Método, kit e iniciadores para a identificação genética de micobacterium bovis bcg cepa moreau-rj, método para monitoramento da viabilidade de bcg moreau-rj e expressão de genes, e, produtos com atividade imunobiológica

  • Número do pedido da patente:
  • PI 0604958-3 A2
  • Data do depósito:
  • 23/11/2006
  • Data da publicação:
  • 06/06/2006
Inventores:
  • Classificação:
  • A61P 35/00
    Agentes antineopl?sticos;
    ;
    A61K 39/04
    Prepara??es medicinais contendo ant?genos ou anticorpos; / Ant?genos bacterianos; / Mycobacterium, p. ex. Mycobacterium tuberculosis;
    ;
    G01N 33/50
    Investiga??o ou an?lise de materiais por m?todos espec?ficos n?o abrangidos pelos grupos ; / Material biol?gico, p. ex. sangue, urina; Hemocitr?metros; / An?lise qu?mica de material biol?gico, p. ex. sangue, urina; Testes por m?todos envolvendo a forma??o liga??es bioespec?ficas de ligantes; Testes imunol?gicos;
    ;
    C07H 21/04
    Compostos contendo duas ou mais unidades mononucleot?dicas tendo grupos fosfato ou polifosfato separados, ligados por radicais sacar?deos de grupos nucleos?deos, p. ex. ?cidos nucleicos; / com desoxiribosila como radical sacar?deo;
    ;
    C12N 15/31
    Muta??o ou engenharia gen?tica; DNA ou RNA concernentes ? engenharia gen?tica, vetores, p. ex. plasm?deos ou seu isolamento, preparação ou purifica??o; Uso de seus hospedeiros; / Tecnologia do DNA recombinante; / Fragmentos de DNA ou RNA; Suas formas modificadas; / Genes que codificam prote?nas microbianas, p. ex. enterotoxinas;
    ;
    A61K 39/40
    Prepara??es medicinais contendo ant?genos ou anticorpos; / Anticorpos; Imunoglobulinas; Imunosoro, p. ex. soro antilinfoc?tico; / bacteriano;
    ;

MÉTODO, KIT E INICIADORES PARA A IDENTIFICAÇÃO GENÉTICA DE MICOBACTERIUM BOVIS BCG CEPA MOREAU-RJ, MÉTODO PARA MONITORAMENTO DA VIABILIDADE DE BCG MOREAU-RJ E EXPRESSÃO DE GENES, E, PRODUTOS COM ATIVIDADE IMUNOBIOLOGICA - A presente invenção se refere ao mapeamento de inserções, deleções e mutações pontuais de BCG Moreau a partir da determinação da seqüência genômica de BCG Moreau e a sua comparação com o genoma de outras micobactérias. Além disso, a presente invenção identifica seqüências nucleotídicas e peptídicas que proporcionam metodologias para a verificação genética de BCG Moreau, e para a distinção de BCG Moreau de outras micobactérias, inclusive em amostras biológicas e clínicas. A presente invenção fornece, ainda, métodos e kits para a identificação de tais seqüências, dos produtos da expressão destas seqüências ou de anticorpos gerados a partir desta expressão. A invenção ainda proporciona metodologias para o monitoramento e preparação de vacinas e kits para a verificação da transcrição/expressão gênica de determinados antígenos do bacilo. A partir da presente invenção também são proporcionados produtos secundários com atividade imunomoduladora, por exemplo, no tratamento de câncer de bexiga e asma.

Página de 9

Documento

961 -    gacgttgcgc gaagagcaca    tcgccggcaa    gccggccccc gactccttcc    tgcgcgcggc

1021 -    agaactgttg ggggttaccc    ccgacgcggc    ggcggtgttc gaggacgccc    tgtccggggt

1081 -    ggcggccggc cgcgccggca    acttcgccgt    agtggtgggc atcaaccgaa    cgggccgggc

1141 -    ggctcaggcc gcccagttgc    gccgccatgg    cgccgacgtg gtggtaaccg    atctcgccga

1201 -    gctgctgTAG ggcatgatcg    ggcgatgatc    accgaggacg ccttccccgt    cgaaccgtgg

1261 -    caggtccgcg agaccaagct    caacctgaac    ctgctggccc agtccgaatc    cctattcgcc

1321    -    ttgtccaacg    ggcacattgg    attacgcggc    aacctcgacg    agggcgaacc    cttcggactg

1381    -    ccgggcacct    acctgaactc    tttctacgaa    atccggccgc    tgccgtacgc    cgaggccggt

1441    -    tatggatatc    cggaggccgg    ccagaccgtt    gtcgacgtca    ccaacggcaa    gatctttcgc

1501    -    ctgttggtcg    gcgacgagcc    gttcgacgtc    cggtatggcg    aattgatctc    ccacgaacgg

1561    -    atcctcgacc    tgcgcgccgg    gacgctgacc    cgccgcgcgc    actggcgctc    accggcgggc

1621    -    aagcaagtca    aagtgacgtc    cacccggctg    gtgtcgctgg    cccaccgcag    cgtcgcggcg

1681    -    atcgagtacg    tcgtcgaggc    aatcgaggaa    ttcgttcgcg    tgaccgtgca    gtccgaactc

1741    -    gtcaccaacg    aggacgtacc    ggagacctcg    gccgacccgc    gggtgtcggc    catcctggac

1801 -    aggccgctac aggccgtcga    gcacgaacgc    accgagcggg gtgcacttct    catgcaccgc

1861 -    acccgagcca gcgcgctgat    gatggccgca    gggatggaac acgaggtcga    ggttcccggg

1921 -    cgggtcgaga tcaccaccga    cgcccgcccg    gacctggccc gaaccaccgt    gatctgcggg

1981 -    ctgcgcccgg gacagaagct    gcgcatcgtc    aaatacctgg cctatggctg    gtccagcctg

204r -    cgctcccgcc cggcgctgcg    cgaccaggcc    gccggcgcgc tgcacggtgc    ccgctacagc

2101 -    ggctggcagg ggctgctgga    cgcgcaacgc    gcctacctcg acgacttctg    ggacagcgcg

2161 -    gacgtggagg tcgagggcga    cccggaatgt    cagcaagcgg tgcgtttcgg    gttatttcac

2221 -    ctgttgcagg ccagcgcgcg    cgccgaacgc    cgcgcgatcc ccagcaaggg    gctcaccgga

2281 -    accgggtatg acggccacgc    cttttgggac    accgaaggtt tcgtgctacc    ggtgctcacc

2341 -    tacaccgcac cgcatgcggt    cgccgacgcg    ctgcggtggc gggcgtcgac    gttggacctg

2401 -    gccaaggagc gggcggccga    gctcggcctg    gaaggtgccg cctttccctg    gcggaccatc

2461 -    cgcggacagg agtcctcggc    ctactggccg    gccggcacgg cggcctggca    catcaacgcc

2521 -    gacatcgcga tggcgttcga    gcggtaccgc    atcgtcaccg gcgacggttc    gctggaggag

2581 -    gaatgcggcc ttgcggtgct    gatcgagacc    gcccggctgt ggctctcgct    cgggcaccac

2641 -    gaccgccacg gcgtctggca    cctcgacggg    gtcaccggtc ccgacgagta    cacggcggtc

2701 -    gtccgcgaca acgtgttcac    gaatctgatg    gcggcgcaca atctgcacac    cgccgccgat

2761 -    gcttgcttgc gccaccccga    ggcggcggag    gccatgggtg tcaccaccga    ggagatggcc

2821 -    gcctggcgcg acgcggccga    cgccgccaac    attccctacg acgaggaact    cggtgtccac

2881 -    cagcagtgtg aagggttcac    cacccttgcg    gagtgggatt tcgaagccaa    caccacttat

2941 -    ccgttgctac tgcacgaggc    ctacgtgcgc    ttgtatcccg cacaggtgat    caagcaggcc

3001 -    gacctggtgc tggcgatgca    gtggcagagt    cacgcgttca cgcccgagca    gaaggcgcgc

3061 -    aacgtcgact actacgaacg    gcgcatggtg    cgcgactcgt cgttgtcggc    ctgcactcag

3121 -    gcggtgatgt gcgccgaggt    cggccatctc    gagttggccc acgactatgc    ctacgaagcc

3181 -    gccctgatcg acctgcacga    cctgcaccgc    aacacccgtg acggcctaca    catggcttcg

3241 -    ctggccggag cctggacggc    gctggtcgta    ggcttcggcg gcctacgcga    cgacgagggc

3301 -    atcctgtcca tcgatccgca    gctgcccgac    ggcatctcgc ggctgcggtt    ccggctgcga

3361 -    tggcgcggct tccggctgat    cgtcgacgcc    aaccacaccg acgtcacctt    catccttggc

3421 -    gacggtcccg gcacccagct    gaccatgcgc    cacgccggcc    aagatctgac    gctgcacacg

3481 -    gacacaccgt ccaccatcgc    cgtgcgcacc    cgtaagccgc    tgctgccgcc    accaccgcag

3541 -    ccgccaggcc gcgagccagt    gcaccgccgg    gctttagccc    ggtgacgata    cgggccgcgt

3601 -    agcggcccga ggaggagccg    ggcaatcggc    ttagcccggt    gacgatgcgg    gccgcgtagc

3661 -    ggcccgagga ggagccgggc    aatcggctta    gcccggtgac    gatacgggcc    gcgtagcggc

3721 -    ccgaggagga gccgggcaat    cggcttagcc    cggtgacgat    gcgggccgcg    tagcggcccg

3781 -    aggaggagcc gggcaatcca    gcctgagccc    ggtgacgatg    cgggccgcgt    agcggcccga

3841 -    ggaggagccg ggcaatccag    cctgagcccg    gtgacgatgc    gggccgcgta    gcggcccgag

3901 -    gaggagccgg gcaatccagc    ctgagcccgg    tgacgatgcg    ggccgcgtag    cggcccgagg

3961 -    aggagccggg caatccagcc    tgagcccggt    gacgatgcgg    gccgcgtagc    ggcccgagaa

4021 -    ggagccgggc aatcggctta    gcccggtgac    gatgcgggcc    gcgctggggg    caccatccgc

4081 -    ttgcggggac gcgtctgcgt    ctacctgggc    ggcaccggtg    aacgtctcat    tcaccgcgca

4141 -    cctccgcttc ctgcacggcg    gcgacgaccc    gggcaacgtc    atccggggcc    atgtggtcgt

4201 -    ggactggcag cgacacgatt    cgcgagcaaa    tgtccgccgt    gacggctaga    tcggtcgact

4261 -    cgactaactc ggcattcgtc    acaaagtacg    gatgtcggtg    ctgcggtggg    ttctagtagt

4321 -    cgcgcgcctc gatcgcgtgc    ctacgcaggc    tacccagaac    cgcggccttg    tggtcggcgg

4381 -    acgtgcagca agcgctcgcg    aaacagagcg    acgcaacatt    ggcgttgtcc    tggaaacgca

4441 -    cacccgcgtc ggccataccg    gtgcgatagc    actcgaggac    cttgcggcga    cttgccaggc

4501 -    ggcgatcaag cccgactagt    tggcgtaggc    caatagcggc    gctgatctcc    gacagcttgc

4561 -    cgttcattcc gagctggatg    gactcgcgtg    tttgcaccaa    gccgaagttc    tggaacttgt

4621 -    atgcgtgctc gacgagccgt    ggatcgcgag    aaaccagagc    gccgccctca    ccaaccgcga

4681 -    acggcttggt cgcatggaag    gagaagatct    cgcatgcacc    gcgtccaccg    aggcgctcgc

4741 -    cgtcggcgta cgtggagccg    aagccggccg    ccgagtcgag    cacaatcggt    agctcccatt

4801 -    cggcggcgag ctcctcccag    acgctgatct    ggggattgcc    gacgccgaac    acattggcca

4861 -    gcaggatgcc ggcgatccgg    tcgcggaagc    gttcgatgac    ggcgcaggcg    gagtggacgc

4921 -    atggctgcca tgtgttggcg    tcgatgtcga    tgaaccaggg    acggtaccca    gtccatagcg

4981 -    cagcctgagc cacgccgacg    aacgtgaacg    acggcatcag    caggtagcgg    tcccgcgtac

5041 -    cggcgccgaa    actgacgtgg    agcgccgcga    ggagtgccag    ggtgccgttg    gcgagggtag

5101 -    caacgtgcag    atgaggtccc    agatagtcgc    gcagggcgcg    ggcaaaccgc    cgctcgttcg

5161 -    gaccgaagtt    cgtgtaccag    ttagcctggg    cgatctgtac    gaagtcctcg    gcgagctcgg

5221 -    ctggcccggg    aaagctcggg    cggatgaagg ggatcttggg    gatcgtcgag    ccacccggct

5281 -    cgagttttaa    catggacgtg    cctggggtcg cgcgtactgc    ggacggcggc    tccagcaccg

5341 -    agccggataa    cgttcggatc    ttcatatatg cagagctcaa    ggtccgtttg    cagcgcgtcg

5401 -    ggacagtttc    cgcagcgcac    ttcgtcgcac catcgttggc    atcggcgcct    gaagcagtta

5461 -    ccgcgagaac    cgcatcatgt    cgaacttgag gttagcctta    cctcttaaga    atgtcacccc

5521 -    cggggagtga    ccccggctgt    ccacgcgtgg gcgacccggc    acgcacggtg    cacgttccct

5581 -    ggtgtctcac    ccgcctcatt    cgtcccggcg ccacagggct    agcgatatgg    ccgcctcgcg

5641 -    tagtcggtcc    gggtcggtac    gcgtggggca gatgaggaag    gtgcggcgca    ttgaagcagc

5701 -    ctgtcaagcc    cggctcggtg    accggcacgg cgcgttcagc    atggggccag    tgcgacgggc

576T -    tggagcgaag    caagcaggct    ggccgccagc gatttcgcca    gcgaccggac    gcgcggtgcg

5821 -    ctctcgacgt    gccaaaaacg    gatcttggga gtgaaattgc    cgccgactag    gggcccgatg

5881 -    acgcaaaaac    ctgggctggc    ctcgaagtcg tcgttaacca    gaaggccacg    gttggtgcgg

5941 -    ttcgggcggc    acagcccgtt    ctgcatcgcg ctgaccagga    acggcgagga    acacgtgtcc

6001 -    agctcctcga    aaccgccaca    attcaccacc gcagcgaagg    ggacggggtg    ggtatgctcg

6061 -    gctcccgcgg    ctcggtaggt    catggtggcg aacggctggc    cggacgcgca    ggcatccacg

6121 -    cgcagtactt    cgccggcgag    caggctcagc gtgccgtccg    cggctagctc    ctcggatgcc

6181 -    tggcggcaat    cgcgtcccgc    acgccgcacc aacttggtga    agttcatgcc    gtgcacgcag

6241 -    aagaactctt    cctgctgcac    gagatccatc ttgtgcagcg    cctgcccaaa    cagggcggca

6301 -    acggcgtcgt    acaaatcggc    caggttcaac gagcgttctt    cggccgtcgc    gagatcgtcg

6361 -    cggatcgcgg    acatgagatc    cgccgcggcg atcgcttccg    tacagagcag    cgtgcgcagc

6421 -    cgcgggaagt    caaactccgg    cggctgattg cagatcatgt    agggcagcac    gccggagcgc

6481 -    gagatgacgg    tgatggaccg    gacgcgtgcg cggatgcgcg    cgtcgtgacg    cattaggtag

6541 -    agcgcttcca    gcgaggtggc    gttggaaccc acgaccagta    cgttgcgctt    ctcccacgac

6601 -    tcgacgcggt    cgagcgaatc    gcgcagtcgc gctacgttgc    tctccccgcc    gggggagtag

6661 -    aaatcgttga    tataggtgaa    tgcgggttcg gaatcgctcg    caaggatggc    tttggtcggg

6721 -    gggctgccaa    tggccacaac    cactttgcct gcagcaattg    ccgttggacc    gtttccagac

6781 -    gggcggaggc    cgattcggta    gtggccgtct gcggagtggg    cgctcatggc    ctcagcgcgg

6841 -    atggtgacga    tttcggccag    gtcacgctcg ccgagcgcgg    cgatggcggc    aatcatctgc

6901 -    tccgacagaa    atacaccgaa    gagaaaccgc ggcaggtaga    gctcccccca    ctggttgccg

6961 -    tccaatgcgt    cgcggttgtc    gcagatccag cgggccgcgg    ccgcaccgcc    ctctgcctgg

7021 - aagaacgcca gccagcgctg cttgttctgc tccagccaga tccggtaggc ggccttttcc 7081 - ggctcgtcgg cgaaatcgtc gagcttctga atggccagcg atccgatgct ggagcgttgg 7141 - ccatagggga ttccgcacca gaactgctcg tctcgctcca ccaccgcgat gcgcaacttg 7201 - ggcgatgccg aggggctgct cagcagggca tcggccattt ccagcagagt catagagcac 7261 - gcggccccgc tgccgatgaa cgcaacgtcg aaggtaggtg gagtgatcat agtcatcaaa 7321 - taagggaagg ctaacataac ctcgaggcgg tggttaggct tccgcgggct tctccggttc 7381 - gagcacgacg cggacaaaca ccttgcggcc tgacgcatcg acgaaccaag cgttgcggaa 7441 - atcatcatgg gtcaacgcgc gcaggcgatt caggaaatgc ccaaacgttc cgcgctcgtt 7501 - caggtctagc cgccggagtt gttcgaaatc ctttttcagg ttgaggttgc cctcggtggc 7561 - cggcgattta gccgtgtagc tgccgtcccg gatggcgtcg aaatgttcca gcaccaactc 7621 - acgctcgatg tccatcagcc gggcgtagac acttcccgag gaatcccacg actcgatcgc 7681 - gcattcccgc tgggcgatga tcggaccatg gtccaactga tcgtcgatct cgtggatcgt 7741 - cacgccgact ttttgcccgt cgatgatcga gaagacctgg ggaaaccagc cgcggttgta 7801 - ggggttgaaa cccggatgaa cattcacaca cctgacccca tcgatcaaag cggcgggaaa 7861 - cctctgttta cagtggaagg aaaggacgag gtcataccgc tccacgattt ccgcgacgcg 7921 - ctctgcgaca tcacatcgcg ggacacccgg cagctggccg atgggggact gatagacgtc 7981 - catatcgcca tgcctggcct gcagatcgac cgccagagca tgggcgtgga cgttgtcggt 8041 - caggatcaat atcgtcacga ctcgcccccg ccagcctgcc cagcgcccat cagcggagcc 8101 - cccaacacca gctcacccta cttcagggcc gacgcatacc ggacggccac gctggggcca 8161 - gcgcagggac atcagtcagt gcggttccag gatccgggct accgcatcgt tcacggacaa 8221 - ccgtagttcg tcaccggtca gctcgtcgat acccgtcgcc gagcgcagca tgggcgcaaa 8281 - gagccgccaa ccgaattgca gcgcaagggc gtgcgcgacc gccagccgcg cgcccaagtc 8341 - gctgtcgtag cgaggccgta ccgcgtcgag cagctccgca acattgggaa atcgctgttg 8401 - cagctggccc acgggatatc cgtccagcag tgcccgggct aagacccgcc catgtcggtc (3' dei)

8461 - gagagcccgt tcgatgatgt cagcgggcgc ctcggagtgc aacagtctgg tcagcttcgt 8521 - gcccaggtga tcgagcacgg ccccaaccag ttggtccttg gtgccgaagt gacgaaacac 8581 - cagcccgtgg ttgaccttgg atcgagcggc gatgtcgcga atcgacgtcg cggctggccc 8641 - acgctcggcg aacaggtcgg tggcggcctg caggattgcg gccgctacct cttcccgccc

8701 - agtgggcatc ttgcggcggt cggttgccgg acgcgtagtc atccggctac agtaaccgat 8761 - gtagtcatct gactacacta accattcatt gaggacgcca gcaatgacag atctgattac 8821 - cgtgaagaag ctgggcagcc gtatcggcgc ccaaatcgac ggggtgcgcc tcggaggcga 8881 - tctggacccc gccgcagt

I. a) Número identificador da seqüência: ID SEQ 35

II)    Caracteristicas da seqüência:

II. a) tamanho: Deleção

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III)    Posição no genoma:

III. a) posição no mapa: 3888915-3889052 Região contig Moreau:

GACGGCGGTGCCGGCGGGAACGGCGGCGCGGCGGGCACGGGCGGCACCGG

CGGCGACGGCGGCCTCACCGGTACTGGCGGCACCGGCGGCAGCGGTGGCA

CCGGCGGTGACGGCGGTAACGGCGGCAACGGCGGGCACGGAGCAGATACA

CCGCAAACATGACTGCGCAGGCGGGCGGTGACGGTGGCAACGGCGGCGAC

GGTGGCTTCGGCGGCGGGGCCGGGGCCGGCGTCGGTGGCTTGACCGCTGG

CGCCATCGGCACCGGCGGTCAAGGCGGCGCCGGCGGCGATGGCGGCAACG

GCGGTACCGGCGGCAACGGCGGTACCGGCGGCGAGGGCGGCGAGGTCGGC

GGCGCCGGCGGCACCGGCGGTGCGGCCGGCAATGGCGGCGATGGCGGCAC

CGGCGGCACCGGCGGCGGGGACGGGGGCGCCGGCACCACCGGCGGCAAGG

GTGGCACCGGCGGCAACGGCAGTGGCACCGGCTCGGGCGGCACCGGCGGC

GATGGCGGCACCGGCGGTGGTGGTGGGAACGGCGGCACCGGCTGGAATGG

CGGCAAGGGAGACACCGGCAGCGGCGGTGGCGCCGGAGACGGTGGTAAGG

CACCAGCCGGTGGCACCGGCGGCGCCGGCGGCGACGGCGGAGCGGGCGG

I.a) Número identificador da seqüência: ID SEQ 36

II)    Caracteristicas da seqüência:

II.a) tamanho: 138 pb

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III)    Posição no genoma:

III. a) posição no mapa: 3888915-3889052

Região M. bovis (Bovilist):

1    -    gcaccgcggg    caccgcgggg    gccgccggta    acggcggcgc    cgccggaaag    ggtggcgccg

61    -    gcggccaagg    cggcaccggt    ggcgggaccg    ggggtcaggg    tggcgccggc    ggcgacggcg

121    -    gtgccggcgg    caccggcggc    gaccgcaccg    tcggcggtgg    cacggtcccc    gccggctccg

181    -    gtggacaagg    cggtaacgct    ggcggtggtg    gggccggcgg    gcagggtgga    gccgacggcg

241    -    gcagcggcgg    cgacggcggc    gacgccggca    caggtggcaa    tggcggtaac    ggcggcaacc

301    -    gtaattccgg    caatggcacc    ggcggcgctg    gcggcaacgg    tggtggtggt    gctaacggtg

361 -    gcgccggcgg cgctgggggc    agcggcggcg gcaccggcgg    caacggcggc    gctggcggcg

421 -    acgccggcga cgccggcaac    ggcggcaacg gcaacggcac    cggcaacggc    ggcaacggcg

481 -    gcaacggcgg catcgccggc    atgggcggca acggcggtgc    cgggacgggc    agcggcaacg

541 -    gcggcaacgg cggcagcggc    ggcaacggcg gcaacgccgg    catgggcggc    aacagcggca

601 -    ccggcagcgg cgacggcggt    gccggcggga acggcggcgc    ggcgggcacg    ggcggcaccg

661 -    gcggcgacgg cggcctcacc    ggtactggcg gcaccggcgg    cagcggtggc    accggcggtg

721 -    acggcggtaa cggcggcaac    ggcggcaacg gagcagataa    caccgcaaac    atgactgcgc

781 -    aggcgggcgg tgacggtggc    aacggcggcg acggtggctt    cggcggcggg    gccggggccg

841 -    gcggcggtgg cttgaccgct    ggcgccaacg gcaccggcgg    gcaaggcggc    gccggcggcg

901 -    atggcggcaa cggggccatc    gqcqgccacg gcccactcac    tqacgacccc    ggcggcaacg

961 -    ggggcaccgg cggcaacggc    gqcaccggcg gcaccggcgg    cgcgggcatc    ggcaqccttg

1021 -    gcggcggcac tggcqgcgat    ggcggcaacg gcqqtaccqq    cggcaacggc    ggtaccggcg

1081 -    gcgagggcgg cgaggtcggc    ggcgccggcg gcaccggcgg    tgcggccggc    aatggcggcg

1141 -    atggcggcac cggcggcacc    ggcggcgggg acgggggcgc    cggcggcacc    ggcggcaccg

1201 -    gcggcaccgg cggcctcggc    gacccccggg tcggcggatc    cggcggcgac    ggcggcaccg

1261 -    gcggcagcgg cggtgcggcc    ggcaatggcg gcaacggcgg    caacgccggc    gcgggaggca

1321 -    atggcaacgg cggcaccggt    ggggccggcg gtatcggcgg    caccggcggc    aatggcggcg

1381 -    acgccgagcc cggagtgccc    ccgggagccg gtggtgctgg    cggcgccggc    accaccggcg

1441 -    gcaagggtgg caccggcggc    aacggcagtg gcaccggctc    gggcggcacc    ggcggcgatg

1501 -    gcggcaccgg cggtggtggt    gggaacggcg gcaccggctg    gaatggcggc    aagggagaca

1561 -    ccggcagcgg cggtggcgcc    ggagacggtg gtaaggcacc    agccggtggc    accggcggcg

1621 -    ccggcggcga cggcggagcg    ggcggcaagg gcggcagcgg    cggcgtctag    tcgcgatggg

1681 -    cccagcggcc gcgatggtgc    gccgggcgtc cgccggcgag    tggtccagcc    agatttgacg

1741 -    acaaacggcg acccagcggt    atcccccagc cgcggcgcca    tagccgcgac    ccgcgcaatc

1801 -    aggaaccgct cgtcacgtgt    cccgcatgca cgtcatcggc    tggccgcgcc    tcggtctgct

1861 -    ccttggccca gcggtagtcc    ggcttaccgg cgggcgaacg    cttcacctcg    tcgacaaacc

1921 -    acagactgcg cggcactttg    tagcccgcga tctcggagcg    cacgaacgag    tccaactcgg