Método, kit e iniciadores para a identificação genética de micobacterium bovis bcg cepa moreau-rj, método para monitoramento da viabilidade de bcg moreau-rj e expressão de genes, e, produtos com atividade imunobiológica

  • Número do pedido da patente:
  • PI 0604958-3 A2
  • Data do depósito:
  • 23/11/2006
  • Data da publicação:
  • 06/06/2006
Inventores:
  • Classificação:
  • A61P 35/00
    Agentes antineopl?sticos;
    ;
    A61K 39/04
    Prepara??es medicinais contendo ant?genos ou anticorpos; / Ant?genos bacterianos; / Mycobacterium, p. ex. Mycobacterium tuberculosis;
    ;
    G01N 33/50
    Investiga??o ou an?lise de materiais por m?todos espec?ficos n?o abrangidos pelos grupos ; / Material biol?gico, p. ex. sangue, urina; Hemocitr?metros; / An?lise qu?mica de material biol?gico, p. ex. sangue, urina; Testes por m?todos envolvendo a forma??o liga??es bioespec?ficas de ligantes; Testes imunol?gicos;
    ;
    C07H 21/04
    Compostos contendo duas ou mais unidades mononucleot?dicas tendo grupos fosfato ou polifosfato separados, ligados por radicais sacar?deos de grupos nucleos?deos, p. ex. ?cidos nucleicos; / com desoxiribosila como radical sacar?deo;
    ;
    C12N 15/31
    Muta??o ou engenharia gen?tica; DNA ou RNA concernentes ? engenharia gen?tica, vetores, p. ex. plasm?deos ou seu isolamento, preparação ou purifica??o; Uso de seus hospedeiros; / Tecnologia do DNA recombinante; / Fragmentos de DNA ou RNA; Suas formas modificadas; / Genes que codificam prote?nas microbianas, p. ex. enterotoxinas;
    ;
    A61K 39/40
    Prepara??es medicinais contendo ant?genos ou anticorpos; / Anticorpos; Imunoglobulinas; Imunosoro, p. ex. soro antilinfoc?tico; / bacteriano;
    ;

MÉTODO, KIT E INICIADORES PARA A IDENTIFICAÇÃO GENÉTICA DE MICOBACTERIUM BOVIS BCG CEPA MOREAU-RJ, MÉTODO PARA MONITORAMENTO DA VIABILIDADE DE BCG MOREAU-RJ E EXPRESSÃO DE GENES, E, PRODUTOS COM ATIVIDADE IMUNOBIOLOGICA - A presente invenção se refere ao mapeamento de inserções, deleções e mutações pontuais de BCG Moreau a partir da determinação da seqüência genômica de BCG Moreau e a sua comparação com o genoma de outras micobactérias. Além disso, a presente invenção identifica seqüências nucleotídicas e peptídicas que proporcionam metodologias para a verificação genética de BCG Moreau, e para a distinção de BCG Moreau de outras micobactérias, inclusive em amostras biológicas e clínicas. A presente invenção fornece, ainda, métodos e kits para a identificação de tais seqüências, dos produtos da expressão destas seqüências ou de anticorpos gerados a partir desta expressão. A invenção ainda proporciona metodologias para o monitoramento e preparação de vacinas e kits para a verificação da transcrição/expressão gênica de determinados antígenos do bacilo. A partir da presente invenção também são proporcionados produtos secundários com atividade imunomoduladora, por exemplo, no tratamento de câncer de bexiga e asma.

Página de 9

Documento

1981 -    ccaacgacgg ccgacaaccc

I.a) Número identificador da seqüência: ID SEQ 37

II)    Características da seqüência:

II.a) tamanho: Deleção

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III)    Posição no genoma:

III. a) posição no mapa: 3890900-3891010

Região contig Moreau:

AGCCAGTGCGACCACGCAGGTGCTGGCTGCGGGCGCCGATGAGGTGTCTG

CCCGTATTGCGGCGCTGTTCGGCGGGTTTGGCCTGGAGTACCAGGCGATT

AGTGCGCAGGTGGCGGCCTACCACCAGCGGTTTGTGCAGGCCTCGAGTAC

CGGCGCGGGCGCATATGCCTCGGCCGAGGCCACCGCCGCTGAGCAGATCG

TGCTGGGCGTGATCAATGCGCCCACCCAGGCGCTGCTGGGGCGCCCGTTG

ATCGGTGACGGCGCCAATGCGACGACTCCCGGCGGGGCCGGCGGGGCCGG

CGGCAGCGGTGGGGGCACCGGCGGTGCCGGCGGCGCCGGTGGGTGGCTGT

TCGGGGTTGGCGGCGCCGGCGGTGTCGGTGGGGCCGGTGGCGGCACCGGC

GGGGCGGGCGGGCCCGGTGGTTTGATCTGGGGCGGCGGCGGGGCCGGCGG

TGTCGGTGGGGCCGGTGGCGGCACCGGCGGGGCCGGCGGCCGCGCCGAGC

TGCTGTTCGGCGCCGGCGGTGCGGGCGGCGCGGGTGGGGCGGGCACCGAC

GGCGGGCCCGGTGCTACCGGCGGGACCGGCGGACACGGCGGAGTCGGCGG

CGACGGCGGATGGCTGGCACCCGGCGGGGCCGGCGGGGCCGGCGGGCAAG

I.a) Número identificador da seqüência: ID SEQ 38

II)    Características da seqüência:

II.a) tamanho: 111 pb

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III)    Posição no genoma:

III. a) posição no mapa: 3890900-3891010 Região M. bovis (Bovilist):

1 -    atgtcgttcg    tgttgatcgc    accggaattc    gtgacagcag    ccgcggggga    tctgacgaat

61 -    ctgggttcgt    cgattagcgc    ggccaacgcg    tcggcagcca    gtgcgaccac    gcaggtgctg

121 -    gctgcgggcg    ccgatgaggt    gtctgcccgt    attgcggcgc    tgttcggcgg    gtttggcctg

181 -    gagtaccagg    cgattagtgc    gcaggtggcg    gcctaccacc    agcggtttgt    gcaggccttg

241 -    agtaccggcg    cgggcgcata    tgcctcggcc    gaggccgccg    ccgctgagca    gatcgtgctg

301 -    ggcgtgatca    atgcgcccac    ccaggcgctg    ctggggcgcc    cgttgatcgg    tgacggcgcc

361 -    aatgcgacga    ctcccggcgg    ggccggcggg    gccggcggtc    tqctgttcgg    caacggcggg

421 -    qccggggcaq    ccggggcgcc    cggccaggcc    gqcgggcctg    qcqqgcccgc    cqqcctgtgq

481 -    qgcaacqqcq    qgcccggcgg    gqccggcggc    agcggtgggg    gcaccggcgg    tgccggcggc

541 -    gccggtgggt    ggctgttcgg    ggttggcggc    gccggcggtg    tcggtggggc    cggtggcggc

601 -    accggcgggg    cgggcgggcc    cggtggtttg    atctggggcg    gcggcggggc    cggcggtgtc

661 -    ggtggggccg    gtggcggcac    cggcggggcc    ggcggccgcg    ccgagctgct    gttcggcgcc

721 -    ggcggtgcgg    gcggcgcggg    tggggcgggc    accgacggcg    ggcccggtgc    taccggcggg

781 -    accggcggac    acggcggagt    cggcggcgac    ggcggatggc    tggcacccgg    cggggccggc

841 -    ggggccggcg    ggcaaggcgg    ggcaggtggt    gccggcagcg    atggtggcgc    gttgggtggt

901 -    accggcggga    cgggcggtac    cggcggcgcc    ggtggcgccg    gcggtcgcgg    cgcactgctg

961 -    ctgggcgctg    gcggacaggg    cggcctcggc    ggcgccggcg

I. a) Número identificador da seqüência: ID SEQ 39

II)    Caracteristicas da seqüência:

II. a) tamanho: Deleção

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III)    Posição no genoma:

III. a) posição no mapa: 4094370-4094428 Região contig Moreau:

CCCGGGTCCACCTTGGGATTTAGCAGGCTGACCACGGATTGCTCTAGTCG

GCCGGCGGCGTCCAGGCCGAGCACCGCAAGGCTGATGATCCGGGCCTGGC

CCGGCCGAAAGCCCGAGGTCTCGACGTCGATGACGGCCCAACCCCGATCC

TGGTGGCTGGCTGGCCGTCCCCAGGTGTGGCTCACAAGACGAGGATGACA

CGTCCGAGCGACATCACCTGGTCGCTACGCATCGTGTCGGCCCGTAAAAC

CCGGACGCGGGCGACCCGCCGCACCCGGCGACAAGCGCCGAGCTTGCGAT

CGCCCGTAAACTGCCCGGGTGGTAACCACCCGGGCACGCCTGGCCCTAGC

CGCCGGCGCGGGCGCACGCTGGGCGTCGCGGGTCACCGGTCGCGGCGCCG

GAGCGATGATCGGCGGTCTGGTCGCCATGACCCTGGACCGCTCGATCCTG

CGCCAACTCGGGATGGGCCGGCGCACCGTCGTCGTCACCGGCACCAACGG

CAAGTCGACCACCACACGGATGACCGCGGCCGCGCTGGGCACGTTGGGAG

CCGTGGCCACCAACGCCGAGGGCGCCAACATGGACGCCGGCCTGGTGGCC

GCGCTCGCCGCTCACCGCGACGCCGAGCTGGCGGTGCTGGAAGTCGACGA

I.a) Número identificador da seqüência: ID SEQ 40

II) Caracteristicas da seqüência:

II.a) tamanho: 59 pb

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II.d) topologia: linear

III) Posição no genoma:

III.a) posição no mapa: 4094370-4094428

Região M. bovis (Bovilist):

l

61

121

181

241

301

361

421

481

541

601

661

121

781

841

901

961


atatcggcga actgtggctg gtcatcgagc gggcccgggt ccaccttggg atttagcagg gcgtccaggc cgagcaccgc aaggctgatg gtctcgacgt cgatgacggc ccaaccccga tggctcacaa gacgaggatg acacgtccga cggcccgtaa aacccggacg cgggcgaccc gatcqccctq aatccaacgc gggcqacccg atcgcccgta aactgcccgg gtggtaacca cgggcgcacg ctgggcgtcg cgggtcaccg tggtcgccat gaccctggac cgctcgatcc tcgtcgtcac cggcaccaac ggcaagtcga gcacgttggg agccgtggcc accaacgccg ccgcgctcgc cgctcaccgc gacgccgagc taccgcacat ctccgatgcc gtcgatcccg accagctgga ccgggtcggc gagatcaacg cccggcaccc cgacgctgtc gtggtcgcca cctacgacag ccccaacgtc gtttgggtgg


atggcggcgg tcaggccgtg cacgtgggtg ctgaccacgg attgctctag tcggccggcg atccgggcct ggcccggccg aaagcccgag tcctggtggc tggctggccg tccccaggtg gcgacatcac ctggtcgcta cgcatcgtgt gccgcacccg gcgacaagcg ccgagcttgc ccgcacccgg cqacaagcgc cgagcttgcg cccgggcacg cctggcccta gccgccggcg gtcgcggcgc cggagcgatg atcggcggtc tgcgccaact cgggatgggc cggcgcaccg ccaccacacg gatgaccgcg gccgcgctgg agggcgccaa catggacgcc ggcctggtgg tggcggtgct ggaagtcgac gagatgcacg ccgtcgtcgt cttgctcaac ctctcccgag tcatcgaacg cacactgcgg gccgggctgg actgcgacga cgtgctgatg acctcggccg ctgccggcgg


I.a) Número identificador da seqüência: ID SEQ 41

II) Características da seqüência:

II.a) tamanho: Deleção

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II.d) topologia: linear

III) Posição no genoma:

III.a) posição no mapa: 4286586-4296088 Região contig Moreau:

CGGGATGTACCGGCAGCTGCGTGACGATCCAAGTCAACCCGTTGCGTCCG

ATCCATACGGCGACGTCTTTCTGATCATCGACGGATGGCCCGGTTTTGTC

GGCGAGTTCCCCGACCTTGAGGGGCAGGTTCAAGATCTGGCCGCCCAGGG

GCTGGCGTTCGGCGTCCACGTCATCATCTCCACGCCACGCTGGACAGAGC

TGAAGTCGCGTGTTCGCGACTACCTCGGCACCAAGATCGAGTTCCGGCTT

GGTGACGTCAATGAAACCCAGATCGACCGGATTACCCGCGAGATCCCGGC

GAATCGTCCGGGTCGGGCAGTGTCGATGGAAAAGCACCATCTGATGATCG

GCGTGCCCAGGTTCGACGGCGTGCACAGCGCCGATAACCTGGTGGAGGCG

ATCACCGCGGGGGTGACGCAGATCGCTTCCCAGCACACCGAACAGGCACC

TCCGGTGCGGGTCCTGCCGGAGCGTATCCACCTGCACGAACTCGACCCGA

ACCCGCCGGGACCAGAGTCCGACTACCGCACTCGCTGGGAGATTCCGATC

GGCTTGCGCGAGACGGACCTGACGCCGGCTCACTGCCACATGCACACGAA

CCCGCACCTACTGATCTTCGGTGCGGCCAAATCGGGCAAGACGACCATTG

CCCACGCGATCGCGCGCGCCATTTGTGCCCGAAACAGTCCCCAGCAGGTG

CGGTTCATGCTCGCGGACTACCGCTCGGGCCTGCTGGACGCGGTGCCGGA

CACCCATCTGCTGGGCGCCGGCGCGATCAACCGCAACAGCGCGTCGCTAG

ACGAGGCCGTTCAAGCACTGGCGGTCAACCTGAAGAAGCGGTTGCCGCCG

ACCGACCTGACGACGGCGCAGCTACGCTCGCGTTCGTGGTGGAGCGGATT

TGACGTCGTGCTTCTGGTCGACGATTGGCACATCCAGCCGCCCGGATCCA

GCATCTGTCTGGCATAGCTGCCCGTCGGCCTGGTAATACTCATCCCCTAC

TGCCCTCCCCAAACCGCCAGATCGCCTCGCGGATCACCGTCCGGTTGGCC

TCCGGCATTTCACGCCGGCTCGGCCGCTGGATCCACCCCGCGCCGGTATT

CGCAGTAACCCGTTGAATCCGCGCGCATGATGCACCGCTTGGGCGATCAG

CCGGGTGGTCACCTCGCTTGCGCTGGCCGCGCTGTCGCACGGGGCGCTCG

GTGGTAACGGACGTCATAATTAACCAGCGTAACCGAACCTAAGACCAGCT

AGCTGCGGCAATATTGGCGACCAGGACTATGGCGCCCTCCGAACCCGGCC

GATCCATGTCAAAACATTGACAATGCGTACTCACGCCGTGTCGGGCGCGC

TGAATGACCGCATTGCGGCGCTCATTCGGTGCGTAGTCGCTACCACCGCA

ACAATGGGCTTAGGCCATTCCTTCGTTCATCGCGCGGGACATGGCCGATA

I. a)' Número identificador da seqüência: ID SEQ 42

II)    Caracteristicas da seqüência:

II. a) tamanho: 9503 pb

II.b) tipo: ácido nucléico

II.c) conformação da fita: fita senso

II. d) topologia: linear

III)    Posição no genoma:

III. a) posição no mapa: 4286586-4296088

Região M. bovis (Bovilist):

1

61

121

181

241

301

361

421

481

541

601

661

721

781

841

901

961

1021

1081

1141

1201

1261

1321

1381

1441

1501


tggcccggtt ttgtcggcga gttccccgac cttgaggggc aggttcaaga tctggccgcc caggggctgg cgttcggcgt ccacgtcatc atctccacgc cacgctggac agagctgaag tcgcgtgttc gcgactacct cggcaccaag atcgagttcc ggcttggtga cgtcaatgaa acccagatcg accggattac ccgcgagatc ccggcgaatc gtccgggtcg ggcagtgtcg atggaaaagc accatctgat gatcggcgtg cccaggttcg acggcgtgca cagcgccgat aacctggtgg aggcgatcac cgcgggggtg acgcagatcg cttcccagca caccgaacag gcacctccgg tgcgggtcct gccggagcgt atccacctgc acgaactcga cccgaacccg ccgggaccag agtccgacta ccgcactcgc tgggagattc cgatcggctt gcgcgagacg gacctgacgc cggctcactg ccacatgcac acgaacccgc acctactgat cttcggtgcg gccaaatcgg gcaagacgac cattgcccac gcgatcgcgc gcgccatttg tgcccgaaac agtccccagc aggtgcggtt catgctcgcg gactaccgct cgggcctgct ggacgcggtg ccggacaccc atctgctggg cgccggcgcg atcaaccgca acagcgcgtc gctagacgag gccgttcaag cactggcggt caacctgaag aagcggttgc cgccgaccga cctgacgacg gcgcagctac gctcgcgttc gtggtggagc ggatttgacg tcgtgcttct ggtcgacgat tqqcacatga tcqtqggtgc cqccgggggg atgccgccga tggcaccgct qgccccgtta ttgccggcgg cggcagatat cgggttqcac atcattgtca cctgtcaqat gagccaggct tacaaggcaa ccatggacaa gttcqtcqgc gccgcattcg ggtcgggcgc tccgacaatg fcfccctfcfccqg qcgagaagca ggaattccca tccagtgagt tcaaqgtcaa qcggcgcccc cctggccagg cafcttctcgt ctegccaqac ggcaaagagg tcatccagqc cccctacatc qaqcctccaq aaqaagtgtt cgcagcaccc ccaagcgccq gttaaqatta tttcattgcc qqtgtagcag gacccgagct cagcccqqta atcgagttcg ggcaatgctg accatcgggt ttgtttccgq ctat^aaccga acqqtttqtq tacgggatac aaatacaqqq aqggaagaag taggcaaatg qaaaaaatgt cacatqatcc gatcgctgcc gacattqgca cgcaagtgag cgacaacgct: ctgcacggcg tqacggccgq ctogacggcg ctgacgtcgg tgaccggqct qgttcccgcg qgggccgatg aggtctccgc ccaagcggcg acqgcgttca catcggaggg catccaattg ctqqcttcca atgcatcggc ccaagaccag ctccaccgtq cqggcgaagc

1561 -    qqtccaggac    gtcqcccqca    cctattcqca    aatcqacgac    ggcgccgccg    gcgtcttcgc

1621 -    ctaataggcc    cccaacacat    cqgagggagt    gatcaccatg    ctqtggcacg    caatgccacc

1681 -    ggagctaaat    aceqeacggc    tgatggccgg    cgcgggtccg    qctccaatqc    ttgcggcqqc

1741 -    cqcggqatqg    caqacgcttt    cggcggctct    qgacgctcag    qccgtcqaqt    tgaccgcgcg

1801 -    cctgaactct    c-tgggagaaq    cctggactgq    aggtqqcagc    gacaaggcqc    ttqcqgctqc

1861 -    aacgccgatq    gtggtctggc    tacaaaccgc    qtcaacacag    gccaagaccc    gtqcqatgca

1921 -    ggcgacggcg    caagccgcgg    catacaccca    qgccafcqgcc    acqacgccqt    cqctqccgqa

1981 -    gatcgccgcc    aaccacatca    cccaggccgt    ccttacqqcc    accaacttct    fccqqtatcaa

2041 -    cacgatcccg    atcgcgttga    ccgagatgga    ttatttcatc    cgtatgtgga    accaggcagc

2101 -    cctggcaatq    gaggtctacc    aggccgagac    cgcggttaac    acgcttttcg    agaagctcga

2161 -    gccgatggcg    tcgatccttg    atcceqgcgc    gagccagagc    acqacgaacc    cgatcfctcgg

2221 -    aatgccctcc    ccfcqgcaqcfc    caacaccgqt    tqgccaqttg    ccqccggcgg    ctacocaqac

2281 -    cctcqgccaa    ctqqqtqaqa    tgagcqgccc    gatgcagcag    ctgacccagc    cgctgcagca

2341 -    ggtqaoqtog    ttgttcaqcc    agqtjqqgcgg    cacoggcggc    ggoaacccag    ccgacgagga

2401 -    agccgcgcag    atgggcctgc    tcgqcaccaq    tccgctgtcg    aaccatccgc    tgqctggtgg

2461 -    atcaggcccc    agcgcgggcg    oqqqcctgct    gcgcgogqag    tcgctacctg    gcgcaggtgg

2521 -    gtcgttqacc    cgcacgccgc    tgatq tctoa    qctgatcgaa    aagccggttg    ccccctcggt

2581 - gatgccgqcg gctgctgcoq gatoqtoggc qacgggtqgc gccgctccgg tqggtgcqgg 2641 - agcgatggge oaqggtqcqc aatocqgcgg ctccaccagg ccgggtctgg tcqcqecqqc 2701 - accgcfccqcg caqqagcqtq aaqaaqaoga cgaqgacqac tqqgacqaaq aqqaogactg 2761 - gtgagctooc gtaatgacaa cagacttccc ggccacccgg gccggaagac ttgccaacat 2821 - t.ttggcgagg aaggtaaaga gaqaaagtaq tccaqcatgg cagagatgaa gaccgatgcc 2881 - gctaccctcg cgcaggaggc aggtaatttc gagcqgatct ccqgcgacct gaaaacccag 2941 - atcgaccagg tqqaqtcqac qqcaqqttcq ttgcagggcc aqtggogcqq cgoqgcgggg 3001 - acqgccqccc aggccgcqqt ggtqcqcttc caagaagcag ccaataagca gaagcaggaa 3061 - otogacgaga fcotcgaogaa tattoqtcag gccggcgt.cc aatactcqaq ggccgacgag 3121 - gagcagcaqc aqqcqctqtc ctcqoaaatq ggcttctqac ccqctaatac qaaaaqaaac 3181 - ggagcaaaaa catqacagag oagoagtgga atttcqcggg tatogaggoo qcqgcaagcg 3241 - caatccaggg aaatqtcacq tocattcatt ccctccttga cgaggggaag caqtccctga 3301 - coaagctcgc agcqgcctqq ggcggtagcg gttcqqaqgc gtaccagggt gtccagcaaa 3361 - aatgggacgc cacggctacc gaqctgaaca acgcqctqca qaacctqqcg cqqacgatca 3421 - gcgaagccqg tcaqqoaatg gcttcgaccq aaqqoaacqt caotqqqatq ttoqcataqq 3481 - goaacgccga qttoqcqtaq aatagcgaaa cacgggatcg ggcgagttcq accttccgtc 3541 - ggtctcqccc tttetoqtqt ttatacqttt gagcgcactc tgagaggttg tcatggcggc 3601 - cgactacgac aaqctcttcc ggccgcacga aqqtatqqaa gctccgqacq atatqgcaqc 3661 - gcaqccgfctc ttcgacocca gtqcttogtt tcogccgqcg cocgcatcgg caaacctacc 3721 - qaagcccaac ggccagacfcc cgcccccgac gtccgacgac ctgtcggagc ggttcgtgtc 3781 - qqooooqcoq ocgccacccc cacccccacc tccgcctccg ccaactccga tgccgatcgc 3841 - cgcagqagag ccgccctcgc cqqaaccqgc cqcatctaaa ccacccacac cccccatgcc 3901 - catcgccqqa ccogaaocgg occcaeccaa accacccaca ccocccatqc ccatcgccgg 3961 - acccgaaceq gccccaccca aaccacccac acctccgatg cccatcgccg gacctgcacc 4021 - caococaacc gaatcceagt tqgogccccc cagaccaccg acaccacaaa cgccaaccgg 4081 - agcgccgcag caaccggaat caeoggcgcc ccacgtaccc tcgcacgggc cacatcaacc 4141 - ccggcqcacc gcaccagcac cgccctqqqo aaagatgcca atcggcqaac cccoqoccgc 4201 - tccqtccaqa ccqtctgcgt ccccggccga accaccgacc cggcctgccc cccaacactc 4261 - ccgacgtgcg cgccggggtc accqctatoq cacagacacc gaacgaaacg tcqqgaaggt 4321 - agcaactggt ccatccatcc aggcgcggct qcgggcaqag qaagcatccg gcgcgcagct 4381 - cgcccccgga aoqqagocct ogccagegcc gttgggccaa cogagatcgt atctqgctcc 4441 - qcccacccqc cccqcqccga cagaacctcc ccccagcccc tcgccgcagc gcaactccgg 4501 - tcgqogtqoo gagcgacgog tcoaccooga tttagccgcc caacatgccg cggcgcaacc 4561 - tgattcaatt acggccgcaa ccactgqcqg tcqtcgcogc aagcgtgcaq cqcoqqatct 4621 - cgacqcgaca caqaaatcct taaggocggc ggccaaqggg ccqaaggtqa aqaaqgtgaa 4681 - gccccagaaa ecgaaggcca cgaagccgcc caaaqtqqtq tcqcagcgcg gctggcgaca 4741 - ttqqqtqcat qccrttqacqc gaatcaacct qqgcctgtca ccogaoqaga agtacgagct 4801 - gqacctqcac qctcqagtcc gccgcaatcc ccgcgggtcg tatcagatcq ccqtcgtcqq 4861 - tctoaaaqqt qgqqctqqca aaaccaoqct qacaqcaqog ttqqgqtoqa ocrtfaqgctea 4921 - qqtqcgggcc qaccggatcc tggctctaga cgcgqafccca ggcgccggaa acctcgccga 4981 - teqqqtaqqq oqacaatcgg gogogaccat ogctgatgtg cttgcagaaa aagaqctgtc 5041 - qcactacaac gacatccgcg cacacactag cgtcaatgcq qtcaatctqg aagtqctgcc 5101 - ggcaccggaa taoaqctogg cgcaqcqoqc qctcaqcgac gccqactqqc afcfcteategc 5161 - cqatcctqoq toqaqgtttt acaacctcgt cttggctgat tgtggggccg gcttcttcga 5221 - ccogctgacc cqoqqcqtgc tgtccacqgt qtccqqtqtc qtqqtcqtqq caagtgtctc 5281 - aatcgacgqc qcacaacagg cgtcgqtcqc qttgqactgg ttgcgcaaca acqqttacca 5341 - agatttggcg aqccqcgeat qcgtgg-tcat: caatcacatc atgccgggag aacccaatgt 5401 - cgcagttaaa gacctqgtqc ggcatttcga acaqcaagtt caacccggcc gggtcgfcggt 5461 - catgccgtgg qacaggcaca ttgcggccgg aaccqaqatt tcactcgact tgctcgaccc 5521 - tatctaoaaq cgcaaggt.cc tcgaattggc cgcagcgcta tccgacgat.t tcgagagggc 5581 - tggacgtcgt tgagcgcacc tgctgttgct gctggtccta ccgccgcggg ggcaaccgct 5641 - gcgcggcctg ccaccacccg ggtgacgatc ctgaccggca gacggatgac cgatttggta 5701 - ctgecagcgg cggtgccgat ggaaacttat attgacgaca ccgfccgcggfc gctt-fcccgag 5761 - gtgttggaag acacgccggc tgatgtactc ggcggcttcg actttaccgc gcaaggcgtg 5821 - tgqqcqttcg ctcgtcccgg atcgccgccg ctgaagctcg accagtcact cqatgacgcc 5881 - ggggtggtcg acgggtcact qctgactctg gtqtcagtca gtcgcaccga gcgctaccga 5941 - ccgttggtcg aqqatqtcat cqacgcgatc gcogtgcttg acgagtoacc tgaqrttcgac 6001 - cgcacggcat tqaatcgctt tgtgggggcg gcgatcccgc ttttgaccgc gcccgtcatc 6061 - qgqatggcga tqcqqqcqtq gtgggaaact gggcgtagct tgtggtggcc gttggcgatt 6121 - ggcatcctgg gqateqcfcgt gctggtaggc agcttcqtcg cgaacaggtt ctacoaqagc 6181 - ggccacctgq ccgagtgcct actggtoacg acgtatotgc tgatcgcaac cgccgcagcg 6241 - ctggccgtgc cqttqccqoq cggggtcaac tcgttggggg cgccacaagt tgccggcgcc 6301 - gctaoggcog tgctgttttt gaccttgatg aogoggggcg gccctcggaa gcgtcatgag 6361 - ttggcgtcgt ttqccgtgat caccgctatc gcggtcatcg cggccgccgc tgccttcqqc 6421 - tatqgatacc agqactgggt coccgcgggg qggateqcat toggqctgtt catt-gtqacq 6481 - aatgcggcea agctqaccgt cqcggtcqcg cggatcgcgc tgccgccgat tccggtaccc 6541 - ggogaaacog tggacaaoga qgagttgctc gatcccgtcg cgaccccgga ggctaccagc 6601 - gaagaaaccc cqacctggca ggccatcato gcgtcqgtgc ccgcgtccgc ggtocggctc 6661 - accgagcgca gcaaactggc caaqcaactt. ctcatcqgat acgtcacgtc gggcaccctg 6721 - attctqqctq ccgq-tgccat cgcqqtcgtg gtgcgcgggc acttctttgt acacagcctg 6781 - gtggtogcgg gtttqatcac qaccgtctgc ggatttcgct ogcggcttta cgccgagcgc 6841 - tggtgtqcqt qqqcgttgot ggcggcgacg gtcgcgatto cqacgggtct gacggccaaa 6901 - ctcafccatct gqtacoogca ctatgcctgg ctxrttqtfcga gogtctacct caoggtagcc 6961 - ctggttqcqc tcgtggtggt cggg-tcgatg gctcacgt.cc ggcgcgtttc accggtcgta 7021 - aaacgaactc tggaattgat ogaoggcgcc atgatcgctg ccatcattcc catgctgctg 7081 - tggatcaccg ggqtqtacga cacggtccgo aatatocqgt tctgagocgg atoggctqat 7141 - tggcgqttcc tgacagaaca tcgaggacac ggcgcaqgtt tgcatacctt cggcgcccga 7201 - caaattgctg cqattqagcg tgtggogogt ccggtaaaat ttgctcgatg gggaacacgt 7261 - ataqqagatc oggcaatggc •tgaaccgttq qccqtcqatc ccaccggctt gagcgcagcg 7321 - gccgcgaaat faggccggcct cqtttttooq cagcctccgg cgccgatcgc ggtcagogga 7381 - acggattcgg tjggtagcagc aatcaacaag accatgccaa gcatcgaatc gcrbggtcagt 7441 - gacgqqctgc ccggcgtgaa agccgcoctg actoqaacag catccaacat gaacgcggcg 7501 goggacqtct atgogaaqac ogatcagtca ctgggaacca gtttgagcoa gtatgcattc 7561 - ggctcg-fccgg gcgaaggcct ggctggcgtc gcctcggtcg gtggtoaqcc aaqtoagqct 7621 - acccagctgc tgagcacacc cgtgtcacag gtcaoqaccc agctcggcqa gacggocgct 7681 - gagctqgcac cccqtqtt-qt tgcqacgqtg ccgcaactcg t-tcagctggc tccgcacgcc 7741 - gttcaqatqt ogcaaaaogc atccccoatc gctcagacga tcagtcaaac cgcccaacag 7801 - gccgcccaga gcgcgcaggg cggcagcggc ecaatqcccg cacagcttgc cagcgctqaa 7861 - aaaccqgcca ccgagcaagc ggagccggto cacgaaqtga caaacgaoga tcagggogac 7921 - cagggcgacg tgcagccggc cqagqtcgtt gccgcggcac gtgacgaagg cgccggcgca 7981 - teacogggcc agcagcoogg cggaggogtt cccgcgcaag ccatggatac cggagccggt 8041 - gcccgcccag cggcgaqtec qctgqcggcc cccgtegato cgtogactoc ggcaccctca 8101 - acaaccacaa cqttqtagac cgggcctgcc agcggctccg totogcaogc agcgcctqtt 8161 - gctqtecfcqq cotoqtcagg atgcggcggc cagggcccgg tcgaqcaacc cggtgacgta 8221 - ttgocagtac agccaqtoog cgacggccac acqctqqacq qccqcqtcaq t.cgcagtgtq 8281 - cgcttggtgc aqqgcaatct cotgtgagtg qqcagcgtag gcccggaacg cccgcagatg 8341 - agcgqccteg cqgccqgtag oggtgctqgt catqqqcttc atcagctcga accacagcat 8401 - gtgccgctca tcgcccggtg gattqacatc caccggcgcc ggcggcaaca agtcgagcaa 8461 - aogctgatog qtaqtqtoqq ccagctgagc cgccgccgag gggtcgacga cctccagccq 8521 - cgaccggccc gtcattttqc cgctctccgg aatqtcatct ggctccagca caatcttggc 8581 - cacaccggga tccqaactgq ccaactgctc cgoggtoccg atcacogccc qcaqcgtcat 8641 - gtogtggaaa gccgcccagg cttgcacggc caaaaccggg taggtggcac agcgtgcaat 8701 - ttoqtcaaoc gqgattgcgt: gateogogct ggccaaqtac accttattcg gcaattccat 8761 - cccgfccgggt atgtaggcca qcccataqct qttggocacg acgatggaac cgtcggtggt 8821 - caccgoggtg atccagaaga accogtaqtc gcccqcqttg ttgtoqgaog cgttxyagcgc 8881 - cgccgcga-bg cg~tcgcgcca accgcaqcgc atcaccgcgg ccacgctggc gggcgctggc 8941 - agcfcgcagtjg qcqqcqtcgc gtgcçxrcccxg agccqccqac accgqgatca tcgacaccgg