Método, kit e iniciadores para a identificação genética de micobacterium bovis bcg cepa moreau-rj, método para monitoramento da viabilidade de bcg moreau-rj e expressão de genes, e, produtos com atividade imunobiológica

  • Número do pedido da patente:
  • PI 0604958-3 A2
  • Data do depósito:
  • 23/11/2006
  • Data da publicação:
  • 06/06/2006
Inventores:
  • Classificação:
  • A61P 35/00
    Agentes antineopl?sticos;
    ;
    A61K 39/04
    Prepara??es medicinais contendo ant?genos ou anticorpos; / Ant?genos bacterianos; / Mycobacterium, p. ex. Mycobacterium tuberculosis;
    ;
    G01N 33/50
    Investiga??o ou an?lise de materiais por m?todos espec?ficos n?o abrangidos pelos grupos ; / Material biol?gico, p. ex. sangue, urina; Hemocitr?metros; / An?lise qu?mica de material biol?gico, p. ex. sangue, urina; Testes por m?todos envolvendo a forma??o liga??es bioespec?ficas de ligantes; Testes imunol?gicos;
    ;
    C07H 21/04
    Compostos contendo duas ou mais unidades mononucleot?dicas tendo grupos fosfato ou polifosfato separados, ligados por radicais sacar?deos de grupos nucleos?deos, p. ex. ?cidos nucleicos; / com desoxiribosila como radical sacar?deo;
    ;
    C12N 15/31
    Muta??o ou engenharia gen?tica; DNA ou RNA concernentes ? engenharia gen?tica, vetores, p. ex. plasm?deos ou seu isolamento, preparação ou purifica??o; Uso de seus hospedeiros; / Tecnologia do DNA recombinante; / Fragmentos de DNA ou RNA; Suas formas modificadas; / Genes que codificam prote?nas microbianas, p. ex. enterotoxinas;
    ;
    A61K 39/40
    Prepara??es medicinais contendo ant?genos ou anticorpos; / Anticorpos; Imunoglobulinas; Imunosoro, p. ex. soro antilinfoc?tico; / bacteriano;
    ;

MÉTODO, KIT E INICIADORES PARA A IDENTIFICAÇÃO GENÉTICA DE MICOBACTERIUM BOVIS BCG CEPA MOREAU-RJ, MÉTODO PARA MONITORAMENTO DA VIABILIDADE DE BCG MOREAU-RJ E EXPRESSÃO DE GENES, E, PRODUTOS COM ATIVIDADE IMUNOBIOLOGICA - A presente invenção se refere ao mapeamento de inserções, deleções e mutações pontuais de BCG Moreau a partir da determinação da seqüência genômica de BCG Moreau e a sua comparação com o genoma de outras micobactérias. Além disso, a presente invenção identifica seqüências nucleotídicas e peptídicas que proporcionam metodologias para a verificação genética de BCG Moreau, e para a distinção de BCG Moreau de outras micobactérias, inclusive em amostras biológicas e clínicas. A presente invenção fornece, ainda, métodos e kits para a identificação de tais seqüências, dos produtos da expressão destas seqüências ou de anticorpos gerados a partir desta expressão. A invenção ainda proporciona metodologias para o monitoramento e preparação de vacinas e kits para a verificação da transcrição/expressão gênica de determinados antígenos do bacilo. A partir da presente invenção também são proporcionados produtos secundários com atividade imunomoduladora, por exemplo, no tratamento de câncer de bexiga e asma.

Página de 9

Documento

361 -    ccggggcgca    tcgtcgccga    gctcgatttg    attgcccggc    tcctcctcac    cccgttaccc

421 -    ggggcgcatc    gtcgccgagc    taggttggqc    cggtgcgggg    caatccgata    gccttagctg

481 -    ccagccccgg    tggttggttg    gtccgagtgg    cggaatggca    gacgcgctag    cttgaggtgc

541 -    tagtgcccta    ctaatgggcg    tgggggttca    agtcccccct    cggacacaac    ttcttagctc 601 - tatagatcaa aaccaagcct tgacctcgtc aaggactaac gttatgagtt tgctcatacc 661 - aacgatggtc atctcgttga tgtcctaata cctaagaact caccgatcac tcgaaggtgc 721 - ggccagagat ctcagcctcg accgcgttcg ggttctccat tccgtgccga acagccagta 781 - tgtcgatagc ctcgtcggtc gtccgatagg caacgtagta cctgaagggc cggaggtaga 841 - tgtgtcgata gtgcttgaat aacggcgcaa acgcgttcgg agcctgcgga atccgcttcg 901 - tcacggcatc gacaaacaag ttgtaaagcc gatcgatctg atctggcgcc gcgtccgcgt 961 - agtaggaaaa cgcctcgaat aggtcgtctt caaccccgtt

I.a) Número identificador da seqüência: ID SEQ 25

II)    Caracteristicas da seqüência:

II.a) tamanho: Deleção

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III)    Posição no genoma:

III. a) posição no mapa: 3011662-3011835

Região contig Moreau:

CGGCGGCTTCGGCGACACCGGTGGGACCGGCGGCGACGGCGGCAGCGGCG

GGCTGTTTGGCGTCGGCGGGGCCGGCGGGCACGGTGGCTTCGGCAGTGCT

GCCGGCGGCGACGGCGGCGCGGGCGGCGCCGGCGGCACGGTCTTCGGCTC

GGGCGGGGCCGGCGGTGCAGGCGGAGTCGCCACTGTCGCTGGCCACGGTG

GTCACGGCGGTAATGCCGGCCTGCTATACGGCACCGGTGGGGCCGGCGGA

GCCGGCGGGTTCGGAGGGTTCGGCGGCGACGGCGGCGACGACGGTATCGG

CGGGTTGGTCGGCGAGGGCGGCAACGGCGGCGACGGCGGTGCCACGATAG

CAGGAAAGGGTGGTAGCGGCGGTAACGGCGGCAACGCCTGGCTGACGGGC

CAGGGCGGCAACGGCGGCAACGCCGCATTTGGCAAAGCCGGGACTGGCAG

CGTCGGCGTCGGTGGCGCCGGCGGGCTGCTGGAGGGCCAGAACGGCGAGA

ACGGATTGCTGCCTAGCTGAGCCAGCTTAGCCGCAGCTTGGCCTCAGCCA

CCGGGCGTGCGGCGGCCCATCGACCGAGGCACGTCGAAATCGGTGCACAA

CGCCCACCACGCGACGCGGGGCTCAACCCCGTCCTCGATCGCGCAGATGG

I.a) Número identificador da seqüência: ID SEQ 26

II) Caracteristicas da seqüência:

II.a) tamanho: 174 pb

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II.d) topologia: linear

III) Posição no genoma:

III.a) posição no mapa: 3011662-3011835

Região M. bovis (Bovilist):

1 -    ctccggccag    aagggcggta    acggaggagc    tgccggattg    tttggcaacg    gcggggccgg

61 -    cggtgccggc    gcgtccaacc    aagccggcaa    cggcggcgcc    ggcggaaacg    gcggcgccgg

121 -    tgggctgatc    tggggcaccg    cggggaccgg    tggcaacggc    gggttcacca    cctttcttga

181 -    tgccgctggg    ggtgccggcg    gggccggcgg    cgccggtggg    ctgttcggcg    cgggcggggc

241 -    cggcggcgta    ggcggcgccg    ccctcggcgg    cggcgcccag    gccgccggtg    gcaacggcgg

301 -    tgcgggcggg    gtcggtgggc    tgttcggcgc    cggcggtgcc    ggcggcgccg    gcggcttcgg

361 -    cgacaccggt    gggaccggcg    gcgacggcgg    cagcggcggg    ctgtttggcg    tcggcggggc

421 -    cggcgggcac    ggtggcttcg    gcagtgctgc    cggcggcgac    ggcggcgcgg    gcggcgccgg

481 -    cggcacggtc    ttcggctcgg    gcggggccgg    cggtgcaggc    ggagtcgcca    ctgtcgctgg

541 -    ccacggtggt    cacggcggta    atgccggcct    gctatacggc    accggtgggg    ccggcggagc

601 -    cggcgggttc    ggagggttcg    gcggcgacgg    cggcgacgac    ggtatcggcg    ggttggtcgg

661 -    ttctggcggc    gccggcggca    gcggcggcac    cggtacccta    agtggtggtc    gcggcggggc

721 -    cggcggtaac    gccggoacgt    tctacggttc    cggcggcgcc    ggcggcgccg    gcggggagag

781 -    cgacaacggc    gacggcggaa    acggcggcgt    gggcggcaag    gccgggttgg    tcggcqaqqq

841 -    cggcaacggc    ggcgacggcg    gtgccacgat    agcaggaaag    ggtggtagcg    gcggtaacgg

901 -    cggcaacgcc    tggctgacgg    gccagggcgg    caacggcggc    aacgccgcat    ttggcaaagc

961 -    cgggactggc    agcgtcggcg    tcggtggcgc    cggcgggctg

I.a) Número identificador da seqüência: ID SEQ 27

II)    Caracteristicas da seqüência:

II.a) tamanho: Deleção

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III)    Posição no genoma:

III. a) posição no mapa: 3120022-3120075

Região contig Moreau:

ACTCCTTTGGTGGTGCCGGCGGCGCCGGAGGCGACGGCGCCAACGGCGGC

GACGGTGGCGCTGGCGGGGAAGCCCTCACCGAAGGCGGTGCCACCGCCGT

TAGTGGTGCTGGTGGTAAGGGAGGTAACGCCGAGGCTTCCGGCGGCGCCG

GCGGCAACGGCGGCAAAGGTGGCTTTGCTCAGGCCACCACCAGCGTGACC

GGGGGTAACGGCGGTAACGGTGGCAATGGCCACGACAGTACCGCGCCGGG

CGGCGCTGGCGGCAGCGGTGGCGTCGGCGGTGACGGCGGCCGTGGCGGCC

TGCTGGCCGGCAACGGCGGCACCGGCGGCGCCGGCGGCAAAGCCGACATC

GCCAACAGCCTCGGCGACAATGCCACCGTAACCGGGGGCAATGGCGGGAC

AGGCGGAGACGGCGGCAGCGCGCTGGGCACCGGGGGGGCTGGGGGTGCCG

GAGGTCTAGGTGGTCACGGGGGTGCAGGCGGGCTGCTGATTGGCAACGGC

GGCGCCGGTGGCGCTGGCGGCCTCGGCGGTGCGGGCGGCGCCGGCGGTGC

GGGCGGTGAGGGCGGTGCCGGCGGCGCCGGAGGCGAAGCTATTCCCGGCG

GGGCGTCCACCAACTCCGCCGGCGGTGACGGAGGGGCGGGCGGTACTGGC

I.a) Número identificador da seqüência: ID SEQ 28

II) Características da seqüência:

II.a) tamanho: 54 pb

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II.d) topologia: linear

III) Posição no genoma:

III.a) posição no mapa: 3120022-3120075

Região M. bovis (Bovilist):

1 -    gtggcaatgg    ccacgacagt    aacgcgccgg    gcggcgctgg    cggcagcggt    ggcgtcggcg

61 -    gtgacggcgg    ccgtggcggc    ctgctggccg    gcaacggcgg    caccggcggt    gccggtggca

121 -    acggcgqtac    cggtqqcqcc    gqtgcccccg    gcggtqccgg    cggcgccqgc    ggcaaagccg

181 -    acatcgccaa    cagcctcggc    gacaatgcca    ccgtaaccgg    gggcaatggc    gggacaggcg

241 -    gagacggcgg    cagcgcgctg    ggcaccgggg    gggctggggg    tgccggaggt    ctaggtggtc

301 -    acgggggtgc    aggcgggctg    ctgattggca    acggcggcgc    cggtggcgct    ggcggcctcg

361 -    gcggtgcggg    cggcgccggc    ggtgcgggcg    gtgagggcgg    tgccggcggc    gccggaggcg

421 -    aagctattcc    cggcggggcg    tccaccaact    ccgccggcgg    tgacggaggg    gcgggcggta

481 -    ctggcggcaa    tggcggtgac    ggcggtgccg    gcggagcccc    cggcctcggt    ggcgcgggcg

541 -    gggccggcgg    atggttgatc    ggccagtcgg    gcagcaccgg    cggcggtggc    gccggcggtg

601 -    ccggtggtgc    cggaggtgcc    ggtggcgcgg    gcggcagcgg    cggtgcgggt    ggccatggcg

661 -    acactacctc    cggcaagaac    ggttcgtctg    gcaccgcggg    cttcgacggc    aaccccgggc

721 -    agcccggctg    agcggcacaa    gatctgaacg    cgctctaagc    tgaccccgtg    actggctggg

781 -    tgcccgatgt    gctgcccggc    tattggcagt    gcacaattcc    gctcgggccg    gatcccgacg

841 -    acgagggcga    cattgtcgca    accctggtcg    gccgcggtcc    gcaaacaggg    aaagcccgcg

I.a) Número identificador da seqüência: ID SEQ 29

II)    Características da seqüência:

II.a) tamanho: Deleção

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III)    Posição no genoma:

III. a) posição no mapa: 3201078-3202053

Região contig Moreau:

CTGCCCCGGTCGTAGTTGAGGTTGATCTGCTTGATTTGGACTCGCCGCGA

CAGATGCCGGCTTTCTCTCGTCAGCACACCGGGGCGGCTTATCTCCAATA

CACGTCCGGATCGACGCGTACGCCGGCCGGAGTCATTGTGTCGCACACGA

ATGTCATTGCCAATGTGACACAAAGTATGTACGGCTATTTCGGCGATCCC

GCAAAGATTCCGACCGGGACTGTGGTGTCGTGGCTGCCTTTGTATCACGA

TATGGGCCTGATTCTCGGAATTTGCGCACCGCTGGTGGCCCGACGCCGCG

CGGTGTTGATGAGCCCAATGTCATTTTTGCGCCGTCCGGCCCGCTGGATG

CAACTGCTTGCCACCAGCGGCCGGTGCTTTTCTGCGGCACCGCCACTGGC

TAATCGACTACCTAGTAACCAATATCGGCTGCACACCTGACGAGGTGGAC

CCCGATCTGTCGCTTGCCGACCTCGGCGTCAGCTCCCGCGACGCGGTCGT

ACTGTCCGGCGAACTGTCAGAGCTGCTGGGCAGGACCGTATCGCCGATTG

ACTTCTGGGAGCACCCGACGATCAACGCGCTGGCCGCGTATCTGGCCGCA

CCCGAGCCGAGCCCCGACTCCGACGCCGCAGTCAAGCGTGGTGCCCGGAA

CTCACTCGACGAGCCAATCGCCGTCGTCGGCATGGGATGTCGTTTCCCTG

GCGGGATTTCGTGCCCAGAAGCATTGTGGGACTTTCTCTGTGAACGCCGT

TCCTCGATCAGCCAGGTGCCGCCGCAACGATGGCAGCCCTTCGAAGGCGG

I.a) Número identificador da seqüência: ID SEQ 30

II)    Características da seqüência:

II.a) tamanho: 976 pb

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III)    Posição no genoma:

III. a) posição no mapa: 3201078-3202053

Região M. bovis (Bovilist):

gtggtaggcg atgtaacgaa atacgcagcc agccacgacg ggcagcctgc cccggtcgta gttgaggttg atctgcttga tttggactcg ccgcgacaga tgccggcttt ctctcgtcag cacaccgggg cggcttatct ccaatacacg tccggatcga cgcgtacgcc ggccggagtc attgtgtcgc acacgaatgt cattgccaat gtgacacaaa gtatgtacgg ctatttcggc gatcccgcaa agattccgac cgggactgtg gtgtcgtggc tgcctttgta tcacgatatg ggcctgattc tcggaatttg cgcaccgctg gtggcccgac gccgcgcggt gttgatgagc ccaatgtcat ttttgcgccg tccggcccgc tggatgcaac tgcttgccac cagcggccgg tgcttttctg cggcaccgaa tttcgccttc gaqctggccq tgcqcagaac atctgaccag gacatqqcgg ggctcgacct. gcgcgacgtq qtcgqoatcg tcagtgqcag tgagcgaatc catgtgqcaa ccqtgcggcg gttcatcgag cqqttcgcgc cgtacaatct cagccccacc gcgatacggc cgtcgtacgg gctcgcggaa gcgaccttat atgtggcagc tcccgaagcc qqcgccqcqc ccaaqacggt ccgt.ttt.gac tacgagcagc tgaccqccgg gcaqqctcqq ccctgcggaa ccgatgggtc ggtcggcacc gaactgatca gctacggct.c ccccgaccca tcgtctgtgc gaatcgtcaa cccggagacc atggttgaga atccgcctgg agtggtcgqt gagatctqqg tgcatggcga ccacgtgact atggggtatt ggcagaagcc gaagcagacc gcgcaggtct tcgacgccaa qctggtcgat cccgcgccgg cagccccgga ggggccgtqq ctgcgcaccg gcgacctggg cqtcatttcc gatggtgagc tgttcatcat gggccgcatc aaagacctgc tcatcgtgga cgqgcgcaac cactaccccg acqacatcga ggcaacgatc caggagatca ccggtggacg ggccgcggcg atcgcagtgc ccgacgacat caccgaacaa ctggtggcga tcatcqaatt caagcgacgc ggt.aqta.ccg ccqaagaggt catgctcaag ctccgctcgg tgaagcgtga ggtcacctcc gcgatatcga agtcacacag cctgcgggtg gccgatctcg ttctgqtgtc acctggttcg attcccatca ccaccagcgg caagatccgg cggtcagcct: gcgtcgaacg ctatcgcagc gacggcttca agcggctgga cgtagccgta tgacgggaaq catcagtggt gaagccgacc ttcgccactq gctaatcgac tacctagtaa ccaatatcgg ctgcacacct gacgaggtgg accccgatct gtcgcttgcc gacctcggcg tcagctcccg cgacgcggtc gtactgtccg gcgaactgtc agagctgctg ggcaggaccg tatcgccgat tgacttctgg gagcacccga cgatcaacgc gctggccgcg tatctggccg cacccgagcc gagccccgac tccgacgccg cagtcaagcg tggtgcccgg aactcactcg acgagccaat cgccgtcgtc ggcatgggat gtcgtttccc tggcgggatt tcgtgcccag aagcattgtg ggactttctc tgtgaacgcc gttcctcgat cagccaggtg ccgccgcaac gatggcagcc cttcgaaggc gggccacccg aggtagccgc ggcgctagcg cgcactacac ggtggggctc at

I.a) Número identificador da seqüência: ID SEQ 31

II) Características da seqüência:

II.a) tamanho: Deleção

II.b) tipo: ácido nucléico

II. c) conformação da fita: fita senso

II.d) topologia: linear

III) Posição no genoma:

III.a) posição no mapa: 3733171-3733275

Região contig Moreau:

ATGGCGCCGCCGGCGACAGCAATATCGAGCCGCAAACCAGCGTCCTGATC

GGCACCCAAGGCGGTGACGGCACGCCCGGGGGTGCTGGCGTCAACGGCGG

CAACGGTGGCGCGGGCGGAGACGCCAATGGCAACCCCGCAAACACCTCGA

TCGCCAACGCAGGCGCCGGCGGGAACGGCGCCGCCGGCGGTGACGGCGGT

GCCAATGGCGGTGCGGGCGGCGCCGGCGGGCAGGCCGCGTCCGCCGGTAG

TTCCGTCGGCGGTGACGGCGGCAACGGCGGTGCCGGCGGTACGGGCACGA

ACGGGCACGCCGGCGGTGCGGGCGGCGCCGGCGGTGCCGGTGGTCGCGGC

GGGTGGCTGGTCGGCAGCGGTGGCAACGGTGGCAACGGTGGCAACGGTGC

CGCCGGCGGCAACGGCGCCATCGGCGGTACCGGTGGTGCCGGCGGCGTCC

CCGCCAACCAGGGCGGTAACAGCGCCCTAGGCACCCAGCCGGTCAGCGGC

GACGGCGGCGACGGCGGCAACGGGGGCACCGGAGGCACCGGCGGGCGTGG

CGGCGACGGCGGATCCGGCGGCGCGGGCGGCGCGAGCGGTTGGTTGATGG

GCAACGGCGGCAACGGCGGCAACGGCGGCACCGGCGGCTCAGGCGGTGTC

I.a) Número identificador da seqüência: ID SEQ 32

II) Características da seqüência:

II.a) tamanho: 105 pb

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III) Posição no genoma:

III. a) posição no mapa: 3733171-3733275

Região M. bovis (Bovilist):

1 -    cggcaacggg    ggcgccggct    acaacagcgc    cgccacgccc    ggaatggccg    gcggcaacgg

61 -    cggcaacgcc    ggattgatcg    gcaacggcgg    tactggcggg    tcgggcggtg    ccggcgcggc

121 -    cggtggcgcc    ggcggcagcg    gcggctggtt    gtacggcaac    ggcggaaacg    gcggcatcgg

181 -    cgggaatgcg    atcgtcgcgg    gcggtgccgg    cggcaatggg    ggcgctggcg    gcgccgccgg

241 -    attgtggggc    agtggcggca    gcggcggcca    aggcggcaac    ggtctgaccg    gcaacgacgg

301 -    cgtgaatccg    gcccccgtca    caaaccccgc    gctaaatggc    gccgccggcg    acagcaatat

361 -    cgagccgcaa    accagcgtcc    tgatcggcac    ccaaggcggt    gacggcacgc    ccgggggtgc

421 -    tggcgtcaac    ggcggcaacg    gtggcgcggg    cggagacgcc    aatggcaacc    ccgcaaacac

481 -    ctcgatcgcc    aacgcaggcg    ccggcgggaa    cggcgccgcc    ggcggtgacg    gcggtgccaa

541 -    tggcggtgcg    ggcggcgccg    gcgggcaggc    cgcgtccgcc    ggtagttccg    tcggcggtga

601 -    cggcggcaac    ggcggtgccg    gcggtacggg    cacgaacggg    cacgccggcg    gtgcgggcgg

661 -    cgccggcggg    caggccgcgt    ccgccggtag    ttccgtcggc    gg-tgacggcg    gcaacggcgg

721 -    tgccggcggt    acgggcacga    acgggcacgc    cggcggtgcg    ggcggcgccg    gcggtgccgg

781 -    tggtcgcggc    gggtggctgg    tcggcagcgg    tggcaacggt    ggcaacggtg    gcaacggtgc

841 -    cgccggcggc    aacggcgcca    tcggcggtac    cggtggtgcc    ggcggcgtcc    ccgccaacca

901 -    gggcggtaac    agcgccctag    gcacccagcc    ggtcagcggc    gacggcggcg    acggcggcaa

961 -    cgggggcacc    ggaggcaccg    gcgggcgtgg    cggcgacggc

I.a) Número identificador da seqüência: ID SEQ 33

II) Características da seqüência:

II.a) tamanho: Deleção

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II.d) topologia: linear

III) Posição no genoma:

III.a) posição no mapa: 3769705-3777603

Região contig Moreau:

TGCGATTACCGCGCTCAGCGCCCCTGACAGCCGGTTGGCCACCCAGAGCC

CACTGGTGCTCGACCTGGCCGAGGAAGATGAGAAGAAGATGCGCATGAAA

TCCGCGGCCGAGGCATGGCGGGAACGCGGCTTTGATCTGGACTTGACCGA

GCTGATCTACTTCGATCAACGCAACGACGTGGCCGACTACCTCGCCGGCT

CCGGCTGGCAGGTCACCACCAGCACCGGCAAGGAACTCTTTGCGGCCCAA GGGCTGCCGCCCTTCGAGGACGACCACATAACTCGGTTCGCCGACCGCCG CTACATCAGCGCGGTGCTGAAGTAGGTGGCCCCGGCACTATAGCCGGGCC TAACTCGTAGGCTTGGTACGCGGGCAGAGCCGCCAGGCATGGCGAACTGG TATCGCCCGAACTATCCGGAAGTGAGGTCCCGCGTGCTGGGTCTGCCCGA GAAGGTGCGTGCTTGCCTGTTCGACCTCGACGGTGTGCTCACCGATACCG CGAGCCTGCATACCAACCCATGTCGGTCGAGAGCCCGTTCGATGATGTCA GCGGGCGCCTCGGAGTGCAACAGTCTGGTCAGCTTCGTGCCCAGGTGATC GAGCACGGCCCCAACCAGTTGGTCCTTGGTGCCGAAGTGACGAAACACCA GCCCGTGGTTGACCTTGGATCGAGCGGCGATGTCGCGAATCGACGTCGCG GCTGGCCCACGCTCGGCGAACAGGTCGGTGGCGGCCTGCAGGATTGCGGC CGCTACCTCTTCCCGCCCAGTGGGCATCTTGCGGCGGTCGGTTGCCGGAC GCGTAGTCATCCGGCTACAGTAACCGATGTAGTCATCTGACTACACTAAC CATTCATT G AGG AC GC C AGC AAT G AC AG AT C T G AT T AC CGT G AAG AAG C T GGGCAGCCGTATCGGCGCCCAAATCGACGGGGTGCGCCTCGGAGGCGATC

I.a) Número identificador da seqüência: ID SEQ 34

II)    Características da seqüência:

II.a) tamanho: 7899 pb

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III)    Posição no genoma:

III. a) posição no mapa: 3769705-3777603 Região M. bovis (Bovilist):

1 -    cctgccccca caggggcagg    accgcctgct    cgatgcgatt accgcgctca    gcgcccctga

61 -    cagccggttg gccacccaga    gcccactggt    gctcgacctg gccgaggaag    atgagaagaa

121 -    gatgcgcatg aaatccgcgg    ccgaggcatg    gcgggaacgc ggctttgatc    tggacttgac

181 -    cgagctgatc tacttcgatc    aacgcaacga    cgtggccgac tacctcgccg    gctccggctg

241 -    gcaggtcacc accagcaccg    gcaaggaact    ctttgcggcc caagggctgc    cgcccttcga

301 -    ggacgaccac ataactcggt    tcgccgaccg    ccgctacatc agcgcggtgc    tgaagtaggt

361 -    ggccccggca ctatagccgg    gcctaactcg    taggcttggt acgcgggcag    agccgccagg

421 -    cATGgcgaac tggtatcgcc    cgaactatcc    ggaagtgagg tcccgcgtgc    tgggtctgcc

481 -    cgagaaggtg cgtgcttgcc    tgttcgacct    cgacggtgtg ctcaccgata    ccgcgagcct

541 -    gcataccaag gcgtggaagg    ccatgtttga    cgcctaccta gccgagcgag    ccgagcgcac

601 -    cggcgaaaaa ttcgttccct    tcgaccctgc    cgcggactat cacacgtatg    tggacggcaa

661 -    gaaacgcgaa gacggcgttc    gatcgtttct    gagcagccgc gccatcgaaa    tacccgacgg

721 -    ttccccggat gacccgggcg    ccgccgagac    ggtgtatggc ctgggcaacc    gcaagaacga

781 -    catgttgcac aagctgctgc    gcgacgatgg    ggcccaggtg ttcgacgggt    cgcggcgcta

841 -    cctggaggcg gtcacggccg    cgggtctcgg    tgtggccgtg gtgtcttcga    gcgccaacac

901 -    ccgcgacgtg ctcgcgacca    ccggtctgga    ccggttcgtc cagcagcggg    tggacggcgt