAGCCGTGCTGCCCATCCCGGCCGAGTACCAGCCCACCGGCGCCG

CCGGCACCCGCCGTGCCCCCGGCTTTTCCGGCATTGCCGCCGGCTCCACC

CTTGCCGCTGGTGGCGCCATCCCCGCCGGCGCCACCGTCACCGCCGTTGC

I. a) Número identificador da seqüência: ID SEQ 18

II)    Características da seqüência:

II. a) tamanho: 36 pb

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III)    Posição no genoma:

III. a) posição no mapa: 1980768-1980803

Região M. bovis (Bovilist) :

1    -    ccggtattta    cgacgcgggc    acccatgtcg    aacagacggc    ggcgaactgt    ccccaaagca

61    -    agctggtgct    cggcggattt    tcccaaggtg    cggccgtgat    gggctttgtt    accgcggcgg

121    -    cgattccgga    tggggcgccg    ttggacgcgc    ccaggccgat    gccgcccgaa    gtcgccgacc

181    -    acgtggccgc    cgtcacactc    ttcggaatgc    cctcggttgc    gttcatgcac    tcgatcggcg

241    -    cgccgccgat    cgtcatcggt    ccgctatatg    cagaaaagac    catccagctg    tgcgccccgg

301    -    gcgaccccgt    ctgttctagc    ggaggcaatt    gggcggcgca    taacgggtac    gccgacgacg

361    -    gcatggtcga    gcaggccgca    gtgtttgccg    ccggtcggct    cggttaaggc    agtgtcagcc

421    -    actcgccact    cagcccgaca    ccgatcggac    gtcgtgaccg    gcgggaccga    gaactgctcg

481    -    atccgcaaca    acgccgcgac    gtggattgtg    tcccatggtg    agctgtgact    tggagtgcgg

541    -    gtggtgagct    gaaggcccgt    tgtcgaccga    aacggggcga    cgtccgcgac    ttcctgtaca

601    -    acctgatgct    ctgggatttg    ggctgcggat    gcgcggcggg    ggttcgctct    ggtgtcgtcg

661    -    gtgttccgcc    gcgctacgtc    aagccgtgct    gcccatcccg    gccgagtacc    agcccaccgg

721    -    cgccgccggc    acccgccgtg    cccccggctt    ttccggcatt    qccqccgttg    ccqocgttgc

781    -    cgatcaccac    ggcgttgcog    ccggctccac    ccttgccgct    ggtggcgcca    tccccgccgg

I.a) Número identificador da seqüência: ID SEQ 19

II) Características da seqüência:

II.a) tamanho: Deleção

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III) Posição no genoma:

III. a) posição no mapa: 1980909-1980923

CGTACAGCCCGGCCTTGCCGCCGGCGCCGCCGTTCCCGCCGGCGCCGCCG

GCGCCGCCGGCGCTGCCGAAGCCGCTGCGAAGGCCGGTGATTTGGCCGGC

CCCACCGGTGCCGCCATCACCGCCAGTGCCATTGAGGCTGTAGCCCCCGT

TGCCGCCGGCCCCGCCGGAGCCGTAGAACAATCCCGCGCTGCCGCCGGCG

CCGCCAGCACCGGCCTTGCCTGACAGGCTGGAGCCGCCGCTGCCGCCGGC

I. a) Número identificador da seqüência: ID SEQ 20

II)    Características da seqüência:

II. a) tamanho: 15 pb

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III)    Posição no genoma:

III. a) posição no mapa: 1980909-1980923

841 - cgccaccgtc accgccgttg ccgtacagcc cggccttgcc gccggcgccg ccgttcccgc 901 - cggcgccggt atcgctggcg ccgccggcgc cgccggcgcc gccgaagccg ctgcgaaggc 961 - cggtgatttg gccggcccca ccggtgccgc catcaccgcc

I. a) Número identificador da seqüência: ID SEQ 21

II) Características da seqüência:

II. a) tamanho: Deleção

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II.d) topologia: linear

III) Posição no genoma:

III.a) posição no mapa: 2321316-2321393 Região contig Moreau:

GCCGCGGTGAACGCCGTCATCGAGCAGTCGAATGCCATGGCCGACCATGT

GGGAGCAACCGCGATGTCCAACATTATCGACGCGACGCAACGAGTGTTCG

ACGAGACCATCGGTGGTGACGCCCACACCTGGTTGCGTGACCACGGTGTA

AGCCTCGACGCTCCCGCGCGGCCACGCCCAGTGACCGCTGAAGACATGAC

TTCTATGACGGCGAACTCGCCTGCAGGATCCCCATTCGGTGCTGCTCCGT

CTGCGCCCAGTCATTCGACGACAACCAGCGGCCCGCCGACAGCTCCAACA

CCAACATCACCATTCGGCACTGCTCCCATGCCGCCCGGCCCACCCCCACC

GGGTACCGTCTCACCACCCCTACCCCCCAGCGCCCCCGCCGTTGGTGTTG

GTGGCCCGTCAGTACCGGCCGCTGGCATGCCACCAGCAGCGGCGGCGGCA

ACAGCGCCGTTATCCCCACAGTCGTTGGGCCAGTCGTTCACCACCGGGAT

GACGACGGGCACGCCGGCCGCGGCCGGTGCACAGGCGCTGTCGGCAGGGG

CGCTGCACGCGGCAACCGAACCCCTGCCGCCACCGGCGCCACCCCCGACG

ACACCCACGGTCACCACACCGACAGTCGCGACCGCCACCACGGCCGGGAT

I.a) Número identificador da seqüência: ID SEQ 22


II) Caracteristicas da seqüência:

II.a) tamanho: 78 pb

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II.d) topologia: linear

III) Posição no genoma:

III.a) posição no mapa: 2321316-2321393

Região M. bovis (Bovilist):

1

gtg

gcg

ggt

gat

ctg

cca

ccc

ggt

cgg

tgg

31

-

tcg

gcg

ctc

ttg

gtg

ggt

gcg

tgg

tgg

ccg

61

-

gcg

cgg

ccc

gat

gcg

ccg

atg

gcc

ggg

gtg

91

acg

tat

tgg

cgt

aag

gcg

gcc

cag

ctc

aag

121

cgc

aac

gag

gcc

aac

gac

ctg

cgc

aac

gag

151

cga

tcc

ctg

tta

gcg

gta

aac

caa

ggg

cgc

181

-

acc

gcc

gac

gat

ttg

ttg

gag

cga

tat

tgg

211

-

cgc

ggc

gaa

cag

cga

cta

gcc

acc

ate

gcg

241

-

cat

cag

tgc

gag

gtc

aaa

age

gac

caa

age

271

gag

caa

gtc

gcg

gat

gcg

gtg

aac

tat

ttg

301

-

cgg

gat

cgg

ctg

acc

gag

ate

gea

caa

tcc

331

ggc

aat

cag

caa

ate

aac

caa

ate

ctg

gcc

361

-

ggc

aaa

ggg

ccg

ata

gag

gcc

aaa

gtt

gcc

391

-

gcg

gtg

aac

gcc

gtc

ate

gag

cag

tcg

aat

421

-

gcc

atg

gcc

gac

cat

gtg

gga

gea

acc

gcg

451

-

atg

tcc

aac

att

ate

gac

gcg

acg

caa

cga

481

-

gtg

ttc

gac

gag

acc

ate

ggt

ggt

gac

gcc

511

-

cac

acc

tgg

ttg

cgt

gac

cac

ggt

gta

age

541

-

ctc

gac

gct

ccc

gcg

cgg

cca

cgc

cca

gtg

571

-

acc

gct

gaa

gac

atg

act

tet

atg

acg

gcg

601

-

aac

tcg

cct

gca

gga

tcc

cca

ttc

ggt

gct

631

-

gct

ccg

tet

gcg

CCC

agt

cat

tcg

acg

aca

661

-

acc

age

ggc

ccg

ccg

aca

gct

cea

aca

cca

691

-

aca

tea

cca

ttc

ggc

act

gct

ccc

atg gtg

721

-

cta

agt

tea

tet

tea

aca

agt age

ggc

li

751

-

ccq

aca

>0

0

(+

cca

aca

cca

aca

tea

cca

ttc

781

-

ggc

act

gct

ccc

atg

ccg

ccc

ggc

cca

ccc

811

-

cca

ccg

ggt

acc

gtc

tea

cca

ccc

cta

ccc

841

-

ccc

age

gcc

ccc

gcc

gtt

ggt

gtt

ggt

ggc

871

-

ccg

tea

gta

ccg

gcc

gct

ggc

atg

cca

cca

901

-

gca

gcg

gcg

gcg

gca

aca

gcg

ccg

tta

tcc

931

-

cca

cag

tcg

ttg

ggc

cag

tcg

ttc

acc

acc

961

-

ggg

atg

acg

acg

ggc

acg

ccg

gcc

gcg

gcc

991

-

ggt

gca

cag

gcg

ctg

tcg

gca

ggg

gcg

ctg

1021

-

cac

gcg

gca

acc

gaa

CCC

ctg

ccg

cca

ccg

1051

-

gcg

cca

CCC

ccg

acg

aca

CCC

acg

gtc

acc

1081

-

aca

ccg

aca

gtc

gcg

acc

gee

acc

acg

gcc

1111

-

ggg

att

ccc

cac

ate

ccc

gac

age

gcg

ccg

1141

-

acc

CCC

age

ccg

gca

ccg

ate

gcg

cca

cca

1171

-

acc

acc

gac

aac

gcc

age

gcc

atg

aca

ccc

1201

-

ate

gcg

ccc

atg

gtc

gct

aat

ggc

ccg

cca

1231

-

gca

tcc

ccg

gcc

CCC

ccg

gcc

gcc

gcc

CCC

1261

-

gcg

ggg

cca

ctg

ccc

gcc

tac

ggc

gcc

gac

1291

-

ctg

cgc

cca

ccg

gta

acc

aca

ccc

cct

gee

1321

-

acg

cca

ccc

acc

cca

acc

gga

ccc

ate

tcc

1351

-

ggt

gcc

gcg

gtc

aca

ccc

tcc

tea

CCC

gca

1381

-

gca

ggc

ggc

tea

cta

atg

tea

ccc

gtc

gtc

1411

-

aac

aaa

tcc

acc

gca

cca

gcc

acc

acc

cag

1441

-

gcc

caa

CCC

age

aac

cca

aca

cea

ccg

cta

1471

-

gcc

age

gcc

acc

gcg

gcc

gcc

acc

acc

ggc

1501

-

gcc

gca

gcc

gga

gac

acc

tcc

cgc

cga

gcc

1531

-

gcc

gaa

caa

caa

cgc

cta

cgc

cgc

ate

ctc

1561

-

gac

acc

gtc

gcc

cgc

caa

gaa

ccc

gga

tta

1591

-

tcg

tgg

gct

gcc

ggg

cta

cgc

gac

aac

ggc

1621

-

caa

acc

acc

ctg

ctg

gtc

acc

gac

ctc

gcc

1651

-

age

ggc

tgg

ate

CCC

cca

cac

att

cgc

cta

1681

-

ccc

gcc

cac

ate

acc

ctg

ctc

gaa

ccg

gcc

1711

-

ccc

cga

cgc

cgc

cac

gcc

acc

gtc

acc

gac

1741

-

cta

ctg

ggc

acc

acc

acc

gta

gcc

gcg

gca

1771

-

cac

cac

ccc

cac

ggc

tac

ctc

age

caa

ccc

1801

-

gac

ccc

gac

aca

CCC

gca

ctc

acc

ggc

gac

1831

-

cgc

aca

gca

cgc

ate

gca

CCC

aca

ate

gac

1861

-

gaa

ctc

gga

CCC

acc

ctg

gtc

gaa

acg

gta

1891

-

cgc

cgc

cac

gac

aca

ctg

ccc

cgc

ate

gcc

1921

-

caa

gcc

gta

gta

gtg

gcc

gcc

acc

cgc

aac

1951

-

tac

ggc

gtc

CCC

gac

aac

gaa

acc

gac

ctc

1981

-

tta

cac

cac

aaa

acc

acc

gag

ate

cac

caa

2011

-

gcc

gta

ctg

acc

acc

tac

CCC

aac

cac

gac

2041

-

ate

gcc

acg

gtg

gtc

gat

tgg

atg

ctg

ttg

2071

-

gcg

gcg

ate

aac

gca

ctg

ate

gca

ggc

gac

2101

-

cag

tcg

ggg

gcg

aac

tat

cac

ctt

gcc

tgg

2131

-

gcg

ate

gcc

gcg

ata

tea

acg

agg

aga

tcc

2161

-

aga

tga

I.a) Número identificador da seqüência: ID SEQ 23 II) Caracteristicas da seqüência:

II.a) tamanho: Deleção

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III) Posição no genoma:

III. a) posição no mapa: 2382327-2382442

Região contig Moreau:

GCGACCCAGCGTGCGCACTCGGCCTCACCCTTGGTGGTCCCGGGTTCGCC

ACTGTTGGTGGTATCGAACCGGATTAGCCTGCTGACGACCTGGGCGACAT

CATCGCTGTGGTCGCTTGAAGCCCCGGTCTCATCTGTCACAGTCACCTTT

CCTACCACTCGTAACCCTGGCGAGCCGATCGCCCCTGGCGCGCCGGGCCC

GCGTCGTCGCCGAGCTGGATTTGCTTACGTGGGCTGATTGCCTGGCTCCT

CCTCACCCCGTTACCCGGGGCGCATCGTCGCCGAGCTCGATTTGATTGCC

CGGCTCCTCCTCACCCCGTTACCCGGGGCGCATCGTCGCCGAGCTAGGTT

GGGCCGGTGCGGGGCAATCCGATAGCCTTAGCTGCCAGCCCTGGTGGTTG

GTTGGTCCGAGTGGCGGAATGGCAGACGCGCTAGCTTGAGGTGCTAGTGC

CCTACTAATGGGCGTGGGGGTTCAAGTCCCCCCTCGGACACAACTTCTTA

GCTCTATAGATCAAAACCAAGCCTTGACCTCGTCAAGGACTAACGTTATG

AGTTTGCTCATACCAACGATGGTCATCTCGTTGATGTCCTAATACCTAAG

AACTCACCGATCACTCGAAGGTGCGGCCAGAGATCTCAGCCTCGACCGCG

I.a) Número identificador da seqüência: ID SEQ 24

II) Características da seqüência:

II.a) tamanho: 116 pb

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II.d) topologia: linear

III) Posição no genoma:

III.a) posição no mapa: 2382327-2382442

Região M. bovis (Bovilist):

1 -    ggcctcaccc    ttggtggtcc    cgggttcgcc    actgttggtg    gtatcgaacc    ggattagcct

61 -    gctgacgacc    tgggcgacat    catcgctgtg    gtcgcttgaa    gccccggtct    catctgtcac

121 -    agtcaccttt    cctaccactc    gtaaccctgg    cgagccgatc    gcccctggcg    cgccgggccc

181 -    gcgtcgtcgc    cgagctggat    ttgcttacgt    gggctgattg    cctggctcct    cctcaccccg

241 -    ttacccgggg    cgcatcgtcg    ccgagctcga    tttgattgcc    cggctcctcc    tcaccccgtt

301 -    acccggggcg    catcgtcgcc    gaqctcgatt    tgattgcccg    gctcctcctc    accccgttac