Método de seleção de bovinos com maior capacidade de crescimento e ganho de peso

  • Número do pedido da patente:
  • PI 0403770-7 A2
  • Data do depósito:
  • 08/09/2004
  • Data da publicação:
  • 02/05/2006
Inventores:
  • Classificação:
  • C12Q 1/68
    Processos de medi??o ou ensaio envolvendo enzimas ou micro-organismos; Composições para esse fim; Processos de preparação de tais composições; / envolvendo ?cidos nucleicos;
    ;
    C12N 15/18
    Muta??o ou engenharia gen?tica; DNA ou RNA concernentes ? engenharia gen?tica, vetores, p. ex. plasm?deos ou seu isolamento, prepara??o ou purifica??o; Uso de seus hospedeiros; / Tecnologia do DNA recombinante; / Fragmentos de DNA ou RNA; Suas formas modificadas; / Genes que codificam prote?nas animais; / Horm?nios; / Horm?nios de crescimento;
    ;

"MÉTODO DE SELEÇÃO DE BOVINOS COM MAIOR CAPACIDADE DE CRESCIMENTO E GANHO DE PESO". A presente invenção refere-se a um método de seleção de rebanho bovino com maior capacidade de aumento de peso consistindo nas etapas de: a) colheita de um pequeno fragmento ou porção de um tecido qualquer do corpo de cada animal do rebanho, b) extração do DNA genômico desse fragmento de tecido, c) identificação das variantes da região promotora do gene de um hormônio bovino e/ou da região promotora do gene do receptor de um hormônio bovino, que podem estar presentes em homozigose ou heterozigose, em cada indivíduo do rebanho, e d) seleção positiva de animais com os genótipos caracterizados pela presença dos alelos longos da região promotora do gen do receptor do hormônio de crescimento, GHR, e seleção negativa de animais com os genótipos caracterizados pela presença dos alelos curtos da região promotora do GHR, e e) seleção positiva de animais com os genótipos caracterizados, simultaneamente, pela presença dos alelos longos da região promotora do gen do receptor do hormônio de crescimento, GHR, e presença do alelo longo da região promotora do gen do hormônio de crescimento, GH, e f) seleção negativa de animais com os genótipos caracterizados, simultaneamente, pela presença dos alelos curtos das regiões promotoras do GHR e do GH, respectivamente.

Página de 1

Documento

"MÉTODO DE SELEÇÃO DE BOVINOS COM MAIOR CAPACIDADE

DE CRESCIMENTO E GANHO DE PESO"

CAMPO DA INVEÇÃO

A presente invenção refere-se a um método de seleção de bovinos e ao melhoramento genético de bovinos, proporcionando aumento em sua produtividade, baseado na seleção e fixação de variantes genéticas ou alelos do promotor do gene do receptor do hormônio de crescimento (GHR), isoladamente ou em combinação com a seleção e fixação de variantes genéticas ou alelos do promotor do gene do hormônio do crescimento (GH) .

ANTECEDENTES DA INVENÇÃO

No passado, a seleção e o melhoramento genético de animais de criação eram feitos apenas com base nas características fenotípicas, ou aparência externa dos animais. Num estágio intermediário, métodos estatísticos e computacionais foram agregados à avaliação fenotípica, dando origem à era da seleção assistida por índices de probabilidade de herança, dos quais as DEPs - Diferenças Esperadas na Progênie são o exemplo mais representativo. 0 avanço da genética molecular e das poderosas ferramentas da tecnologia do DNA tornou possível "enxergar" além das aparências externas e buscar no DNA dos animais de criação as informações de interesse para a seleção. Esta nova tecnologia denomina-se "Seleção Assistida por Marcadores", entendendo-se marcadores como informações genético-moleculares. Marcadores ligados a variações na seqüência do gene do receptor do hormônio de crescimento bovino, conhecido pela sigla GHR (Growth Hormone Receptor gene) e localizado no cromossomo 20 do boi (Bos spp.) , foram descritos e seu uso para a seleção e o melhoramento genético de rebanhos da espécie Bos taurus ou o grupo dos taurinos foi sugerido (Lucy et al., 1998; Hale et al., 2000). Uma variação, um polimorfismo de até 20 repetições do dinucleotí-deo TG localiza-se na posição 5' não transcrita do GHR, 90 pares de bases a montante de um importante sítio de início da transcrição deste gene, chamada de região promotora do gene. Hale e colaboradores (2000) associaram a presença da variante de 11 repetições, chamada de "alelo curto" a um menor crescimento em animais taurinos da raça Angus, comparado à presença de variantes com maior número de repetições, ou alelos longos. Entretanto, a literatura ainda não descreve a presença de alelos longos em bovinos da espécie Bos indicus, conhecidos como zebuínos, e tampouco registra estudos de associação entre estes alelos e o crescimento nestes animais. Isto motivou a pesquisa e o desenvolvimento do presente método de seleção, que será descrito a seguir.

SUMÁRIO DA INVENÇÃO

A natureza química do gene que codifica a síntese do receptor do hormônio de crescimento em um bovino é conhecida. Esse gene é composto por uma seqüência de bases nucle-otídicas próprias, que se encontra depositada nos bancos de dados de seqüências genéticas. Entretanto, pequenas variações ou desvios desta seqüência são possíveis e refletem a variação individual, que é natural em qualquer população de qualquer ser vivo conhecido. Essas variações ou desvios, também chamados de polimorfismos, podem ser responsáveis por

alterações metabólicas significativas, que afetam características de interesse para a produtividade nos rebanhos.

A presente invenção partiu da descoberta original de que o espectro da variação, contida em um trecho do DNA de animais da espécie Bos indicus chamada região promotora do gene do receptor do hormônio do crescimento, é maior do que anteriormente se pensava, e consiste na existência de, pelo menos, 20 repetições do dinucleotídeo TG neste trecho do DNA de zebuínos.

A região promotora é um fragmento da seqüência do DNA onde se situam elementos ou trechos de DNA responsáveis pelo controle da ativação ou desativação do gene, de acordo com as necessidades ou peculiaridades fisiológicas de cada organismo. Desta forma, variações na região promotora podem modificar o padrão de ativação ou desativação do gene do hormônio do crescimento, alterando seu efeito final sobre o organismo.

Foi constatado aqui que há determinadas raças de gado, por exemplo o gado das raças zebuínas, como a raça Ne-lore e outras, que apresentam um polimorfismo, ou seja, o dinucleotídeo TG está repetido, em tandem, na região promotora do gene do receptor do hormônio do crescimento (GHR), até 20 vezes, em alguns dos elementos do rebanho.

Estudando as características de desenvolvimento do rebanho, verificou-se que os elementos do rebanho que apresentavam maior número dessa repetição do dinucleotídeo TG ou alelos longos na região promotora do gene do GHR ganhavam mais peso e altura que os outros elementos do rebanho cuja

seqüência continha um menor número de repetições do dinucle-otídeo TG ou alelos curtos nesta mesma região. Verificou-se, também, que a associação dos alelos longos da região promotora do GHR e o alelo longo ou alelo G2 da região promotora do gen do hormônio do crescimento (GH), localizada no cromossomo 19 do boi (conforme descrito em outro pedido de patente depositado, em 2002, pela empresa coligada, Genon Genética ltda.), em um mesmo animal, potencializa os ganhos de produtividade, crescimento e ganho de peso deste animal, de maneira significativa. Desenvolveu-se, a partir destas observações, um novo método de seleção de bovinos visando ao aumento de sua produtividade.

DESCRIÇÃO DETALHADA DA INVENÇÃO

A invenção tem assim por objetivo um método para seleção de rebanho bovino com maior capacidade de crescimento e aumento de peso, em que o processo consiste na seleção de uma determinada variante genotípica ou alelo na região promotora do gene do GHR de gado, especialmente do gado ze-buíno, que apresenta um maior número de repetições do dinu-cleotídeo TG na seqüência de DNA do gene do referido receptor do hormônio de crescimento bovino, GHR. Esta seleção pode ser feita isoladamente ou em combinação com a seleção de uma determinada variante genotípica ou alelo na região promotora do gene do hormônio do crescimento ou GH de gado, potencializando o aumento de produtividade dos rebanhos assim selecionados.

0 método da presente invenção consiste nas seguintes etapas:

1)    colheita de um pequeno fragmento ou porção de um tecido qualquer do corpo de cada animal do rebanho;

2)    extração do DNA-ácido desoxirribonucléico genô-mico deste fragmento de tecido;

3)    identificação das variantes da região promotora do gene do receptor do hormônio do crescimento (GHR) , que podem estar presentes em homozigose (par de alelos idênticos entre si) ou heterozigose (par de alelos distintos entre si) , em cada indivíduo do rebanho; pode ser feita, concomitantemente, identificação das variantes da região promotora do gene do hormônio do crescimento (GH) , que também podem estar presentes em homozigose ou heterozigose, em cada indivíduo do rebanho;

4)    a seleção positiva de animais portadores das variantes longas das duas regiões promotoras, do GHR e/ou do GH, e negativa de animais portadores das formas curtas destas regiões promotoras.

Os ganhos de produtividade conferidos por este método de seleção incluem:

(a)    um aumento de 45-120 g no ganho de peso diário dos animais, na fase de crescimento (7-24 meses de idade), em regime de estabulação e de 10-100 g/dia, na mesma fase, em regime exclusivo de pasto;

(b) um aumento de 1-5 cm na altura dos animais, nestas mesmas condições ambientais. Estes ganhos de produtividade se refletem em um aumento médio de duas arrobas de peso vivo (30 kg) ao final da fase de crescimento.

Esses ganhos estão sendo validados tanto em estudos populacionais quanto em cruzamentos-testes. Ganhos desta monta somente são obtidos pela técnica tradicional de feno-tipagem, por exemplo, cálculo de DEPs e a utilização destes índices para programar acasalamentos no decorrer de várias gerações em um rebanho, enquanto a nova técnica possibilita um ganho imediato, uma vez conhecida e selecionada a melhor constituição genética ou genótipo ganhador, conforme acima descrito.

Os ganhos proporcionados pela aplicação da nova técnica são mais previsíveis, portanto mais seguros e mais reproduzíveis. Uma vez conhecido o genótipo de cada animal, fica mais fácil, objetivo e seguro programar acasalamentos visando o aumento da produtividade. 0 genótipo do animal pode ser conhecido no momento do nascimento, bastando colher uma amostra de um tecido do animal, para análise do DNA. Os programas de seleção e melhoramento genético são acelerados, esforços inúteis são poupados, com economia de tempo e dinheiro .

A genotipagem agrega valor de mercado aos animais, pois seu genótipo passa a ser conhecido e suas características hereditárias deixam de ser uma mera especulação ou questão de probabilidade. Uma vez que o critério de seleção é baseado em um dado genético objetivo, é possível racionalizar um empreendimento e prever, com maior segurança, o retorno dos investimentos.

Mostrado abaixo está um trecho da seqüência de nu-cleotídeos que circunda o maior alelo conhecido do polimor-



fismo de repetição TG na região promotora do GHR (seqüência do GHR depositada no GenBank sob o número de acesso U15731-Bos taurus). A seqüência referente a Bos indicus, depositada sob o número de acesso AF040955, representa apenas o alelo 5 curto do polimorfismo TG.

Alelo longo (20 repetições TG, sublinhadas) da região promotora do GHR. A TATA box também está sublinhada:

GTTCGTTATGTGAGGCAATGCGTTGTGTGCTCTAATCTTTTCTGGTACCA GGTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGACTGGGAGGGAGGAAGA 10 GAGAGAAAATGTAATTGATTTGGGGAGGATTTGGGGAAGGTTTATATAGGAAAGCAGCAA GACCAAGAAT

Deve ficar claro que modificações e variações podem ser introduzidas na modalidade da invenção aqui descrita sem que com isso se caracterize um desvio do escopo da invenção.



REFERÊNCIAS

Hale,    C.S.;    Herring,    W.O.;    Shibuya,    H.;    Lucy,

M.C.; Lubahn, D.B.; Keisler, D.H.; Johnson, G.S. Decreased growth in Angus steers with a short TG-microsatellite allele 5 in the PI promoter of the growth hormone receptor gene. J. Anim. Sei. 2000. 78:2099-2104.

Lucy,    M.C.;    Johnson,    G.S.;    Shibuya,    H.;    Boyd,

C.K.; Herring, W.O. Rapid communication:    Polymorphic (GT)n

10 microsatellite in the bovine somatotropin receptor gene promoter. J. Anim. Sei. 2000. 78:2099-2104. J. Anim. Sei. 1998.

76:2209-2210.

• • •• • • • •


REIVINDICAÇÕES

1. Método de seleção de bovinos com maior capacidade de crescimento e ganho de peso CARACTERIZADO pelo fato de que consiste nas etapas de:

a)    colheita de um pequeno fragmento ou porção de um tecido qualquer do corpo de cada animal do rebanho,

b)    extração do DNA genômico desse fragmento de tecido,

c)    identificação das variantes genotípicas da região promotora do gene do receptor do hormônio de crescimento bovino, isoladamente ou em conjunto com a identificação das variantes genotípicas da região promotora do gene do hormônio de crescimento bovino, que podem estar presentes em homozigose ou heterozigose, em cada indivíduo do rebanho, e

d)    seleção positiva de animais com os genótipos definidos pela presença dos alelos longos das respectivas regiões promotoras dos GHR e GH, e seleção negativa de animais com os genótipos definidos pela presença dos alelos curtos das respectivas regiões promotoras dos GHR e GH.

2.    Método, de acordo com a reivindicação 1, CARACTERIZADO pelo fato de que o hormônio bovino é o hormônio de crescimento GH, e o receptor deste hormônio é o GHR.

3.    Método, de acordo com a reivindicação 1 ou 2, CARACTERIZADO pelo fato de que são selecionados os animais contendo uma repetição do trinucleotídeo AAG na seqüência de DNA do gene do hormônio de crescimento, GH, isolada ou simultaneamente à detecção dos alelos longos na seqüência de

•• • • ••• •••••••• « • • •


• • •••••• • • • • • *

• t • •••••• • • •

•••• • •• •• • • • •

DNA do gene do receptor do gene do hormônio de crescimento, GHR.

4.    Método,    de    acordo    com    a    reivindicação    1,

CARACTERIZADO pelo fato de haver um aumento de 45 a 120 g no

5 ganho de peso diário dos animais, na fase entre 7 a 24 meses de idade em regime de estabulação.

5.    Método,    de    acordo    com    a    reivindicação    1,

CARACTERIZADO pelo fato de haver um aumento de 10 a 100 g por dia no ganho de peso na fase entre 7 a 24 meses de ida-

10 de, em regime exclusivo de pasto.

6.    Método,    de    acordo    com    a    reivindicação    1,

CARACTERIZADO pelo fato de haver um aumento de 1 a 5 cm na altura dos animais na fase de 7 a 24 meses de idade.

7.    Método,    de    acordo    com    a    reivindicação    1,

15 CARACTERIZADO pelo fato de que aos 24 meses de idade há um

aumento médio de 30 kg de peso nos animais.

8.    Método, de acordo com qualquer uma das reivindicações 1 a 3, CARACTERIZADO pelo fato de que determinadas variantes genotípicas da região promotora do gene GH e/ou do gene GHR são selecionadas para se obter ganhos de produtividade ou ganho de peso em bovinos.

• •• •• • •• •••••••••#•• • •

• « •••• •• • • •••

• • ••••••• • • • • •

• • • •••••• • • • » « •

•    • è •    ••••••    •    ••

•    ••• •• •••••• • ••

RESUMO

"MÉTODO DE SELEÇÃO DE BOVINOS COM MAIOR CAPACIDADE DE CRESCIMENTO E GANHO DE PESO"

A presente invenção refere-se a um método de seleção de rebanho bovino com maior capacidade de aumento de peso consistindo nas etapas de:

a)    colheita de um pequeno fragmento ou porção de um tecido qualquer do corpo de cada animal do rebanho,

b)    extração do DNA genômico desse fragmento de tecido,

c) identificação das variantes da região promotora do gene de um hormônio bovino e/ou da região promotora do gene do receptor de um hormônio bovino, que podem estar presentes em homozigose ou heterozigose, em cada indivíduo do rebanho, e

d)    seleção positiva de animais com os genótipos caracterizados pela presença dos alelos longos da região promotora do gen do receptor do hormônio de crescimento, GHR, e seleção negativa de animais com os genótipos caracterizados pela presença dos alelos curtos da região promotora do GHR, e

e)    seleção positiva de animais com os genótipos caracterizados, simultaneamente, pela presença dos alelos longos da região promotora do gen do receptor do hormônio de crescimento, GHR, e presença do alelo longo da região promotora do gen do hormônio de crescimento, GH, e

• • ••• •• • •• •«•••••••••• ••

• •••• •• • • •••

• •••*•••• • •••

M    •    •    ••••••    •    •    •    •    •    •

f) seleção negativa de animais com os genótipos caracterizados, simultaneamente, pela presença dos alelos curtos das regiões promotoras do GHR e do GH, respectivamente.