Aristeu Vieira da Silva

Aristeu Vieira da Silva é doutor em Doenças Tropicais pela Faculdade de Medicina da UNESP/Botucatu (2003). Atualmente é Professor Pleno da Universidade Estadual de Feira de Santana (UEFS/BA), e coordenador do Grupo de Pesquisa em Zoonoses e Saúde Púlica. Publicou mais de uma centena de artigos em periódicos científicos com "peer review", e mais de 350 trabalhos em anais de eventos. Orientou dissertações de Mestrado e teses de Doutorado, trabalhos de Iniciação Científica, Especializações e Trabalhos de Conclusão de Curso de Graduação nas áreas de Medicina Veterinária, Farmácia e Ciências Biológicas. Recebeu quatro prêmios ou homenagens. Participa de projetos de pesquisa na UEFS, FIOCRUZ/RJ, UFBA, UESC, IEC/MS e UNESP. É associado do Colégio Brasileiro de Parasitologia Veterinária, da Associação de Profissionais de Epidemiologia de Campo (ProEPI), da Sociedade Brasileira para o Progresso da Ciência (SBPC) e da International Society of Geospatial Health (GnosisGIS). Atua na área de Epidemiologia, com ênfase em Zoonoses e Saúde Pública. Tem sido coordenador de projetos de pesquisa e extensão patrocinados pela FAPESB, CNPq e CAPES. Os termos mais freqüentes na contextualização da produção científica são toxoplasmose, epidemiologia e zoonoses. É bolsista de produtividade em pesquisa do CNPq na área de Medicina Veterinária.

Informações coletadas do Lattes em 24/05/2022

Acadêmico

Formação acadêmica

Doutorado em Doenças Tropicais

2000 - 2003

Universidade Estadual Paulista Júlio de Mesquita Filho
Título: Avaliação da infecção de ratos Fischer com duas amostras geneticamente distintas de Toxoplasma gondii: cinética de anticorpos, reisolamento em camundongos e reação em cadeia pela polimerase
Helio Langoni. Bolsista do(a): Fundação de Amparo à Pesquisa do Estado de São Paulo, FAPESP, Brasil. Palavras-chave: Toxoplasmose; Rattus norvegicus; Infecção experimental; Sorologia; Isolamento; Reação em cadeia pela polimerase. Grande área: Ciências AgráriasSetores de atividade: Desenvolvimento de Produtos Tecnológicos Voltados Para A Saúde Humana.

Mestrado em Medicina Veterinária

1997 - 1999

Universidade Estadual Paulista Júlio de Mesquita Filho
Título: Toxoplasmose ovina: Avaliação de métodos diretos na detecção do seu agente em cordeiros sorologicamente positivos, abatidos para consumo humano. Botucatu, 1999,Ano de Obtenção: 1999
Helio Langoni.Bolsista do(a): Fundação de Amparo à Pesquisa do Estado de São Paulo, FAPESP, Brasil. Palavras-chave: Toxoplasmose; Ovina; Diagnóstico; Sorologia; Isolamento; Reação em cadeia pela polimerase. Grande área: Ciências AgráriasGrande Área: Ciências Agrárias / Área: Medicina Veterinária / Subárea: Medicina Veterinária Preventiva / Especialidade: Epidemiologia Animal. Grande Área: Ciências Agrárias / Área: Medicina Veterinária / Subárea: Medicina Veterinária Preventiva / Especialidade: Saneamento Aplicado a Saúde do Homem. Setores de atividade: Produção Animal, Inclusive Serviços Veterinários; Saúde Humana.

Aperfeiçoamento em Formação de Educadores Ambientais

1999 - 2001

Universidade Estadual Paulista Júlio de Mesquita Filho
Título: Utilização da World Wide Web como Fonte de Recursos em Educação Ambiental. Ano de finalização: 2001
Orientador: Carlos Rodrigues Teixeira

Aperfeiçoamento em Residência Em Zoonoses e Saúde Pública FMVZ

1995 - 1997

Universidade Estadual Paulista Júlio de Mesquita Filho
Título: Não se aplica. Ano de finalização: 1997
Orientador: Helio Langoni
Bolsista do(a): Fundação de Desenvolvimento Administrativo, FUNDAP, Brasil.

Graduação em Medicina Veterinária

1990 - 1994

Universidade Estadual Paulista Júlio de Mesquita Filho

Formação complementar

2019 - 2019

Pintura Ornamental para Templos Budistas - Teoria e Prática. (Carga horária: 12h). , Centro de Estudos Budistas Bodisatva, CEBB, Brasil.

2019 - 2019

Curso em Estudos Epidemiológicos Espaciais no QGis. (Carga horária: 40h). , Diretoria de Vigilância Epidemiológica, DIVEP, Brasil.

2014 - 2014

Laboratório de Sorologia e Imunobiologia do IMT-SP. (Carga horária: 64h). , Universidade de São Paulo, USP, Brasil.

2012 - 2012

XII Curso Internacional de Epidemiologia Molecular. (Carga horária: 40h). , Centro de Pesquisas Gonçalo Moniz, CPGM-FIOCRUZ-BA, Brasil.

2008 - 2008

Programa de Valorização do Magistério Superior. (Carga horária: 12h). , Universidade Paranaense, UNIPAR, Brasil.

2005 - 2005

Identificação de Vetores de Interesse Médico. (Carga horária: 15h). , Sociedade Brasileira de Parasitologia, SBP**, Brasil.

2003 - 2003

Doenças Infecciosas Em Cães e Gatos. (Carga horária: 14h). , Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Brasil.

1998 - 1998

Planejamento e Técnica Em Educação e Saúde. (Carga horária: 2h). , Centro Nacional de Epidemiologia, CENEPI, Brasil.

1998 - 1998

Fundamentos de Epidemiologia e Investigação Epidem. (Carga horária: 2h). , Centro Nacional de Epidemiologia, CENEPI, Brasil.

1997 - 1997

Estatística Básica Através do Sas Para Windows. (Carga horária: 20h). , Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Brasil.

1996 - 1996

Técnicas Imunológicas e de Biologia Molecular Apli. (Carga horária: 15h). , Universidade de São Paulo, USP, Brasil.

1996 - 1996

Dermatologia de Pequenos Animais. (Carga horária: 20h). , Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Brasil.

1996 - 1996

Atualização Em Tuberculose Bovina. (Carga horária: 20h). , Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Brasil.

1995 - 1995

Leptospirose Saúde Animal e Saúde Pública. (Carga horária: 12h). , Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Brasil.

1995 - 1995

Atualização e Novas Perspectivas Em Tuberculose. (Carga horária: 4h). , Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Brasil.

1995 - 1995

Mastite X Produção Leiteira. (Carga horária: 8h). , Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Brasil.

1995 - 1995

Seminário Estadual de Atualização Em Raiva. (Carga horária: 24h). , Instituto Pasteur de São Paulo, IP-SP, Brasil.

1995 - 1995

Epi Info Organização das Informações Em Pesquisa. (Carga horária: 12h). , Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Brasil.

1995 - 1995

Estágio Diagnóstico Raiva Humana e Animal. (Carga horária: 80h). , Instituto Pasteur de São Paulo, IP-SP, Brasil.

1994 - 1994

Tuberculose Produção Animal e Saúde Pública. (Carga horária: 12h). , Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Brasil.

1994 - 1994

Estágio Zoonoses Saúde Pùblica. (Carga horária: 180h). , Centro de Controle de Zoonoses São Paulo, CCZ, Brasil.

1994 - 1994

Estágio Supervisionado Obrigatório. (Carga horária: 1760h). , Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Brasil.

1994 - 1994

Estágio Patologia Animal. (Carga horária: 160h). , José Di Fabio Laboratório de Patologia Animal, JF, Brasil.

1993 - 1993

Patologia Clínica Veterinária. (Carga horária: 15h). , Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Brasil.

1993 - 1993

Mastite Bovina Produção Leiteira e Saúde Pública. (Carga horária: 13h). , Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Brasil.

1993 - 1993

Estágio Reprodução Animal. (Carga horária: 180h). , Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Brasil.

1993 - 1993

Estágio Zoonoses. (Carga horária: 192h). , Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Brasil.

1993 - 1993

Estágio Planejamento Saúde Animal Saúde Pública. (Carga horária: 160h). , Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Brasil.

1992 - 1992

Equideocultura. (Carga horária: 26h). , Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Brasil.

1992 - 1992

Condutas Clínico Cirúrgicas e Fisioterápicas Em An. (Carga horária: 32h). , Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Brasil.

1992 - 1992

Estágio Anestesiologia Veterinária. (Carga horária: 160h). , Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Brasil.

1991 - 1991

Curso Atualização Ovinocultura. (Carga horária: 16h). , Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Brasil.

1991 - 1991

Mosca do Chifre Nova Ameaça à Pecuária Nacional. (Carga horária: 6h). , Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Brasil.

1991 - 1991

Manejo e Clínica de Animais Silvestres. (Carga horária: 32h). , Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Brasil.

1990 - 1990

II Curso de Atualização Em Biotécnicas da Reproduç. (Carga horária: 24h). , Universidade Estadual Paulista Júlio de Mesquita Filho, UNESP, Brasil.

Idiomas

Bandeira representando o idioma Inglês

Compreende Razoavelmente, Fala Pouco, Lê Bem, Escreve Razoavelmente.

Bandeira representando o idioma Espanhol

Compreende Razoavelmente, Fala Razoavelmente, Lê Bem, Escreve Pouco.

Bandeira representando o idioma Português

Compreende Bem, Fala Bem, Lê Bem, Escreve Bem.

Áreas de atuação

Grande área: Ciências Agrárias / Área: Medicina Veterinária / Subárea: Medicina Veterinária Preventiva/Especialidade: Doenças Infecciosas de Animais.

Grande área: Ciências Agrárias / Área: Medicina Veterinária / Subárea: Medicina Veterinária Preventiva/Especialidade: Doenças Parasitárias de Animais.

Grande área: Ciências Agrárias / Área: Medicina Veterinária / Subárea: Medicina Veterinária Preventiva/Especialidade: Epidemiologia Animal.

Grande área: Ciências Agrárias / Área: Medicina Veterinária / Subárea: Medicina Veterinária Preventiva/Especialidade: Saneamento Aplicado a Saúde do Homem.

Grande área: Ciências Agrárias / Área: Medicina Veterinária / Subárea: Medicina Veterinária Preventiva/Especialidade: Saúde Animal (Programas Sanitários).

Organização de eventos

DA SILVA, A.V. ; OLIVEIRA, S. S. ; ROCHA, W. J. S. F. ; RODRIGUES, D. P. ; OLIVEIRA, P. M. V. ; SILVA, C. A. . Estudos Epidemiológicos Espaciais no QGIS. 2017. (Outro).

LANGONI, H. ; LUCHEIS, Simone Baldini ; Da SILVA, A. V. ; GIMENES BOSCO, S.M. . Saúde Pública: Desafios no Enfrentamento das Zoonoses. 2014. (Outro).

JESUS, T. B. ; ALMEIDA, N. L. F. ; DA SILVA, A.V. ; ASSIS, M. M. A. . XVII Seminário de Iniciação Científica da UEFS - Ciência, Saúde, Esporte. 2013. (Congresso).

SANTANA, J. C. B. ; SOUZA, J. C. ; ASSIS, M. M. A. ; ALMEIDA, N. L. F. ; da Silva, Aristeu V. . XVI SEMIC: Seminário de Iniciação Científica - Sustentabilidade, Erradicação da Pobreza e Economia Verde. 2012. (Congresso).

da Silva, Aristeu V. ; ALMEIDA, P. H. A. ; SANTOS, S. A. A. . I Simpósio de Integração Graduação-Pós-Graduação do Grupo de Pesquisa em Zoonoses e Saúde Pública. 2012. (Outro).

ALVES, A. D. R. ; ORLEANS, A. R. D. G. P. ; JESUS, A. D. C. ; Da SILVA, A. V. ; SANTOS, E. M. C. ; MARQUES, E. F. L. ; GUEDES, G. P. ; P.TEIXEIRA, E. S. ; SANTOS, F. A. R. . XV SEMIC - Seminário de Iniciação Científica. 2011. (Congresso).

Da SILVA, A. V. ; HERMES, C. ; GOES, M. B. . IV Encontro Científico do Mestrado em Ciência Animal. 2009. (Congresso).

MARTINS, L.A. ; HERMES, C. ; MARTINI, K. C. ; MORESCHI, E. G. ; Da SILVA, A. V. . III Encontro Científico do Mestrado em Ciência Animal. 2008. (Congresso).

Da SILVA, A. V. ; MANZANO, M. A. ; ARAÚJO, J. B. ; SILVA, J. S. . Mostra de Filmes: Evolução e Biodiversidade. 2008. (Outro).

Da SILVA, A. V. ; GALLI, S. ; SILVA, R. P. B. ; LUCAS, T. M. ; ZAMPROGNA, T. O. . I Ciclo de Palestras do Mestrado em Ciência Animal. 2007. (Outro).

Da SILVA, A. V. . II Encontro Científico do Mestrado em Ciência Animal. 2007. (Congresso).

Da SILVA, A. V. . I Encontro Científico do Mestrado em Ciência Animal. 2006. (Congresso).

PIAU JÚNIOR, R. ; PINTO NETO, A. ; ACCO, A. ; GONÇALVES, G.F. ; Da SILVA, A. V. . IX JOVET - Jornada do Curso de Medicina Veterinária da UNIPAR- VI Mostra Científica em Medicina Veterinária - I ARTVET - I Exposição Artistica da Veterinária. 2005. (Outro).

Da SILVA, A. V. . II Seminário Pedagógico do Curso de Farmácia Bioquímica. 2004. (Outro).

Da SILVA, A. V. ; LANGONI, H. ; PEZERICO, S.B. ; da SILVA, R. C. ; CASTRO, A. P. B. C. ; VOGL, Mônika . Simpósio: Biologia Molecular. 2003. (Outro).

Da SILVA, A. V. ; LANGONI, H. ; ASSIS, A.C.B. . Tuberculose e Micobacterioses: Doença nos Animais e Aspectos de Saúde Pública. 2001. (Outro).

LANGONI, H. ; DOMINGUES, Paulo Francisco ; Da SILVA, A. V. ; RIBEIRO, M.G. ; CABRAL, K.G. ; MARCOS JÚNIOR, G. . III Encontro de Pesquisadores em Mastites. 1999. (Congresso).

ROCHA, N.S. ; Da SILVA, A. V. . Curso de Atualização em Imunohistoquímica. 1998. (Outro).

LANGONI, H. ; Da SILVA, A. V. ; CABRAL, K.G. ; BALDINI, Simone . Leptospirose: Saúde Animal e Saúde Pública. 1995. (Outro).

LANGONI, H. ; Da SILVA, A. V. . Workshop: Tuberculose - Produção Animal e Saúde Pública. 1994. (Outro).

LANGONI, H. ; Da SILVA, A. V. ; RIBEIRO, M.G. . Workshop: Mastite bovina, produção leiteira e saúde pública. 1993. (Outro).

Participação em eventos

Encontro Nacional do Fórum de Pró-Reitores de Pesquisa e Pós-Graduação das Universidades Estaduais e Municipais. 2019. (Encontro).

VII Workshop CT-INFRA N/NE/CO. 2019. (Oficina).

VI Workshop de Pós-Graduação Stricto Sensu da UNEB.Perspectivas para a Educação Superior e Pós-Graduação das Universidades Estaduais da Bahia. 2019. (Oficina).

Encontro de Coordenadores de Cursos, vinculados à Área de Educação CAPES. 2018. (Encontro).

V International Meeting of Biosciences and Physiopathology. Pensamentos Intestinais: Uma Coletânea de Aforismos Microbianos Neurotransmitidos. 2018. (Congresso).

X Workshop Internacionalização Universitária "Um Olhar para O Futuro.A Internacionalização da Pesquisa. 2018. (Encontro).

XX Congresso Brasileiro de Parasitologia Veterinária. Alterações induzidas pelo Toxoplasma gondii no Sistema Nervoso Entérico. 2018. (Congresso).

69a Reunião Anual da SBPC. 2017. (Congresso).

IX Workshop Internacionalização Universitária.Impactos, Resultados e Compromisso Social da Internacionalização no Ensino, na Pesquisa e na Extensão. 2017. (Outra).

Reunião do Fórum de Pró-Reitores de Pesquisa e Pós-Graduação-FOPROPNE. 2017. (Encontro).

Sentinelas Animais em Saúde ùnica. 2017. (Seminário).

2a Reunião do Fórum de Pró-Reitores de Pesquisa e Pós-Graduação - Regional Nordeste. 2016. (Encontro).

XIX Congresso Brasileiro de Parasitologia Veterinária. Detecção de anticorpos, bioprova em camundongos e análise de curvas de dissociação (HRM) na detecção de Toxoplasma gondii em tecidos de Gallus gallus domesticus criados extensivamente. 2016. (Congresso).

XIX Congresso Brasileiro de Parasitologia Veterinária. Soroprevalência e fatores de risco associados a infecção pelo Toxoplasma gondii e Toxocara spp em frangos criados extensivamente. 2016. (Congresso).

XXXII Encontro Nacional de Pró-Reitores de Pesquisa e Pós-Graduaçãação. 2016. (Encontro).

1a Reunião Anual do Fórum de Pró-Reitores de Pesquisa e Pós-Graduação da Região Nordeste. 2015. (Encontro).

Aula Magna UNIPAR Francisco Beltrão.De Paixões, Saberes e Outros Causos. 2015. (Outra).

XXIV Congresso Brasileiro de Parasitologia. 2015. (Congresso).

1a Reunião Anual do FOPROP Nordeste - 2014. 2014. (Encontro).

III BRISPE: Brazilian Meeting on Research Integrity. 2014. (Encontro).

Saúde Pública: Desafios no Enfrentamento das Zoonoses.A toxoplasmose no contexto da saúde pública. 2014. (Encontro).

I CIC Saúde: Seminário de Conhecimento, Inovação e Comunicação em Serviços de Saúde. 2013. (Seminário).

II Reunião Anual do FOPROP-NE. 2013. (Encontro).

II Simpósio Brasileiro de Toxoplasmose.Genotyping of Toxoplasma gondii isolates in free-range chickens from brazilian certified pig farms. 2013. (Simpósio).

VIII Reunião do Fórum Nacional de Gestores de Inovação e Transferência de Tecnologia - Seção Nordeste. 2013. (Encontro).

2o Encontro do Fórum de Pró-Reitores de Pesquisa e Pós-Graduação - Regional Nordeste. 2012. (Encontro).

Seminário Vivendo Farmácia.Palestra sobre a Pró-Reitoria de Pesquisa e Pós-Graduação. 2012. (Seminário).

XVI Congresso Médico Amazônico. Toxoplasma: Da Floresta para o Mundo?. 2012. (Congresso).

XVI Congresso Médico Amazônico. Sobre porcos, ratos e gatos: os animais e a toxoplasmose humana. 2012. (Congresso).

XVI Congresso Médico Amazônico. Prevalência de protozoários e helmintos entéricos em residentes de São Cristovão, Feira de Santana, Bahia. 2012. (Congresso).

XXVIII ENPROP - Encontro Nacional de Pró-Reitores de Pesquisa e Pós-Graduação "A. 2012. (Encontro).

49 Fórum Nacional de Reitores da ABRUEM. 2011. (Encontro).

IV Oficina Pedagógica do Curso de Odontologia. 2011. (Oficina).

Missão OUI de Universidades Canadenses no Brasil. 2011. (Encontro).

VII Encontro Nacional dos Mestrados Profissionais. 2011. (Encontro).

XXVII Encontro Nacional dos Pró-Reitores de Pesquisa e Pós-Graduação. 2011. (Encontro).

8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa. 2009. (Congresso).

7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa. Quantificação de Toxoplasma gondii pela PCR em tempo real em tecidos de galinhas soropositivas criadas extensivamente no Paraná. 2008. (Congresso).

Oficina para Eleição de Prioridades ao PPSUS. 2008. (Oficina).

Toxoplasma Centennial Congress. Genotyping of Toxoplasma gondii from chickens from Mato Grosso do Sul State, Brazil: Preliminary results. 2008. (Congresso).

XV Congresso Brasileiro de Parasitologia Veterinária. Genotipagem de Marcadores Moleculares para Diagnóstico da Toxoplasmose. 2008. (Congresso).

XV Congresso Brasileiro de Parasitologia Veterinária. Resposta Imune Celular Frente à Inoculação de Leishmania chagasi em Camundongos BALB/c Imunossuprimidos. 2008. (Congresso).

I FEPEA - Fórum de ètica em Pesquisa e Experimentação Animal da UNIPAR. 2007. (Simpósio).

IX Reunião de Coordenadores de Programa de Pós-Graduação da Área de Medicina Veterinária da CAPES. 2007. (Outra).

VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. O camundongo, o rato e o ovo embrionado: Modelos experimentais de toxoplasmose congênita. 2007. (Congresso).

14o Congresso Brasileiro de Parasitologia Veterinária & 2o Simpósio Latino-Americano de Rickettsioses. Avaliação de parâmetros hematológicos em cães negativos ou positivos para a presença de anticorpos séricos anti-Toxoplasma gondii. 2006. (Congresso).

V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade. V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR e I Encontro Científico do Mestrado em Ciência Animal. 2006. (Congresso).

VIII Reunião de Coordenadores de Programa de Pós-Graduação da Área de Medicina Veterinária da CAPES. 2006. (Encontro).

IV Encontro de Iniciação Científica, IV Fórum de Pesquisa da UNIPAR e II Encontro Paranaense de Ética.Resumos. 2005. (Encontro).

Workshop sobre Diretrizes e Prioridades em CT&I Aplicada ao Desenvolvimento do Agro-negócio Paranaense.Workshop sobre Diretrizes e Prioridades em CT&I Aplicada ao Desenvolvimento do Agro-negócio Paranaense. 2005. (Oficina).

XIV Jornada Farmacêutica de Umuarama e VIII Mostra de Trabalhos Científicos do Curso de Farmácia.XIV Jornada Farmacêutica de Umuarama e VIII Mostra de Trabalhos Científicos do Curso de Farmácia. 2005. (Outra).

XIX Congresso Brasileiro de Parasitologia. XIX Congresso Brasileiro de Parasitologia. 2005. (Congresso).

III Encontro de Iniciação Científica e III Fórum de Pesquisa.III Encontro de Iniciação Científica e III Fórum de Pesquisa. 2004. (Encontro).

XIII Congresso Brasileiro de Parasitologia Veterinária e I Simpósio Panamericano de Ricketsioses. XIII Congresso Brasileiro de Parasitologia Veterinária. 2004. (Congresso).

II Encontro de: Integração, Construindo os Saberes e Práticas Pedagógicas. 2003. (Encontro).

2o Congresso de Extensão Universitária da UNESP. Curso de Educação Ambiental à Distância "Educação Ambiental: Princípios e Práticas". 2002. (Congresso).

XXXVIII Congresso da Sociedade Brasileira de Medicina Tropical. XXXVIII Congresso da Sociedade Brasileira de Medicina Tropical. 2002. (Congresso).

Encontro - Pesquisa em Educação Ambiental: Tendências e Perspectivas.Encontro - Pesquisa em Educação Ambiental: Tendências e Perspectivas. 2001. (Encontro).

Seminário Internacional de Raiva. 2000. (Seminário).

XIII Jornada Paulista de Parasitologia. Toxoplasma gondii em animais silvestres: sorologia e isolamento do parasita. 2000. (Congresso).

Xth International Congress on Animal Hygiene. Xth International Congress on Animal Hygiene. 2000. (Congresso).

III Encontro de Pesquisadores em Mastites. Ação da enrofloxacina e amoxacilina sós e em associação no tratamento da mastite bovina. 1999. (Congresso).

III Mostra Científica da FMVZ.III Mostra Científica da FMVZ. 1999. (Encontro).

II Congreso Argentino de Zoonosis, I Congreso Argentino de Enfermedades Emergentes, I Congreso Latinoamericano de Enfermedades Emergentes. II Congreso Argentino de Zoonosis, I Congreso Argentino de Enfermedades Emergentes, I Congreso Latinoamericano de Enfermedades Emergentes. 1998. (Congresso).

III Seminário Nacional de Zoonoses e Animais Peçonhentos. III Seminário Nacional de Zoonoses e Animais Peçonhentos. 1998. (Congresso).

I Mostra Científica da FMVZ - UNESP de Botucatu.I Mostra Científica da FMVZ - UNESP de Botucatu. 1997. (Encontro).

XXIV Congresso Brasileiro de Medicina Veterinária. XXIV Congresso Brasileiro de Medicina Veterinária. 1996. (Congresso).

VII Congresso Brasileiro de Veterinários Especialistas em Suínos. VII Congresso Brasileiro de Veterinários Especialistas em Suínos. 1995. (Congresso).

XIX Jornada Científica da Associação dos Docentes do Campus de Botucatu. XIX Jornada Científica da Associação dos Docentes do Campus de Botucatu. 1995. (Congresso).

XVII Congresso Brasileiro de Clínicos Veterinários de Pequenos Animais. XVII Congresso Brasileiro de Clínicos Veterinários de Pequenos Animais. 1995. (Congresso).

XVIII Congresso Brasileiro de Microbiologia. XVIII Congresso Brasileiro de Microbiologia. 1995. (Congresso).

I Congresso de Medicina Eqüina. I Congresso de Medicina Eqüina. 1994. (Congresso).

VI Congresso de Iniciação Científica da UNESP. VI Congresso de Iniciação Científica da UNESP. 1994. (Congresso).

V Congresso de Iniciação Científica da UNESP. V Congresso de Iniciação Científica da UNESP. 1993. (Congresso).

XVIII Jornada Científica da Associação dos Docentes do Campus de Botucatu. XVIII Jornada Científica da Associação dos Docentes do Campus de Botucatu. 1993. (Congresso).

Participação em bancas

Aluno: Luane Etienne Barreto

ALBUQUERQUE, GEORGE RÊGO; ROCHA, D. S.;Da SILVA, A. V.. VERIFICAÇÃO DA EFICIÊNCIA DE PROCESSOS TECNOLÓGICOS UTILIZADOS EM PRODUTOS CÁRNEOS DESTINADOS AO CONSUMO HUMANO, VENDIDOS EM FEIRAS LIVRES NA REGIÃO SUL DA BAHIA, NA INATIVAÇÃO DE CISTOS DE Toxoplasma gondii. 2022. Dissertação (Mestrado em Ciência Animal) - Universidade Estadual de Santa Cruz.

Aluno: Lorena Moura de Assis Sampaio

BIONDI, I.;DA SILVA, ARISTEU VIEIRA; DUARTE, T. A.. Carrapatos e bactérias associadas em equídeos de tração de Feira de Santana, Estado da Bahia, Brasil. 2021. Dissertação (Mestrado em Ciências Farmacêuticas) - Universidade Estadual de Feira de Santana.

Aluno: Elainne Maria Beanes da Silva Santos

LIMA, A. E. S.; MATUSHIMA, E. R.;DA SILVA, ARISTEU VIEIRA; VIEIRA, F. M.. Lesões do trato digestório de tartarugas marinhas encalhadas no litoral norte baiano: caracterização anatomopatológica e helmintofauna associada. 2021. Dissertação (Mestrado em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia.

Aluno: Caio Vinícius Almeida Barreto de Souza

FRANKE, C. R.; BRITO, R. L.;Da SILVA, A. V.; SOLCA, M. S.. Identificação das fontes de alimentação de morcego hematófago (Desmodus rotundus) e fatores associados a sua distribuição espacial em área urbana na cidade de Salvador / BA. 2020. Dissertação (Mestrado em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia.

Aluno: Lailla Rodrigues De Macedo

Da SILVA, A. V.; GUIDELLI, G. M.; OLIVEIRA, S. S.. Fauna parasitária de Chaetodipterus faber (Broussonet, 1782) (Perciformes, Ephippidae) coletados em três locais da Baía de Todos os Santos, Bahia. 2020. Dissertação (Mestrado em Ecologia e evolução) - Universidade Estadual de Feira de Santana.

Aluno: Everton André de Oliveira

DA SILVA, A.V.GIUFFRIDA, R.SANTAREM, V. A.. Avaliação do potencial de tilápias do Nilo na eliminação de ovos de Toxocara canis para o meio ambiente. 2019. Dissertação (Mestrado em Ciência Animal) - Universidade do Oeste Paulista.

Aluno: Helimara D'anunciação Brasileiro

BISNETO, J. P. M.; GARCIA, R. P. M.;Da SILVA, A. V.. Universidade Estadual de Feira de Santana (UEFS) e o desenvolvimento da Ciência, Tecnologia e Inovação (CT&I): um estudo de caso a partir dos aportes da Fundação de Amparo à Pesquisa do Estado da Bahia (FAPESB). 2018. Dissertação (Mestrado em Gestão de Políticas Públicas e Segurança Social) - Universidade Federal do Recôncavo da Bahia.

Aluno: Amanda Ponce Morais Cerqueira

BOTURA, M. B.; PITA, S. S. R.;Da SILVA, A. V.. Modelagem comparativa, acoplamento molecular e estudo in vitro de inibidores da acetilcolinesterase de Rhipicephalus microplus. 2018. Dissertação (Mestrado em Biotecnologia) - Universidade Estadual de Feira de Santana.

Aluno: Livia Daniela Xavier da Silva Guerra

Da SILVA, A. V.; MATOS, E. D.; SILVA, M. Y. G.. Fatores preditores para o abandono do tratamento dos casos novos de tuberculose em Itabuna/BA. 2018. Dissertação (Mestrado em Saúde Coletiva) - Universidade Estadual de Feira de Santana.

Aluno: Maria Aparecida Oliveira Lima

ALCANTARA, L. C. J.; REIS, R. B.;DA SILVA, A.V.. Distribuição espacial dos vírus dengue, chikungunya e zika no municipio de Feira de Santana, Brasil. 2018. Dissertação (Mestrado em SAÚDE COLETIVA) - Universidade Estadual de Feira de Santana.

Aluno: Pedro de Alcântara Brito Junior

DA SILVA, A.V.; WENCESLAU, A. A.; MUNHOZ, A. D.. Ocorrência de Toxoplasma gondii em marsupiais e roedores silvestres na região sul da Bahia. 2017. Dissertação (Mestrado em Ciência Animal) - Universidade Estadual de Santa Cruz.

Aluno: Maria Aparecida Mateus Vieira Gomes de Oliveira

DA SILVA, A.V.; WENCESLAU, A. A.;ALBUQUERQUE, G. R.. Avaliação da presença de oocistos de Cryptosporidium spp e cistos de Giardia spp em amostras de água bruta e tratada, destinada ao abastecimento público no município de Canavieiras, Bahia. 2017. Dissertação (Mestrado em Ciência Animal) - Universidade Estadual de Santa Cruz.

Aluno: Thaise do Nascimento Santos

CARVALHO, C. E. V.; JESUS, T. B.; GARCIA, K. S.;DA SILVA, A.V.. Concentração de elementos traço no pescado comercializado em feiras livres de Feira de Santana - BA, oriundos da Baía de Todos os Santos. 2017. Dissertação (Mestrado em Modelagem em Ciências da Terra e do Ambiente) - Universidade Estadual de Feira de Santana.

Aluno: Lorena Rodrigues Ferreira

RAGNI, M.; FREITAS, D. S.;DA SILVA, A.V.. Viagem à Lua. 2017. Dissertação (Mestrado em Mestrado Profissional em Astronomia) - Universidade Estadual de Feira de Santana.

Aluno: Samir Batista Hage

MUNHOZ, A. D.;ALBUQUERQUE, G. R.DA SILVA, A.V.. Frequência e fatores associados à toxoplasmose e neosporose em gatos (Felis catus) da microrregião Ilhéus-Itabuna, BA. 2015. Dissertação (Mestrado em Ciência Animal) - Universidade Estadual de Santa Cruz.

Aluno: Luciana Carvalho Lacerda

MUNHOZ, A. D.; CARLOS, R. S. A.;DA SILVA, A.V.. Prevalência e fatores associados para toxoplasmose, imunodeficiência felina e leucemia viral felina - Diagnóstico sorológico e molecular em felinos na Bahia. 2015. Dissertação (Mestrado em Ciência Animal) - Universidade Estadual de Santa Cruz.

Aluno: Adriana Lebram von Sohsten

Da SILVA, A. V.; MARTINS, L. A.; FERNANDES, L. M. B.; MELO, S. M. B.. Pesquisa de Toxocara em frangos (Gallus gallus domesticus) criados extensivamente. 2015. Dissertação (Mestrado em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia.

Aluno: ROGÉRIO FERNANDO DE JESUS

GONDIM, L. F. P.Da SILVA, A. V.; PINHEIRO, A. M.; BAHIENSE, T. C.. Infecção natural por Toxoplasma gondii em quirópteros. 2015. Dissertação (Mestrado em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia.

Aluno: ROSANA MARIA REHEM DA SILVA FIALHO

DA SILVA, A.V.; FERREIRA FILHO, R. P.; OLIVEIRA, S. S.. Resposta ao tratamento da hepatite C crônica com inibidores de protease 1a geração em dois serviços de saúde do Estado da Bahia. 2015. Dissertação (Mestrado em Mestrado Profissional em Saúde Coletiva) - Universidade Estadual de Feira de Santana.

Aluno: Sofia Aline Amaral Santos

Da SILVA, A. V.ALBUQUERQUE, G. R.; OLIVEIRA, S. S.. Pesquisa de protozoários Apicomplexa em ostras Crassostrea rhizophorae, Guilding, 1828 (Bilvalvia: Ostreidae) da Baia de Todos os Santos, Bahia. 2014. Dissertação (Mestrado em Zoologia) - Universidade Estadual de Feira de Santana.

Aluno: Patrícia Hercília Arcanjo de Almeida

Da SILVA, A. V.ALBUQUERQUE, G. R.. Avaliação da presença de Achatina fulica Bowdich, 1822 (Gastropoda: Pulmonata) em Feira de Santana, Bahia, e estudo de parasitos associados. 2014. Dissertação (Mestrado em Zoologia) - Universidade Estadual de Feira de Santana.

Aluno: CYNTHIA MARIA MORAIS DE QUEIROZ GALVAO

GONDIM, L. F. P.; PINHEIRO, A. M.;DA SILVA, A.V.. Frequência de anticorpos contra Neospora sp. em equinos e asininos criados no Estado da Bahia. 2013. Dissertação (Mestrado em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia.

Aluno: [Nome removido após solicitação do usuário]

COSTA, M. F. D.;Da SILVA, A. V.; ALMEIDA, M. A. O.. Avaliação da resposta imunomodulatória de células da microglia durante a infecção por Neospora caninum. 2013. Dissertação (Mestrado em Imunologia) - Universidade Federal da Bahia.

Aluno: Diego Generoso

LANGONI, H.DA SILVA, A.V.LUCHEIS, Simone Baldini. Avaliação da ocorrência de Toxoplasma gondii em quibes crus e em carnes suína e bovina comercializadas em Botucatu - SP. 2013. Dissertação (Mestrado em Medicina Veterinária) - Universidade Estadual Paulista Júlio de Mesquita Filho.

Aluno: Débora Santa Mônica Santos

VIEIRA, G. O.; BITTENCOURT, L. J.;DA SILVA, A.V.. Características das crianças menores de dois anos com alergia a proteína de leite de vaca. 2013. Dissertação (Mestrado em Mestrado Profissional em Saúde Coletiva) - Universidade Estadual de Feira de Santana.

Aluno: Suellen Laís Vicentino Vieira

SANT'ANA, D. M. G.DA SILVA, A.V.; ARAUJO, S. M.. Efeito de diferentes inóculos de Toxoplasma gondii sobre a parede intestinal e plexo mioentérico de Rattus norvegicus. 2013. Dissertação (Mestrado em Programa de Pós-Graduação em Biociências e Fisiopa) - Universidade Estadual de Maringá.

Aluno: LUANA ARAÚJO RIBEIRO

ALBUQUERQUE, G. R.DA SILVA, A.V.; WENCESLAU, A. A.. Identificação de DNA Toxoplasma gondii através do método de reação em cadeia de polimerase (PCR) em ostras (Crassostrea rhizophorae) do litoral sul da Bahia. 2013. Dissertação (Mestrado em Ciência Animal) - Universidade Estadual de Santa Cruz.

Aluno: LUANA ARAÚJO RIBEIRO

ALBUQUERQUE, G. R.Da SILVA, A. V.. Identificação de Toxoplasma gondii através do método de reação em cadeia pela polimerase (PCR) em ostras do Litoral Sul da Bahia. 2013. Dissertação (Mestrado em Ciência Animal) - Universidade Estadual de Santa Cruz.

Aluno: Thayana Teles D'Alencar Monteiro

SILVA, E. N.; COURI, M. S.;Da SILVA, A. V.. Calliphoridae, Fannidae e Muscidae (Diptera) associados à material orgânico animal em Feira de Santana, BA. 2012. Dissertação (Mestrado em Zoologia) - Universidade Estadual de Feira de Santana.

Aluno: Eliane Michalczuk Barzon

MARTINS, L.A.MERLINI, L. S.da Silva, Aristeu V.. Fatores de risco relacionados a mastite na região sudoeste do Paraná. 2011. Dissertação (Mestrado em Mestrado em Ciência Animal) - Universidade Paranaense.

Aluno: Priscila Luiza Mello

MARTINS, L.A.GONCALVES, D. D.da Silva, Aristeu V.. Prevalência da mastite e associação dos agentes etiológicos com a contagem de células somáticas de vacas leiteiras da região sudoeste do Paraná. 2011. Dissertação (Mestrado em Mestrado em Ciência Animal) - Universidade Paranaense.

Aluno: Jorge Luiz Pereira de Oliveira

MARTINS, L.A.; ALBERTON, L. R.;da Silva, Aristeu V.. Fatores de risco para a mastite e qualidade do leite no município de Altônia-PR. 2011. Dissertação (Mestrado em Mestrado em Ciência Animal) - Universidade Paranaense.

Aluno: Luciana Afondo Guimarães

ALBUQUERQUE, G. R.; MUNHOZ, A. D.;Da SILVA, A. V.. Ocorrência de anticorpos anti-Toxoplasma gondii e fatores de risco associados à infecção ovina na mesoregião sul baiano da Bahia. 2011. Dissertação (Mestrado em Ciência Animal) - Universidade Estadual de Santa Cruz.

Aluno: Jacqueline Batista de Araújo

Da SILVA, A. V.GIUFFRIDA, R.MARTINS, L.A.. Sorologia, isolamento e genotipagem de Toxoplasma gondii de roedores sinantrópicos comensais e avaliação experimental da detecção de anticorpos contra o parasito em amostras de tecidos. 2010. Dissertação (Mestrado em Mestrado em Ciência Animal) - Universidade Paranaense.

Aluno: Franciele Rossandra Piassa

Da SILVA, A. V.GIUFFRIDA, R.MERLINI, L. S.. Prevalência e fatores de risco para a infecção pelo Toxoplasma gondii em granjas de reprodutores suídeos certificados ou não da região de Toledo, PR, Brasil. 2010. Dissertação (Mestrado em Mestrado em Ciência Animal) - Universidade Paranaense.

Aluno: Duarte Alves de Araújo

Da SILVA, A. V.da SILVA, R. C.MARTINS, L.A.. O cão domiciliado como sentinela para a toxoplasmose humana. 2010. Dissertação (Mestrado em Mestrado em Ciência Animal) - Universidade Paranaense.

Aluno: Adriano Augusto Martins

Da SILVA, A. V.; ELIAS, A. O.; ALBERTON, L. R.. Freqüência e fatores de risco da neosporose em propriedades de produção leiteira de Umuarama, PR. 2009. Dissertação (Mestrado em Mestrado em Ciência Animal) - Universidade Paranaense.

Aluno: Andreia Bittar Saab

MARTINS, L.A.Da SILVA, A. V.; WOSIACKI, S. R.. Prevalência e etiologia da mastite bovina em Novas Tebas - PR. 2009. Dissertação (Mestrado em Mestrado em Ciência Animal) - Universidade Paranaense.

Aluno: Joil Moreira Marques

Da SILVA, A. V.SANTAREM, V. A.FREIRE, Roberta Lemos. Estudo da toxoplasmose em uma comunidade rural de Eldorado, MS. 2008. Dissertação (Mestrado em Mestrado em Ciência Animal) - Universidade Paranaense.

Aluno: Susiana Galli

Da SILVA, A. V.SANTAREM, V. A.FREIRE, Roberta Lemos. Toxoplasmose natural e experimental em galinhas. 2008. Dissertação (Mestrado em Mestrado em Ciência Animal) - Universidade Paranaense.

Aluno: Cleiton Paulo Aigner

Da SILVA, A. V.LANGONI, H.MARTINS, L.A.. Análise molecular de Toxoplasma gondii em tecidos de Gallus gallus utilizando a PCR em tempo real. 2008. Dissertação (Mestrado em Mestrado Em Biotecnologia Aplicada a Agricultura) - Universidade Paranaense.

Aluno: Renata Molina Monteiro

Soares, R.M.GENNARI, S.M.Da SILVA, A. V.. Caracterização dos protozoários pertencentes à sub-família Toxoplasmatinae pela análise molecular do gene codificador de proteína do choque térmico (HSP70) e do espaçador interno transcrito (ITS-1). 2006. Dissertação (Mestrado em Epidemiologia Experimental Aplicada Às Zoonoses) - Universidade de São Paulo.

Aluno: Gustavo Rodamilans de Macedo

PORTELA, R. W. D.; SALCEDO, J. H. P.; ONOFRIO, V. C.; DIAS, L. A. V.;DA SILVA, ARISTEU VIEIRA. Infecção por Hepatozoon sp. em Boa constrictor, Linnaeus 1758: Bioquímica clínica, hematologia, diagnóstico molecular e estudos filogenéticos. 2021. Tese (Doutorado em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia.

Aluno: Fabrício Thomaz de Oliveira Ker

BARBOSA, D. S.;DA SILVA, A.V.; OLIVEIRA, C. S. F.; FERRAZ, M. L.; PESSOA, G. C. D.; CARNEIRO, M.. Padrões espaciais, dispersão e fatores associados à febre amarela silvestre no Sudeste do Brasil entre 2016 e 2019. 2021. Tese (Doutorado em Parasitologia) - Universidade Federal de Minas Gerais.

Aluno: Hllytchaikra Ferraz Fehlberg

ALBUQUERQUE, G. R.; MUNHOZ, A. D.;Da SILVA, A. V.; ROCHA, D. S.; MIRANDA, F. R.. Ocorrência de protozoários em pequenos mamíferos silvestres na região Sul da Bahia. 2020. Tese (Doutorado em Ciência Animal) - Universidade Estadual de Santa Cruz.

Aluno: Adriana Lebram von Sohsten

DA SILVA, A.V.; LIMA, A. G. D.; SANTOS, S. M. B.; FRANKE, C. R.; FERNANDES, L. M. B.. Infecção humana, aviária e a contaminação do solo pelo Toxocara spp. 2019. Tese (Doutorado em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia.

Aluno: Danielle Antonelli Motta Sgrignoli

GIUFFRIDA, R.; ANDRADE, S. M. C. F.; LAPOZI, C. B.;Da SILVA, A. V.; SANCHES, O. C.. Perfil de sensibilidade microbiana de Staphylococcus pseudintermedius isolado de cães com ceratoconjuntivite seca. 2019. Tese (Doutorado em Ciência Animal) - Universidade do Oeste Paulista.

Aluno: Luciana Afonso Guimarães

ALBUQUERQUE, G. R.; ROCHA, D. S.; CARLOS, R. S. A.; BEZERRA, R. A.;DA SILVA, A.V.. Protozoários da família Sarcocystidae em caprinos e codornas no Estado da Bahia. 2018. Tese (Doutorado em Ciência Animal) - Universidade Estadual de Santa Cruz.

Aluno: Janis Cumming Hohlenwerger

FRANKE, C. R.; CARNEIRO, A. J. B.; CARNEIRO, I. O.; GONDIM, L. S. Q.;DA SILVA, A.V.. Pombos em área urbana: percepção, distribuição espacial e associação com outras espécies sinantrópicas em Salvador, Bahia. 2018. Tese (Doutorado em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia.

Aluno: Franciane Oliveira Santos

BATATINHA, M. J. M.;DA SILVA, A.V.; SILVA, V. D. A.; BRANCO, A.; CAMPANHARO, T.. Avaliação fármaco-toxicológica de extratos e frações isoladas de Digitaria insularis (l.) Fedde (Poaceae) sobre parasitos de caprinos e bovinos. 2017. Tese (Doutorado em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia.

Aluno: Daniele de Santana Rocha

LOPES, C. W. G.;DA SILVA, A.V.MACIEL, B. M.; MUNHOZ, A. D.;ALBUQUERQUE, G. R.. Levantamento sorológico, isolamento e caracterização genética de Toxoplasma gondii (Nicolle e Manceaux, 1909) em galinhas de vida livre (Gallus domesticus) abatidas na Bahia. 2017. Tese (Doutorado em Ciência Animal) - Universidade Estadual de Santa Cruz.

Aluno: Ricardo Lustosa Brito

DA SILVA, A.V.; LIMA, A. G. D.; ROMAO, C. O.; FERNANDES, L. M. B.; FRANKE, C. R.. Cryptococcus spp. e ectoparasitos associados a pombos (Columba livia) em hospitais, escolas, praças, igrejas e prédios antigos na cidade de Salvador, Bahia. 2017. Tese (Doutorado em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia.

Aluno: Pedro Cerqueira Lima

FRANKE, C. R.;DA SILVA, A.V.; FERNANDES, L. M. B.; ROMAO, C. O.; CARNEIRO, A. J. B.. Impactos ambientais e indicadores de risco de introdução de patógenos veiculados por aves migratórias no Brasil. 2017. Tese (Doutorado em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia.

Aluno: Marta Mariana Nascimento Silva

COSTA NETO, J. M.; OLIVEIRA, S. S.; LIMA, A. G. D.; BAVIA, M. E.;DA SILVA, A.V.. O enfoque de risco na distribuição geográfica de leishmaniose visceral no município de Feira de Santana, Brasil. 2016. Tese (Doutorado em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia.

Aluno: Marcelo Biondaro Góis

SANT'ANA, D. M. G.DA SILVA, A.V.ARAÚJO, E. J. A.; NATALI, M. R. M.; MELLO, S. T.. Toxoplasma gondii causa alterações na túnica mucosa e no plexo submucoso do jejuno e do cólon proximal de ratos. 2015. Tese (Doutorado em Biologia Comparada) - Universidade Estadual de Maringá.

Aluno: Jairo Torres Magalhães Junior

MELO, S. M. B.;DA SILVA, A.V.; ALEGRE, A. M.; FRAGA, D. B. M.; LIMA, A. G. D.. Avaliação do comportamento atrativo de Lutzomyia longipalpis a compostos orgânicos voláteis e de sua infectividade em cães naturalmente infectados com Leishmania infantum. 2015. Tese (Doutorado em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia.

Aluno: Leane Souza Queiroz Gondím

GONDIM, L. F. P.Da SILVA, A. V.Soares, R.M.; MUNHOZ, A. D.; NISHI, S. M.. Sarcocistídeos: detecção e frequência sorológica em gambás (Didelphis spp.). 2013. Tese (Doutorado em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia.

Aluno: Ana Carolina de Aguiar Vasconcelos Carneiro

VITOR, R.W.A.;Da SILVA, A. V.; MINEO, J.R.; BRAGA, E.M.; MELO, M. N.. Caracterização molecular de isolados de Toxoplasma gondii obtidos de crianças com toxoplasmose congênita no Estado de Minas Gerais. 2011. Tese (Doutorado em Parasitologia) - Universidade Federal de Minas Gerais.

Aluno: Luciane Holsback Silveira

Soares, R.M.GENNARI, S.M.; RICHTZENHAIN, L. J.;Da SILVA, A. V.; NISHI, S. M.. Caracterização biológica e genotípica de isolados de Toxoplasma gondii obtidos de galinhas de criação livre do Patanal do Mato Grosso do Sul. 2009. Tese (Doutorado em Epidemiologia Experimental Aplicada às Zoonoses) - Universidade de São Paulo.

Aluno: Vanessa Yuri de Lima

SOUZA, L.C.LANGONI, H.DOMINGUES, Paulo FranciscoDa SILVA, A. V.; BIONDO, A.W.. Inquérito soroepidemiológico de acadêmicos e Medicina Veterinária de duas universidades do Oeste do Paraná para a Ocorrência de Toxoplasmose e Leptospirose. 2008. Tese (Doutorado em Medicina Veterinária) - Universidade Estadual Paulista Júlio de Mesquita Filho.

Aluno: Acácia Orieth Elias

LANGONI, H.PINTO, J. P. A. N.; GUIMARAES, E. O. C. F.;Da SILVA, A. V.BRANDAO, P. E.. Detecção molecular de Streptococcus agalactiae em amostras de leite bovino obtidas de tanques de expansão. 2007. Tese (Doutorado em Programa de Pós-Graduação em Medicina Veterinária) - Universidade Estadual Paulista Júlio de Mesquita Filho.

Aluno: Anee Valéria Mendonça Stachissini

GENNARI, S.M.Da SILVA, A. V.DOMINGUES, Paulo FranciscoPADOVANI, C. R.; MODOLO, J. R.. Influência da infecção pelo vírus da artrite-encefalite caprina nos perfis soroepidemiológicos em caprinos infectados pelo Toxoplasma gondii e Neospora caninum. 2005. Tese (Doutorado em Medicina Veterinária) - Universidade Estadual Paulista Júlio de Mesquita Filho.

Aluno: RUDSON ALMEIDA DE OLIVEIRA

OLIVEIRA, Silvio Luis de;FREIRE, Roberta LemosMARTINS, L.A.Da SILVA, A. V.; SOARES, A. M. V. C. S.. Modulação da atividade macrofágica, induzida pela suspensão do beta-1,3 poliglicose, extraída do Saccharomyces cerevisae, em camundongos BALB/c, infectados por Toxoplasma gondii. 2004. Tese (Doutorado em Doenças Tropicais) - Universidade Estadual Paulista Júlio de Mesquita Filho.

Aluno: Janis Cumming Hohlenwerger

Da SILVA, A. V.; CARNEIRO, A. J. B.; BRITO, R. L.. Zoonoses associadas a presença de pombos em áreas urbanas. 2018. Exame de qualificação (Doutorando em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia.

Aluno: Ricardo Lustosa Brito

DA SILVA, A.V.; LIMA, A. G. D.; FERNANDES, L. M. B.. Avaliação do risco de ocorrência de Cryptococcus spp e de Pseudolynchia canariensis (Mosca-de Pombo) associado a presença de pombos Columba livia em hoispitais, escolas, praças, igrejas e prédiso antigos na cidade de Salvador, Bahia. 2017. Exame de qualificação (Doutorando em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia.

Aluno: Pedro Cerqueira Lima

DA SILVA, A.V.; ALBINATI, R. C. B.; FERNANDES, L. M. B.. Impactos ambientais e indicadores de risco de patógenos veiculados por aves migratótias no Brasil. 2017. Exame de qualificação (Doutorando em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia.

Aluno: Marta Mariana Nascimento Silva

DA SILVA, A.V.; BAVIA, M. E.; MELO, S. M. B.. Geotecnologias e as doenças infecto-parasitárias. 2016. Exame de qualificação (Doutorando em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia.

Aluno: Norlan Jesus dos Santos

MELO, S. M. B.; CARNEIRO, A. J. B.;DA SILVA, A.V.. Ecologia de morcegos no ambiente urbano. 2016. Exame de qualificação (Doutorando em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia.

Aluno: LUIZ SÉRGIO MERLINI

MENDEZ, L. D. V.; RIBEIRO, Ricardo Pereira; CARDOZO, Rejane Machado; TAKEMOTO, Ricardo;Da SILVA, A. V.. Exame de Qualificação - Doutorado em Zootecnia. 2004. Exame de qualificação (Doutorando em Zootecnia) - Universidade Estadual de Maringá.

Aluno: Yslla Fernanda Fitz Balo Merigueti

SANTAREM, V. A.DA SILVA, ARISTEU VIEIRA; PACAGNELLI, F. L.. Contato com cão ou gato como fator de risco para toxocaríase em adultos e crianças: revisão sistemática e metanálise (2009-2019). 2021. Exame de qualificação (Mestrando em Ciência Animal) - Universidade do Oeste Paulista.

Aluno: Eliane Oliveira da Silva

SANTOS, R. L.;DA SILVA, A.V.; SOLCA, M. S.. ANÁLISE EPIDEMIOLÓGICA E USO DE GEOTECNOLOGIAS COMO FERRAMENTA DE MODELAGEM DE PROPAGAÇÃO DA COVID-19. 2021. Exame de qualificação (Mestrando em Modelagem em Ciências da Terra e do Ambiente) - Universidade Estadual de Feira de Santana.

Aluno: CRISLEIDE MACEDO ALVES SANTOS

PINHEIRO, A. M.;Da SILVA, A. V.. Avaliação da patogenicidade das assemblagens AII e BIV de Giardia duodenalis às células e tecidos que constituem a parede do duodeno e do jejuno de camundongos Swiss. 2020. Exame de qualificação (Mestrando em Imunologia) - Universidade Federal da Bahia.

Aluno: Marcio de Almeida Couto Andrade

Da SILVA, A. V.; SOLCA, M. S.; ALMEIDA, N. R.. Utilização do sistema de informação geográfica no planejamento da campanha de vacinação antirrábica animal. 2018. Exame de qualificação (Mestrando em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia.

Aluno: Yslla Fernanda Fitz Balo Merigueti

Da SILVA, A. V.SANTAREM, V. A.. Frequência e fatores associados à contaminação de pelo de cães por ovos de Toxocara spp na região de Presidente Prudente, São Paulo. 2017. Exame de qualificação (Mestrando em Ciência Animal) - Universidade do Oeste Paulista.

Aluno: Thaise do Nascimento Santos

DA SILVA, A.V.; CARVALHO, C. E. V.; JESUS, T. B.; GARCIA, K. S.. Concentração de metais traços no pescado comercializado nas feiras livres de Feira de Santana, BA advindos da Baía de Todos os Santos. 2016. Exame de qualificação (Mestrando em Modelagem em Ciências da Terra e do Ambiente) - Universidade Estadual de Feira de Santana.

Aluno: Rodrigo Souza Conceição

BOTURA, M. B.;DA SILVA, A.V.; ALVES, C. Q.. Avaliação in vitro da atividade carrapaticida de extratos e frações de Ocotea aciphylla. 2015. Exame de qualificação (Mestrando em Ciências Farmacêuticas) - Universidade Estadual de Feira de Santana.

Aluno: Soraia de Souza Santa Rosa

DA SILVA, A.V.; SOUZA, B. M. P. S.; BRANCO, A.. Avaliação in vitro do efeito anti-helmintico e citotoxico e frações de Persea willdenovii. 2015. Exame de qualificação (Mestrando em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia.

Aluno: Letícia Cardoso Braz

CERQUEIRA, E. M.;da Silva, Aristeu V.. Estudo de prevalência de base populacional da infecção pelo vírus da hepatite B em um município baiano. 2014. Exame de qualificação (Mestrando em Mestrado Profissional em Enfermagem) - Universidade Estadual de Feira de Santana.

Aluno: Débora Santa Mônica Santos

VIEIRA, G. O.; SILVA, L. R.;da Silva, Aristeu V.. Fatores associados às manifestações clínicas daalergia aproteína do leite de vacaem crianças menores de dois anos de idade: Estudo de coorte. 2012. Exame de qualificação (Mestrando em Mestrado Profissional em Saúde Coletiva) - Universidade Estadual de Feira de Santana.

Aluno: Iêda Maria Barbosa Aleluia

da Silva, Aristeu V.; SANTOS, C. A. S. T.; NASCIMENTO SOBRINHO, C. L.. Estudo da relação entre IMC e hiperensão arterial em São Francisco do Conde, Bahia. 2012. Exame de qualificação (Mestrando em Mestrado Profissional em Saúde Coletiva) - Universidade Estadual de Feira de Santana.

Aluno: Nayade Raihanne dos Santos Lima

SANTOS, P. N. P.;DA SILVA, A.V.; OLIVEIRA, S. S.. Perfil epidemiológico dos portadores de enteroparasitos das microáreas do bairro Mangabeira, Feira de Santana - BA. 2016. Monografia (Aperfeiçoamento/Especialização em specialização em Biologia Celular) - Universidade Estadual de Feira de Santana.

Aluno: Caio Vinicius Barreto de Souza

DA SILVA, A.V.; GONDIM, L. S. Q.; DIAS, R.C.. Identificação das fontes de alimentação de morcego hematófago (Desmodus rotundus)na áreas urbana de Salvador, Bahia. 2019. Trabalho de Conclusão de Curso (Graduação em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia.

Aluno: Patrícia Hercília Aracanjo de Almeida

Da SILVA, A. V.; OLIVEIRA, S. S.; CARVALHO, M. V. F.. Prevalência de protozoários e helmintos entéricos em residentes de São Cristóvão, Feira de Santana, Bahia. 2012. Trabalho de Conclusão de Curso (Graduação em Ciências Biológicas) - Universidade Estadual de Feira de Santana.

Aluno: Marcos Argolo Campos Martins

Da SILVA, A. V.; CORREIA, J. E.; CARVALHO, M. V. F.. Ocorrência de ovos de Toxocara sp em amostras de solo de praças e parques públicos de Feira de Santana - Bahia. 2012. Trabalho de Conclusão de Curso (Graduação em Ciências Biológicas) - Universidade Estadual de Feira de Santana.

Aluno: Thais Brito de Oliveira

SANTOS, S. M. B.; SANTOS, P. N. P.;Da SILVA, A. V.. Determinação da frequência de parasitos intestinais em escolares da Creche e do Centro de Educação. 2010. Trabalho de Conclusão de Curso (Graduação em Ciências Biológicas) - Universidade Estadual de Feira de Santana.

Aluno: Thayz Mizuki Lucas

Da SILVA, A. V.MARTINS, L.A.; MENDES, T. C.. Estágio Supervisionado Obrigatório em Clínica de Doenças Infecciosas e Diagnóstico Microbiológico. 2009. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Thiago de Oliveira Zamprogna

Da SILVA, A. V.MARTINS, L.A.; MENDES, T. C.. Estágio Supervisionado Obrigatório em Clínica de Doenças Infecciosas e Diagnóstico Laboratorial das Zoonoses. 2009. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Isabela Maria Polido Guerra

Da SILVA, A. V.; DREER, M. K. P.; ALVES, G.. Estágio Supervisionado Obrigatório em Inspeção no Abate de Bovinos. 2009. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Leticia Sarturi Pereira

SANT'ANA, D. M. G.Da SILVA, A. V.ARAÚJO, E. J. A.. Hipertrofia de neurônios mientéricos NADH-diaforase positivos no jejuno de ratos durante a infecção aguda causada por Toxoplasma gondii. 2009. Trabalho de Conclusão de Curso (Graduação em Farmácia) - Universidade Paranaense.

Aluno: Ana Caroline Rocha Barbosa / Leonardo Bidoia dos Santos

GAZIM, Z. C.;PIAU JÚNIOR, R.Da SILVA, A. V.. Estudo da eficácia do bioterápico de carrapato no controle da infestação por Rhipicephalus (Boophilus) microplus em vacas leiteiras da raça holandesa. 2009. Trabalho de Conclusão de Curso (Graduação em Farmácia) - Universidade Paranaense.

Aluno: Tamara Caroline Gasque

Da SILVA, A. V.MARTINS, L.A.; ALVES, G.. Estágio Supervisionado Obrigatório em Controle de Qualidade no Abate de Aves. 2009. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Hellen Neves Lissaraça Espindola Storari Dias

MERLINI, L. S.PIAU JÚNIOR, R.Da SILVA, A. V.. Relatório de Estágio Curricular Supervisionado em Suinocultura. 2008. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Elaine Terassani / Haroldo José dos Anjos

GAZIM, Z. C.; JACOMASSI, E.;Da SILVA, A. V.. Estudo in vitro da ação carrapaticida da Azadirachta indica sobre teleóginas ingurgitadas da espécies Rhipicephalus (Boophilus) microplus em gado leiteiro proveniente da região de Umuarama - PR. 2008. Trabalho de Conclusão de Curso (Graduação em Farmácia e Bioquímica) - Universidade Paranaense.

Aluno: Luana Carolina Delgado

MANZANO, M. A.ARAÚJO, J. B.Da SILVA, A. V.. Revisão sobre os métodos de estudo de mamíferos a campo. 2008. Trabalho de Conclusão de Curso (Graduação em Ciências Biológicas) - Universidade Paranaense.

Aluno: Barbara Jacqueline Peres Barbosa

Da SILVA, A. V.; BALDISSERA, V. D. A.;ARAÚJO, E. J. A.. Atrofia neuronal mientérica no íleo de ratos infectados cronicamente por uma cepa genótipo I de Toxoplasma gondii. 2008. Trabalho de Conclusão de Curso (Graduação em Enfermagem) - Universidade Paranaense.

Aluno: Janaina Soares

Da SILVA, A. V.; PEREIRA, F.;ARAÚJO, E. J. A.. Infecção crônica por Toxoplasma gondii (cepa genótipo I) induz hipertrofia de neurônios do plexo mientérico do cólon descendente de ratos. 2008. Trabalho de Conclusão de Curso (Graduação em Enfermagem) - Universidade Paranaense.

Aluno: Rodrigo Martin Papazian Cabañas

Da SILVA, A. V.; BALDISSERA, V. D. A.;ARAÚJO, E. J. A.. Plasticidade neuronal mientérica induzida pelo Toxoplasma gondii (genótipo III) no duodeno de ratos. 2008. Trabalho de Conclusão de Curso (Graduação em Enfermagem) - Universidade Paranaense.

Aluno: Celina Sayuri Shiraishi

Da SILVA, A. V.; BALDISSERA, V. D. A.;ARAÚJO, E. J. A.. Análise morfométrica da parede intestinal, distribuição de fibras colágenas e dinâmica de mucinas secretadas no íleo de frangos infectados por Toxoplasma gondii. 2008. Trabalho de Conclusão de Curso (Graduação em Enfermagem) - Universidade Paranaense.

Aluno: Fernando César Belinato

Da SILVA, A. V.MERLINI, L. S.; PAIXÃO, A.R.L.. Relatório de Estágio Curricular Supervisionado em Avicultura de Corte / Toxoplasmose Experimental em Galinhas. 2007. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Ana Lúcia Sartori

ARAÚJO, E. J. A.SANT'ANA, D. M. G.Da SILVA, A. V.. Análise morfométrica e quantitativa dos neurônios do plexo mientérico do jejuno de ratos infecados com Toxoplasma gondii. 2007. Trabalho de Conclusão de Curso (Graduação em Enfermagem) - Universidade Paranaense.

Aluno: HERIC BOARETO

Da SILVA, A. V.MERLINI, L. S.PINTO NETO, A.. Relatório de Estágio Curricular Supervisionado em Clínica Médica, Cirúrgica e Reprodução de Bovinos / Ocorrência de Anticorpos Anti-Toxoplasma gondii em Suínos de Umuarama e Francisco Beltrão, PR, Brasil. 2007. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Kelli Cristina Martini

Da SILVA, A. V.MOTA, M. F.PINTO NETO, A.. Relatório de Estágio Curricular Supervisionado em Bovinocultura Leiteira / Correlação entre o California Mastitis Test e a contagem de células somáticas em leite de vacas criadas sobre diferentes sistemas de produção. 2007. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: João Marco Pansera Bottin

Da SILVA, A. V.MERLINI, L. S.; SANCHES, A.W.D.. Relatório de Estágio Curricular Supervisionado em Suinocultura / Toxoplasmose Experimental Murina. 2007. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Edson Assis Bastos Júnior

Da SILVA, A. V.; ALBERTON, L. R.;PIAU JÚNIOR, R.. Relatório de Estágio Curricular Supervisionado em Clínica Médica de Grandes Animais / Detecção de Resistência Parasitária em Três Criações de Ovinos do Estado do Paraná. 2007. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Francislaine Aparecida dos Reis Lívero

Da SILVA, A. V.; CUNHA, C.G.;GONÇALVES, G.F.. Relatório de Estágio Curricular Supervisionado em Clínica Médica e Diagnóstico por Imagem de Animais de Companhia / Pesquisa de Hematozoários em Cães e Gatos de uma Comunidade Rural do Sul do Mato-Grosso do Sul. 2007. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Fabiane Beatriz Isbrescht

Da SILVA, A. V.; CUNHA, C.G.;GONÇALVES, G.F.. Relatório de Estágio Curricular Supervisionado em Clínica Médica e Cirúrgica de Pequenos Animais / Toxoplasmose em uma comunidade rural: Prevalência de anticorpos em cães e gatos. 2007. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Fernanda Herrera Dias

LOURENÇO, E.L.B.; JAQUES, A.E.;Da SILVA, A. V.. Acidente por serpentes do gênero Bothrops na região sul do Brasil. 2006. Trabalho de Conclusão de Curso (Graduação em Farmácia e Bioquímica) - Universidade Paranaense.

Aluno: Aline Didoni Fajardo e Julina Tadeu Thome

PAULA, M. M. M.; MASSAMBANI, E. M.;Da SILVA, A. V.. Correlação entre parasitoses intestinais, anemia e eosinofilia em pacientes atendidos no Laboratório de Análises Clínicas da UNIPAR. 2006. Trabalho de Conclusão de Curso (Graduação em Farmácia e Bioquímica) - Universidade Paranaense.

Aluno: Keila de Paula Neiverth

Da SILVA, A. V.MARTINS, L.A.MERLINI, L. S.. Relatório de Estágio Curricular Supervisionado em Avicultura de Corte. 2006. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Dayana Gabarim e Dayane Branco da Silva

PAULA, M. M. M.; Paulo, P.;Da SILVA, A. V.. Aspectos Clínicos e Parasitológicos da Doença de Chagas. 2006. Trabalho de Conclusão de Curso (Graduação em Farmácia e Bioquímica) - Universidade Paranaense.

Aluno: Kelly Bufão Cereli

Da SILVA, A. V.MARTINS, L.A.; RIBEIRO, E.A.. Relatório de Estágio Curricular Supervisionado em Clínica Médica e Cirúrgica de Grandes Animais. 2005. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Fernando Latronico

Da SILVA, A. V.; SILVA, L. C. M.; RIBEIRO, E.A.. Relatório de Estágio Curricular Supervisionado em Clínica Médica e Cirúrgica de Grandes Animais. 2005. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Jefferson Douglas Gazzi

PAIXÃO, A.R.L.;Da SILVA, A. V.MERLINI, L. S.. Relatório de Estágio Curricular Supervisionado na área de Avicultura de Corte. 2005. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Jaime de Almeida

Da SILVA, A. V.; BARETTA, I. P.; CORREA, M.I.S.. Revisão de literatura: Atividade antidepressiva do Hipérico. 2005. Trabalho de Conclusão de Curso (Graduação em Farmácia) - Universidade Paranaense.

Aluno: Sheila do Carmo Henkes

Da SILVA, A. V.; PAULA, M. M. M.;CORRÊA, N.B.. Contaminação de praças públicas de Umuarama -PR, por larvas de ancilostomídeos. 2005. Trabalho de Conclusão de Curso (Graduação em Farmácia e Bioquímica) - Universidade Paranaense.

Aluno: Thaíse Sgobero

GASQUES, L. S.; GIMENES, M.;Da SILVA, A. V.. Levantamento do uso de medicamentos utilizados com a finalidade de redução de peso pelos acadêmicos do primeiro e quarto ano do curso de Farmácia Integral. 2005. Trabalho de Conclusão de Curso (Graduação em Farmácia e Bioquímica) - Universidade Paranaense.

Aluno: Fabiana Baldo

Da SILVA, A. V.; GASPAROTTO JÚNIOR, A.; DRAGUNSKY, D.. Influência do extrato aquoso da Ruta graveolens sobre a atividade reprodutiva In vitro de teleóginas de Boophilus microplus. 2005. Trabalho de Conclusão de Curso (Graduação em Farmácia) - Universidade Paranaense.

Aluno: Luiz Henrique Silva

Da SILVA, A. V.; PAULA, M. M. M.; MUELLER, E.V.. Pesquisa de parasitas potencialmente zoonóticos em fezes de cães coletadas em praças públicas da cidade de Umuarama, PR. 2005. Trabalho de Conclusão de Curso (Graduação em Farmácia e Bioquímica) - Universidade Paranaense.

Aluno: Antônio Luiz Ruzzon

Da SILVA, A. V.RIBEIRO, E.A.MOTA, M. F.. Relatório de Estágio Curricular Supervisionado em Manejo de Bovinos de Corte. 2005. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Jader Adamo Martins

Da SILVA, A. V.MARTINS, L.A.; CUNHA, C.G.. Relatório de Estágio Curricular Supervisionado em Clínica Médica e Cirúrgica de Grandes Animais. 2005. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Adriana Aparecida Belo Wrzecionek

VELAZQUES, L.G.;Da SILVA, A. V.; PAULA, M. M. M.. Toxoplasmose e AIDS: Aspectos clínicos, laboratoriais e tratamento. 2005. Trabalho de Conclusão de Curso (Graduação em Farmácia e Bioquímica) - Universidade Paranaense.

Aluno: Karine dos Anjos

PAULA, M. M. M.;Da SILVA, A. V.; MATUMOTO, F.. Levantamento parasitológico em pacientes atendidos no laboratório de análises clínicas da Universidade Paranaense - UNIPAR. 2005. Trabalho de Conclusão de Curso (Graduação em Farmácia e Bioquímica) - Universidade Paranaense.

Aluno: Aristides Daniel Ortiz

Da SILVA, A. V.DELAPORTE, Rosemeres Horwat; GAZIM, Z. C.. Eficácia in vitro do extratos hidro-alcoólico de Chenopodium ambrosioides sobre a postura e eclosão de Boophilus microplus. 2005. Trabalho de Conclusão de Curso (Graduação em Farmácia) - Universidade Paranaense.

Aluno: Jessica Storari Dias Froehner

Da SILVA, A. V.; GAZIM, Z. C.;FERREIRA, F. B. P.. Desenvolvimento de um bioterápico a partir de Ctenocephalides sp e teste preliminar no controle da infestação por pulgas em cães sem raça definida. 2005. Trabalho de Conclusão de Curso (Graduação em Farmácia) - Universidade Paranaense.

Aluno: Andréia Paulista de Almeida

Da SILVA, A. V.; ADAMOSKY, E.V.; MUELLER, E.V.. Revisão de literatura - Toxoplasmose congênita. 2005. Trabalho de Conclusão de Curso (Graduação em Farmácia) - Universidade Paranaense.

Aluno: Kellen Cristina Fernandes

Da SILVA, A. V.; PAULA, M. M. M.; LOURENÇO, E.L.B.. Pesquisa de enteroparasitas em amostras de rúcula e alface comercializadas em Umuarama - PR. 2005. Trabalho de Conclusão de Curso (Graduação em Farmácia e Bioquímica) - Universidade Paranaense.

Aluno: Rodrigo de Almeida

Da SILVA, A. V.MANZANO, M. A.; LOURENÇO, E.L.B.. Avaliação da contaminação de amostras de almeirão e couve por parasitas intestinais na cidade de Umuarama - PR. 2005. Trabalho de Conclusão de Curso (Graduação em Farmácia e Bioquímica) - Universidade Paranaense.

Aluno: Cassiano Carlos Fontana

GAZIM, Z. C.;Da SILVA, A. V.FERREIRA, F. B. P.. Efeito do tratamento de vacas Bos taurus com bioterápico de carrapato Boophilus microplus na postura de eclosão nos carrapatos. 2005. Trabalho de Conclusão de Curso (Graduação em Farmácia) - Universidade Paranaense.

Aluno: Alessandro de Paula

GAZIM, Z. C.;Da SILVA, A. V.TAKEMURA, O.S.. Desenvolvimento de um Bioterápico utilizando carrapatos da espécie Rhipicephalus sanguineus e experimentação em cães de raça definida. 2005. Trabalho de Conclusão de Curso (Graduação em Farmácia) - Universidade Paranaense.

Aluno: MARISTELA PASSINATO

PAULA, M. M. M.;Da SILVA, A. V.; VELAZQUES, L.G.. Ocorrência de enteroparasitoses em crianças entre 0 a 5 anos hospitalizadas. 2005. Trabalho de Conclusão de Curso (Graduação em Farmácia e Bioquímica) - Universidade Paranaense.

Aluno: Cristhiane Tunes

MANZANO, M. A.Da SILVA, A. V.. Células tronco: definições, aplicações gerais e na lesão medular. 2005. Trabalho de Conclusão de Curso (Graduação em Ciências Biológicas Com Ênfase Em Biotecnologia) - Universidade Paranaense.

Aluno: Franciele Rossandra Piassa

MERLINI, L. S.MARTINS, L.A.Da SILVA, A. V.. Relatório de Estágio Curricular Supervisionado em Suinocultura. 2004. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Alexandre Gressana Junior

MERLINI, L. S.Da SILVA, A. V.; SANCHES, A.W.D.. Relatório de Estágio Curricular Supervisionado em Suinocultura. 2004. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Luciana Terna Gomes

Da SILVA, A. V.; SANCHES, A.W.D.;MERLINI, L. S.. Relatório de Estágio Curricular Supervisionado em Piscicultura. 2004. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: João Marcel Mulineth

Da SILVA, A. V.MERLINI, L. S.; PAIXÃO, A.R.L.. Relatório de Estágio Curricular Supervisionado em Suinocultura. 2004. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Fátima Regina da Silva Alves

Da SILVA, A. V.MARTINS, L.A.; CUNHA, C.G.. Relatório de Estágio Curricular Supervisionado em Clínica Médica e Cirúrgica de Grandes Animais. 2004. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Eduardo de Carvalho Ataide

Da SILVA, A. V.; ALBERTON, L. R.;RIBEIRO, E.A.. Relatório de Estágio Curricular Supervisionado em Clínica Médica e Cirúrgica de Grandes Animais. 2004. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Deise Tatiane Bolim

Da SILVA, A. V.. Cryptosporidium sp: aspectos clínicos e epidemiológicos na Pediatria. 2004. Trabalho de Conclusão de Curso (Graduação em Farmácia e Bioquímica) - Universidade Paranaense.

Aluno: Cristiano Pereira Toledo

Da SILVA, A. V.. HPV em infecções de colo do útero e suas formas de tratamento, uma revisão. 2004. Trabalho de Conclusão de Curso (Graduação em Farmácia e Bioquímica) - Universidade Paranaense.

Aluno: Edson Dal Castel

Da SILVA, A. V.MOTA, M. F.; SANCHES, A.W.D.. Relatório de Estágio Curricular Supervisionado em Clínica Médica e Cirúrgica de Grandes Animais. 2004. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Anna Carolina de Freitas Mendes

Da SILVA, A. V.; GAZIM, Z. C.;MOTA, M. F.. Desenvolvimento de um bioterápico de carrapato e teste do mesmo em vacas leiteiras da raça Holandesa. 2004. Trabalho de Conclusão de Curso (Graduação em Farmácia e Bioquímica) - Universidade Paranaense.

Aluno: Hellen Beligni

Da SILVA, A. V.; GASPAROTTO JÚNIOR, A.; CORREA, M.I.S.. Drogas anorexígenas: tipos e abusos relatados no Brasil. 2004. Trabalho de Conclusão de Curso (Graduação em Farmácia e Bioquímica) - Universidade Paranaense.

Aluno: Camila Tochetto Wollmann

Da SILVA, A. V.; GIMENES, M.; FANHANI, H. R.. Automedicação e os acadêmicos da área da saúde da UNIPAR, em Umuarama. 2004. Trabalho de Conclusão de Curso (Graduação em Farmácia e Bioquímica) - Universidade Paranaense.

Aluno: Franklyn Storari Dias

Da SILVA, A. V.MERLINI, L. S.; SANCHES, A.W.D.. Relatório de Estágio Curricular Supervisionado em Suinocultura. 2003. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Paranaense.

Aluno: Rodrigo Costa da Silva

da SILVA, R. C.Da SILVA, A. V.. Utilização da reação em cadeia pela polimerase (PCR) no diagnóstico de toxoplasmose. 2001. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Fundação de Ensino Otávio Bastos.

DA SILVA, A.V.; VILELA, A. B. A.; CAMARA, L. C. J.. Banca de avaliação do processo de promoção na carreira docente de adjunto para titular da Profa Erenilde Marques de Cerqueira. 2017. Universidade Estadual de Feira de Santana.

Da SILVA, A. V.; BENEVIDES, C. M. J.; SANTANA, A. F.. Banca Examinadora do Processo de Promoção na Carreira do Magistério Superior da Classe de Adjunto para a Classe de Titular - Elinalva Maciel Paulo. 2015. Universidade Estadual de Feira de Santana.

RIBEIRO, R. R.; MOREIRA, M. A. S.;Da SILVA, A. V.. Banca Examinadora do Concurso para Docente da Disciplina de Medicina Veterinária Preventiva com Ênfase em Doenças Infecciosas dos Animais. 2010. Universidade Federal do Recôncavo da Bahia.

DA SILVA, ARISTEU VIEIRA; GIMENES, M.; PINHEIRO, A. L. B.; ALMEIDA, P. F.; SANTOS, J. N.. Processo de Promoção de Carreira da Classe Titular para Pleno - Juliana Monteiro Azevedo. 2021. Universidade Estadual de Feira de Santana.

MIEDEMA, M. S. P.;DA SILVA, A.V.; QUEIROZ, A. F. S.; LIMA, A. G. D.; COSTA, M. G. C.. Processo de Promoção de Carreira da Classe Titular para Pleno - Taise Bomfim de Jesus. 2021. Universidade Estadual de Feira de Santana.

OLIVEIRA, L. M.; CRUZ, J. D.;DA SILVA, A.V.. Banca Avaliadora do Processo Seletivo para Docente da Disciplina de Zootecnia. 2014. Universidade Estadual de Feira de Santana.

SANTOS, S. M. B.; OLIVEIRA, S. S.;Da SILVA, A. V.. Banca Examinadora da Seleção de Monitoria para a matéria "Programa de Estudos Parasitológicos da Microrregião de Feira de Santana". 2012. Universidade Estadual de Feira de Santana.

da Silva, Aristeu V.; PRADO, M. J.; NETTO, J. M. B.. Banca de Promoção na Carreira da Classe de Professor Auxiliar para Professor Adjunto do Professor José de Bessa Júnior. 2012. Universidade Estadual de Feira de Santana.

OLIVEIRA, S.V.; van den BERG, C.;Da SILVA, A. V.. Banca Examinadora da Seleção Pública para Professor Substituto da matéria Bioestatística. 2012. Universidade Estadual de Feira de Santana.

FALAVIGNE-GUILHERME, A. L.; MITSUKA-BREGANO, R.;Da SILVA, A. V.. Exame de qualificação de mestrado. 2011. Universidade Estadual de Maringá.

SANTOS, S. M. B.; CAMANDAROBA, E. P.;Da SILVA, A. V.. Banca Examinadora da Seleção de Monitoria para a disciplina "Identificação de Fatores de Risco para Desenvolvimento de Toxoplasmose Humana". 2010. Universidade Estadual de Feira de Santana.

AMORIM, C. R. N.; OLIVEIRA, R. P.;Da SILVA, A. V.. Comissão de Avaliação do Processo Seletivo de Professores para o Curso de Licenciatura em Ciências Biológicas do Programa Especial de Formação de Professores (3a Etapa). 2010. Universidade Estadual de Feira de Santana.

Da SILVA, A. V.GONÇALVES, G.F.PACHALY, J.R.ARAÚJO, E. J. A.. Banca Examinadora do Processo Seletivo para Ingresso de Acadêmicos no Programa de Mestrado em Ciência Animal. 2009. Universidade Paranaense.

Da SILVA, A. V.ARAÚJO, E. J. A.GONÇALVES, G.F.. Banca Examinadora do Processo Seletivo para Ingresso de Docente ? 2009. 2009. Universidade Paranaense.

Da SILVA, A. V.. Banca Examinadora do Processo Seletivo para Ingresso de Acadêmicos no Programa de Mestrado em Ciência Animal. 2008. Universidade Paranaense.

Da SILVA, A. V.; GIMENEZ, R. M. T.;SANT'ANA, D. M. G.. Banca Examinadora do Processo Seletivo para Ingresso de Docente ? 2007. 2007. Universidade Paranaense.

Da SILVA, A. V.. Banca Examinadora do Processo Seletivo para Ingresso de Acadêmicos no Programa de Mestrado em Ciência Animal. 2007. Universidade Paranaense.

Da SILVA, A. V.. Banca Examinadora do Processo Seletivo para Ingresso de Acadêmicos no Programa de Mestrado em Ciência Animal. 2006. Universidade Paranaense.

Comissão julgadora das bancas

Carlos Alberto de Magalhaes Lopes

SILVA, A. V.;LOPES, C. A. M.. Membro titularde Banca de Exame Geral de Qualificação. 1998. Exame de qualificação (Doutorando em Medicina Veterinária) - Universidade Estadual Paulista Júlio de Mesquita Filho.

Jussara Marcondes Machado

MARCONDES-MACHADO, J. Membro Titular da Banca Examinadora de Dissertação de Mestrado no Programa de Pós-Graduação em Medicina Veterinária, Area de Vigilôncia Sanitária da Faculdade de Medicina Veterinária e Zootecnia -UNESP em agosto . 1999. Dissertação (Mestrado em Medicina Veterinária) - Universidade Estadual Paulista Júlio de Mesquita Filho.

Jussara Marcondes Machado

LANGONI, HMARCONDES-MACHADO, JPERAÇOLI, M T S. Toxoplasmose experimental em ratos (Rattus norvegicus). Avaliação da resposta sorológica, da bioprova e comprovação de oligonucleotídeos na reação em cadeia pela polimerase. 2002. Exame de qualificação (Doutorando em Doenças Tropicais) - Universidade Estadual Paulista Júlio de Mesquita Filho.

Paulo Câmara Marques Pereira

PEREIRA, Paulo Câmara Marques; GENNARI, S M; RICHTZENHAIN, L J; NAVARRO, I T; PAES, A C; VASCONCELLOS, S A. TOXOPLASMOSE EXPERIMENTAL EM RATOS ( RATTUS NORVEGICUS). AVALIAÇÃO DA RESPOSTA SOROLÓGICA, DA BIOPROVA E COMPARAÇÃO DE OLIGONUCLEOTÍDEOS NA REAÇÃO EM CADEIA PELA POLIMERASE (PCR). 2003. Tese (Doutorado em Doenças Tropicais) - Universidade Estadual Paulista Júlio de Mesquita Filho.

Paulo Câmara Marques Pereira

PEREIRA, Paulo Câmara Marques. <>. 2002. Outra participação, Universidade Estadual Paulista Júlio de Mesquita Filho.

Jose Rafael Modolo

SILVA, Aristeu Vieira da;MODOLO, Jose Rafael; ETAL. ASPECTOS ETIOLÓGICOS, EPIDEMIOLÓGICOS E DE CONTROLE DA TOXOPLASMOSE. 1998. Outra participação, Fac Med Vet Zoot Unesp de Botucatu.

Eduardo Bagagli

SILVA, Aristeu Vieira daBAGAGLI, E.. Membro titular da comissão examinadora de qualificação de mestrado. 1998. Dissertação (Mestrado em Medicina Veterinária) - Universidade Estadual Paulista Júlio de Mesquita Filho.

Hélio Langoni

LANGONI, H.. Membro titular a Comissão Examinadora para o julgamento da defesa de Dissertação de Mestrado, do Programa de Pós Graduação em Medicina Veterinária, Área de Vigilância Sanitária da Faculdade de Medicina Veterinária e Zootecnia, UNESP, Botucatu, SP. 1999. Dissertação (Mestrado em Medicina Veterinária) - Universidade Estadual Paulista Júlio de Mesquita Filho.

Hélio Langoni

LANGONI, H.. Membro titular a Banca Examinadora do Exame Geral de Qualificação do aluno de Pós Graduação em Doenças Tropicais, Modalidade Biologia Tropical, nível de Doutorado, da Faculdade de Medicina, UNESP, Campus de Botucatu, SP. 2002. Exame de qualificação (Doutorando em Doenças Tropicais) - Universidade Estadual Paulista Júlio de Mesquita Filho.

Hélio Langoni

LANGONI, H.. Membro titular a Banca Examinadora do Exame Geral de Qualificação do aluno de Pós Graduação em Medicina Veterinária, Área de Vigilância Sanitária, nível de Mestrado, da FMVZ, UNESP, Campus de Botucatu, SP. 1998. Exame de qualificação (Doutorando em Medicina Veterinária) - Universidade Estadual Paulista Júlio de Mesquita Filho.

Leonardo José Richtzenhain

SILVA, A. V.;RICHTZENHAIN, L. J.; LANGONI, H.;GENNARI, Solange Maria; NAVARRO, I. T.;PAES, A. C.. Tese de Doutorado/ Aristeu Vieira da Silva - Avaliação da infecção de ratos Fischer com duas amostras geneticamente distintas de Toxoplasma gondii: cinética de anticorpos, reisolamento em camundongos e reação em cadeia pela polimerase.. 2003. Tese (Doutorado em Doenças Tropicais) - Universidade Estadual Paulista Júlio de Mesquita Filho.

Antonio Carlos Paes

PAES, A. C.. Toxoplasmose ovina: Avaliação de métodos diretos na detecção do seu agente em cordeiros sorologicamente positivos, abatidos para consumo humano.. 2002. Dissertação (Mestrado em Medicina Veterinária) - Universidade Estadual Paulista - Júlio de Mesquita Filho.

Antonio Carlos Paes

LANGONI, H.; GENARI, S. M.;RICHTZENHAIN, L. J.; NAVARRO, I. T.;PAES, A. C.. Avaliação da Infecção de Ratos Fischer com Duas Amostras Geneticamente Distintas de Toxoplasma gondii: Cinética de Anticorpos, Reisolmento em Camundongos e Reação em Cadeia pela Polimerase. 2003. Tese (Doutorado em Doenças Tropicais) - Universidade Estadual Paulista Júlio de Mesquita Filho.

Maria Terezinha Serrão Peraçoli

SILVA, A. V.;PERAÇOLI, M. T. S.; LANGONI, H.;MARCONDES-MACHADO, J.. Toxoplasmose experimental em ratos (Rattus norvegicus). avaliação da resposta sorológica, bioprova e comprovação de oligonucleotídeos na reação em cadeia pela polimerase. 2002 - Universidade Estadual Paulista Julio de Mesquita Filho.

Orientou

Ellen Monteiro Ribeiro Santos

DISTRIBUIÇÃO ESPAÇO-TEMPORAL DO SARAMPO: Contribuição da análise de fluxo intermunicipal no modelo SIR; Início: 2020; Dissertação (Mestrado profissional em Modelagem em Ciências da Terra e do Ambiente) - Universidade Estadual de Feira de Santana, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior; (Orientador);

Priscylla Marcelly Vilanova Oliveira do Nascimento

Agravos por cães e gatos a humanos no município de Feira de Santana, Bahia; Início: 2020; Dissertação (Mestrado profissional em Modelagem em Ciências da Terra e do Ambiente) - Universidade Estadual de Feira de Santana, Fundação de Amparo à Pesquisa do Estado da Bahia; (Orientador);

Mariana Guimarães Nilsson

Vigilância Molecular do SARS-CoV-2 em Animais de Companhia: coorte prospectiva de carnívoros e roedores domiciliados para uma abordagem de Saúde Única (Covid-Pets-FSA); Início: 2020; Dissertação (Mestrado profissional em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior; (Orientador);

Joelande Esquivel Correa

INDICADORES PARA A PREDIÇÃO DA DOENÇA DE CHAGAS: INTEGRAÇÃO DE SISTEMAS DE INFORMAÇÕES BIBLIOGRÁFICAS, EPIDEMIOLÓGICAS E AMBIENTAIS; Início: 2021; Tese (Doutorado em Programa de Pós-Graduação em Modelagem em Ciências da Terra e do Ambiente) - Universidade Estadual de Feira de Santana; (Orientador);

MAHYSA FERREIRA COSTA

Diversidade viral em espécies de morcegos (Mammalia, Chiroptera) em zona urbana e rural: Influência de fatores epidemiológicos e ambientais; Início: 2021; Tese (Doutorado em Programa de Pós-Graduação em Modelagem em Ciências da Terra e do Ambiente) - Universidade Estadual de Feira de Santana, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior; (Orientador);

Kathleen Ramos Deegan

Fungos e Enteroparasitos de Aves Silvestres de Vida Livre e Cativas; Início: 2021; Tese (Doutorado em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia; (Orientador);

Mirza de Carvalho Santana Cordeiro

Raiva em herbívoros domésticos e animais selvagens no Estado da Bahia: avaliação da ação antrôpica na dinâmica espaço-temporal; Início: 2020; Tese (Doutorado em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia; (Orientador);

Matheus Oliveira de Melo

Vigilância molecular de protozoários zoonóticos em tecidos de quirópteros; Início: 2021; Iniciação científica (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana, Fundação de Amparo à Pesquisa do Estado da Bahia; (Orientador);

Manuela Santos de Adolfo

Percepção, conhecimento e fatores de risco comportamentais dos tutores nas suas relações com seus animais de estimação: uma abordagem em saúde única; Início: 2021; Iniciação científica (Graduando em Ciências Farmacêuticas) - Universidade Estadual de Feira de Santana, Conselho Nacional de Desenvolvimento Científico e Tecnológico; (Orientador);

Mirza de Carvalho Santana Cordeiro

Análise espacial da contaminação por ovos de Toxocara spp no solo e presença de fezes em praças na área urbana de um munícipio baiano; 2020; Dissertação (Mestrado em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia, Fundação de Amparo à Pesquisa do Estado da Bahia; Orientador: Aristeu Vieira da Silva;

Lailla Rodrigues De Macedo

Fauna parasitária de Chaetodipterus faber (Broussonet, 1782) (Perciformes, Ephippidae) coletados em três locais da Baía de Todos os Santos, Bahia; 2020; Dissertação (Mestrado em Ecologia e evolução) - Universidade Estadual de Feira de Santana, Fundação de Amparo à Pesquisa do Estado da Bahia; Orientador: Aristeu Vieira da Silva;

Waldson Nunes de Jesus

Epidemiologia da Chikungunya em um município do Estado da Bahia, Brasil; 2020; Dissertação (Mestrado em SAÚDE COLETIVA) - Universidade Estadual de Feira de Santana, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior; Orientador: Aristeu Vieira da Silva;

Ilmara Simony Freitas Santana

Nematoda em amostras de tecidos de roedores e marsupiais da Mata Atlântica da Bahia; 2019; Dissertação (Mestrado em Ecologia e evolução) - Universidade Estadual de Feira de Santana, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior; Orientador: Aristeu Vieira da Silva;

Mariana Marrega Rezende Gondim

Toxoplasma gondii e Neospora caninum: Avaliação do crescimento in vitro em diferentes temperaturas; 2016; Dissertação (Mestrado em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior; Orientador: Aristeu Vieira da Silva;

Tarcísio Viana Cardoso

Dor, esforço e qualidade de vida de profissionais da Estratégia Saúde da Família em Guanambi - Bahia; 2016; Dissertação (Mestrado em Mestrado Profissional em Saúde Coletiva) - Universidade Estadual de Feira de Santana,; Orientador: Aristeu Vieira da Silva;

Livia Daniela Xavier

Fatores preditores para o abandono do tratamento em casos novos de tuberculose pulmonar em Itabuna/BA; 2016; Dissertação (Mestrado em Saúde Coletiva) - Universidade Estadual de Feira de Santana,; Orientador: Aristeu Vieira da Silva;

Adriana Lebram von Sohsten

Pesquisa de Toxocara em frangos (Gallus gallus domesticus) criados extensivamente; 2015; Dissertação (Mestrado em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior; Orientador: Aristeu Vieira da Silva;

LYOKELLY PINHO ARAUJO

Frequência de helmintos (Nematoda) em lavados da superfíce externa de Diptera (Insecta) coletados em Feira de Santana e Salvador, BA; 2015; Dissertação (Mestrado em Zoologia) - Universidade Estadual de Feira de Santana,; Orientador: Aristeu Vieira da Silva;

Rosana Maria Fialho

Tratamento da hepatite C em dois cenários do Estado da Bahia; 2015; Dissertação (Mestrado em Mestrado Profissional em Saúde Coletiva) - Universidade Estadual de Feira de Santana,; Orientador: Aristeu Vieira da Silva;

Patrícia Hercília Arcanjo de Almeida

Avaliação da presença de Achatina fulica Bowdich, 1822 (Gastropoda: Pulmonata) e estudo dos helmintos e protozoários associados, em Feira de Santana, Bahia, e estudo de parasitos associados; 2014; Dissertação (Mestrado em Zoologia) - Universidade Estadual de Feira de Santana, Fundação de Amparo à Pesquisa do Estado da Bahia; Orientador: Aristeu Vieira da Silva;

Sofia Aline Amaral Santos

Pesquisa de protozoários Apicomplexa em ostras Crassostrea rhizophorae, Guilding, 1828 (Bilvalvia: Ostreidae) da Baia de Todos os Santos, Bahia; 2014; Dissertação (Mestrado em Zoologia) - Universidade Estadual de Feira de Santana, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior; Orientador: Aristeu Vieira da Silva;

Franciele Rossandra Piassa

Prevalência e fatores de risco para a infecção pelo Toxoplasma gondii em granjas de reprodutores suídeos certificados ou não da região de Toledo, PR, Brasil; 2010; Dissertação (Mestrado em Mestrado em Ciência Animal) - Universidade Paranaense, Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Jacqueline Batista de Araújo

Sorologia, isolamento e genotipagem de Toxoplasma gondii de roedores sinantrópicos comensais e avaliação experimental da detecção de anticorpos contra o parasito em amostras de tecidos; 2010; Dissertação (Mestrado em Mestrado em Ciência Animal) - Universidade Paranaense, Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Duarte Alves de Araújo

O cão domiciliado como sentinela para a infecção pelo Toxoplasma gondii em seres humanos; 2010; Dissertação (Mestrado em Mestrado em Ciência Animal) - Universidade Paranaense, Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Adriano Martins

Freqüência e fatores de risco da neosporose em propriedades de produção leiteira de Umuarama, PR; 2009; Dissertação (Mestrado em Ciência Animal) - Universidade Paranaense,; Orientador: Aristeu Vieira da Silva;

Susiana Galli

Toxoplasmose natural e experimental em galinhas; 2008; 0 f; Dissertação (Mestrado em Ciência Animal) - Universidade Paranaense, Fundação Araucária de Apoio Ao Desenvolvimento Científico e Tecnológico do; Orientador: Aristeu Vieira da Silva;

Cleiton Paulo Aigner

Análise molecular de Toxoplasma gondii em tecidos de Gallus gallus utilizando a PCR em tempo real; 2008; 0 f; Dissertação (Mestrado em Mestrado Em Biotecnologia Aplicada a Agricultura) - Universidade Paranaense,; Orientador: Aristeu Vieira da Silva;

Joil Moreira Marques

Estudo da toxoplasmose em uma comunidade rural de Eldorado, MS; 2008; 0 f; Dissertação (Mestrado em Ciência Animal) - Universidade Paranaense,; Orientador: Aristeu Vieira da Silva;

Maria da Conceição Borges Gomes

?SAI O MORCEGO A PASSEAR; SÃO HORAS DE CEAR?: Agravos por quirópteros a humanos e a percepção de profissionais de saúde, no município de feira de santana, bahia, brasil; ; 2021; Tese (Doutorado em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia, Fundação de Amparo à Pesquisa do Estado da Bahia; Orientador: Aristeu Vieira da Silva;

Mariana Marrega Rezende Gondim

?Separação imunomagnética de cistos teciduais e esporocistos de Toxoplasma gondii por meio de um único anticorpo monoclonal e caracterização de sua proteína alvo por Western blot e imunoblot; 2020; Tese (Doutorado em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior; Orientador: Aristeu Vieira da Silva;

Patrícia Hercília Arcanjo de Almeida

Perfil genotípico e espacialização das infecções por Trypanosoma cruzi em animais silvestres da Mata Atlântica no Estado da Bahia; 2020; Tese (Doutorado em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior; Orientador: Aristeu Vieira da Silva;

Adriana Lebram von Sohsten

Infecção humana, aviária e a contaminação do solo pelo Toxocara spp; 2019; Tese (Doutorado em Ciência Animal Nos Trópicos) - Universidade Federal da Bahia, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior; Orientador: Aristeu Vieira da Silva;

Ediclei Lima do Carmo

Características soroepidemiológicas e moleculares da infecção pelo Toxoplasma gondii em humanos, suínos e galináceos no estado do Pará; 2011; Tese (Doutorado em Biologia de Agentes Infecciosos e Parasitários) - Universidade Federal do Pará,; Coorientador: Aristeu Vieira da Silva;

Wanderleia de Souza Mareco

Salmoneloses zoonóticas com enfâse na prevalência de Salmonella spp em produtos cárneos de origem suína; 2006; Monografia; (Aperfeiçoamento/Especialização em Vigilância Sanitária e Epidemiologia em Saúde) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Giani Lourenco Augusto

Dioctofimose renal em cão: relato de caso; 2005; 0 f; Monografia; (Aperfeiçoamento/Especialização em Clínica e Cirurgia de Pequenos Animais) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

José Mário Fernandes

Dictofimose renal em cão: relato de caso; 2005; 0 f; Monografia; (Aperfeiçoamento/Especialização em Clínica e Cirurgia de Pequenos Animais) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Márcia Küster de Paula Dreer

Pesquisa de anticorpos anti-Leptospira e anti-Toxoplasma em soros de cães da Sociedade de Amparo aos Animais de Umuarama (SAAU); 2005; 0 f; Monografia; (Aperfeiçoamento/Especialização em Clínica e Cirurgia de Pequenos Animais) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Romoaldo Marinho Pascotto

Resistência e eficácia dos anti-helmínticos ao parasito Haemonchus contortus em ovinos; 2005; 0 f; Monografia; (Aperfeiçoamento/Especialização em Clínica de Ruminantes) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Moacir Ferrari

Reconhecimento de parasitos e uso de produtos anti-parasitários em propriedades leiteiras da região de Umuarama - PR; 2005; 0 f; Monografia; (Aperfeiçoamento/Especialização em Clínica de Ruminantes) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Ronaldo Rogoni Bononi

Tratamento e Controle de Anaplasma marginale; 2005; 0 f; Monografia; (Aperfeiçoamento/Especialização em Clínica de Ruminantes) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Lucas Ambrosio Neri Castaldo

Patogenia da babesiose cerebral; 2005; 0 f; Monografia; (Aperfeiçoamento/Especialização em Clínica de Ruminantes) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Caroline Araujo Silva

Detecção de Toxoplasma gondii em animais silvestres no Estado da Bahia; 2018; Trabalho de Conclusão de Curso; (Graduação em Ciências Biológicas) - Universidade Estadual de Feira de Santana; Orientador: Aristeu Vieira da Silva;

Kathleen de Almeida Ferreira

Toxocara spp; : parasitos negligenciados- Detecção de ovos em amostras de solo e diferenciação molecular de espécies; 2017; Trabalho de Conclusão de Curso; (Graduação em Ciências Biológicas) - Universidade Estadual de Feira de Santana; Orientador: Aristeu Vieira da Silva;

JADSON NASCIMENTO BORGES

Detecção de Leishmania pelo método de PCR em animais silvestres no estado da Bahia; 2017; Trabalho de Conclusão de Curso; (Graduação em Ciências Biológicas) - Universidade Estadual de Feira de Santana; Orientador: Aristeu Vieira da Silva;

Taise Cristina Santa Barbara Silva Queiroz

Detecção molecular de Trypanosoma cruzi em órgãos de mamíferos silvestres da fauna da Mata Atlântica - Bahia; 2017; Trabalho de Conclusão de Curso; (Graduação em Ciências Biológicas) - Universidade Estadual de Feira de Santana; Orientador: Aristeu Vieira da Silva;

Marcos Argolo Campos Martins

Ocorrência de ovos de Toxocara sp em amostras de solo de praças e parques públicos de Feira de Santana - Bahia; 2012; Trabalho de Conclusão de Curso; (Graduação em Ciências Biológicas) - Universidade Estadual de Feira de Santana; Orientador: Aristeu Vieira da Silva;

Patrícia Hercília Arcanjo de Almeida

Prevalência de protozoários e helmintos entéricos em residentes de São Cristóvão, Feira de Santana, Bahia; 2012; Trabalho de Conclusão de Curso; (Graduação em Ciências Biológicas) - Universidade Estadual de Feira de Santana; Orientador: Aristeu Vieira da Silva;

Thays Mizuki Lucas

Estágio Supervisionado Obrigatório em Clínica de Doenças Infecciosas; 2009; Trabalho de Conclusão de Curso; (Graduação em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Thiago de Oliveira Zamprogna

Estágio Supervisionado Obrigatório em Clínica de Doenças Infecciosas e Diagnóstico Laboratorial das Zoonoses; 2009; Trabalho de Conclusão de Curso; (Graduação em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Isabela Maria Polido Guerra

Estágio Supervisionado Obrigatório em Inspeção no Abate de Bovinos; 2009; Trabalho de Conclusão de Curso; (Graduação em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Tamara Caroline Gasque

Estágio Supervisionado Obrigatório em Controle de Qualidade no Abate de Aves; 2009; Trabalho de Conclusão de Curso; (Graduação em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Leonardo Passos Besagio

Estágio Curricular Supervisionado em Suinocultura; 2008; Trabalho de Conclusão de Curso; (Graduação em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

João Marco Pansera Bottin

Toxoplasmose experimental murina; 2007; Trabalho de Conclusão de Curso; (Graduação em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

HERIC BOARETO

Ocorrência de Toxoplasma gondii em suínos de Umuarama e Francisco Beltrão, PR; 2007; Trabalho de Conclusão de Curso; (Graduação em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Edson Assis Bastos Júnior

Resistência parasitária em ovinos; 2007; Trabalho de Conclusão de Curso; (Graduação em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Francislaine Aparecida dos Reis Lívero

Hemoparasitos em cães de propriedades rurais de Eldorado - MS; 2007; Trabalho de Conclusão de Curso; (Graduação em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Fabiane Beatriz Isbrescht

Prevalência de anticorpos anti-Toxoplasma em cães e gatos de propriedades rurais de Eldorado - MS; 2007; Trabalho de Conclusão de Curso; (Graduação em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Fernando César Belinato

Toxoplasmose experimental em frangos; 2007; Trabalho de Conclusão de Curso; (Graduação em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Kelly Cristina Martini

Correlação entre o California Mastitis Test e a Contagem de Células Somáticas em Leite de Vacas Criadas Sobre Diferentes Sistemas de Produção; 2007; Trabalho de Conclusão de Curso; (Graduação em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Keila de Paula Neiverth

Controle da coccidiose em aves; 2006; Trabalho de Conclusão de Curso; (Graduação em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Sheila Henkes

Contaminação de praças públicas de Umuarama, PR, por enteroparasitas; 2005; 0 f; Trabalho de Conclusão de Curso; (Graduação em Farmácia e Bioquímica) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Luiz Henrique Silva

Pesquisa de parasitas potencialmente zoonóticos em fezes de cães coletadas em praças públicas da cidade de Umuarama, PR; 2005; 0 f; Trabalho de Conclusão de Curso; (Graduação em Farmácia e Bioquímica) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Jaime de Almeida

Revisão de literatura: Atividade anti-depressiva do hipérico; 2005; 0 f; Trabalho de Conclusão de Curso; (Graduação em Farmácia) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Fabiana Baldo

Avaliação da atividade carrapaticida de extrato de Ruta graveolens L; ; 2005; 0 f; Trabalho de Conclusão de Curso; (Graduação em Farmácia) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Andréia Paulista de Almeida

Toxoplasmose congênita - Revisão de Literatura; 2005; 30 f; Trabalho de Conclusão de Curso; (Graduação em Farmácia) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Aristides Daniel Ortiz

Eficácia in vitro do extrato hidroalcoólico de Chenopodium ambrosioides sobre a postura e eclosão de Boophilus microplus; ; 2005; 0 f; Trabalho de Conclusão de Curso; (Graduação em Farmácia) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Jéssica Storari Dias Frohner

Desenvolvimento de um bioterápico a partir de Ctenocephalides spp e teste preliminar no controle da infestação por pulgas em cães; ; 2005; 0 f; Trabalho de Conclusão de Curso; (Graduação em Farmácia) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Kellen Cristina Fernandes

Pesquisa de enteroparasitas em amostras de rúcula e alface comercializadas em Umuarama, PR; 2005; 0 f; Trabalho de Conclusão de Curso; (Graduação em Farmácia e Bioquímica) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Rodrigo de Almeida

Avaliação da contaminação de amostras de almeirão e couve por parasitas intestinais na cidade de Umuarama, PR; ; 2005; 0 f; Trabalho de Conclusão de Curso; (Graduação em Farmácia e Bioquímica) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Fernando Latronico

Relatório de Estágio Supervisionado na área de Clínica Médica e Cirúrgica de Grandes Animais; 2005; 30 f; Trabalho de Conclusão de Curso; (Graduação em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Kelly Bufão Cereli

Relatório de Estágio em Clínica Médica e Cirúrgica de Grandes Animais; 2005; 30 f; Trabalho de Conclusão de Curso; (Graduação em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Antônio Luiz Ruzzon

Relatório de Estágio Supervisionado em Manejo de Bovinos de Corte; 2005; 30 f; Trabalho de Conclusão de Curso; (Graduação em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Hellen Beligni

Drogas anoréxigenas: Usos e abusos; 2004; 0 f; Trabalho de Conclusão de Curso; (Graduação em Farmácia) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Fátima Regina da Silva Alves

Relatório de Estágio Curricular Supervisionado em Clínica Médica e Cirúrgica de Grandes Animais; 2004; 65 f; Trabalho de Conclusão de Curso; (Graduação em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Camila Tachetto Wollmann

Automedicação e os acadêmicos da Área de Saúde da UNIPAR - Universidade Paranaense em Umuarama - PR; 2004; 28 f; Trabalho de Conclusão de Curso; (Graduação em Farmácia e Bioquímica) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Edson Dal Castel

Relatório de Estágio Supervisionado em Clínica Médica e Cirúrgica de Grandes Animais; 2004; 30 f; Trabalho de Conclusão de Curso; (Graduação em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Rodrigo Costa da Silva

Utilização da reação em cadeia pela polimerase (PCR) no diagnóstico de toxoplasmose; 2001; 100 f; Trabalho de Conclusão de Curso; (Graduação em Medicina Veterinária) - Fundação de Ensino Otávio Bastos; Orientador: Aristeu Vieira da Silva;

Matheus Oliveira de Mello

Avaliação da dinâmica de anticorpos anti-Toxoplasma gonddi em individuos de propriedades rurais de Feira de Santana, BA; 2020; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana, Fundação de Amparo à Pesquisa do Estado da Bahia; Orientador: Aristeu Vieira da Silva;

Priscylla Marcelli Villanova

Determinação da sensibilidade analítica da reação em cadeia pela polimerase para detecção de DNA de Toxocara em amostras de solo; ; 2019; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana, Conselho Nacional de Desenvolvimento Científico e Tecnológico; Orientador: Aristeu Vieira da Silva;

Ellen Monteiro Ribeiro dos Santos

Padronização do Ensaio Imunoenzimático para Detecção de Anticorpos Anti-Ascaridia em Soro de Frangos; 2019; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana, Conselho Nacional de Desenvolvimento Científico e Tecnológico; Orientador: Aristeu Vieira da Silva;

Sebastião Neto Nunes de Araújo

Avaliação da prevalência de ectoparasitas em Quirópteros presentes em áreas urbanas e rurais do município de Feira de Santana, Bahia; ; 2019; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana, Fundação de Amparo à Pesquisa do Estado da Bahia; Orientador: Aristeu Vieira da Silva;

Ellen Monteiro Ribeiro dos Santos

Avaliação da infecção experimental pelo Toxocara canis e Ascaridia galli em frangos de corte de linhagem; 2017; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana, Conselho Nacional de Desenvolvimento Científico e Tecnológico; Orientador: Aristeu Vieira da Silva;

Priscylla Marcelly Vilanova Oliveira do Nascimento

Avaliação da associação entre os constituintes do solo e a presença e viabilidade de ovos de Toxocara spp; ; 2017; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana, Conselho Nacional de Desenvolvimento Científico e Tecnológico; Orientador: Aristeu Vieira da Silva;

Ellen Monteiro Ribeiro Santos

Detecção e caracterização de enteroparasitos em animais silvestres; 2016; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana; Orientador: Aristeu Vieira da Silva;

Taise Cristina Santa Barbara Silva Queiroz

Análise Molecular de Trypanosoma cruzi em Amostras Teciduais de Órgãos de Mamíferos Silvestres da Mata Atlântica ? Bahia; 2016; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana; Orientador: Aristeu Vieira da Silva;

Caroline Araújo da Silva

Detecção de DNA de Toxoplasma gondii em animais silvestres no Estado da Bahia; 2016; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana, Fundação de Amparo à Pesquisa do Estado da Bahia; Orientador: Aristeu Vieira da Silva;

JADSON NASCIMENTO BORGES

Detecção através de PCR de protozoários parasitos (Sporozoea - Sarcocystidae) em amostras de embutidos de origem suína; 2015; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana, Conselho Nacional de Desenvolvimento Científico e Tecnológico; Orientador: Aristeu Vieira da Silva;

Caroline Araújo da Silva

Frequência de Toxoplasma gondii em amostras de tecidos de frangos e em cérebro de camundongos; 2015; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana, Fundação de Amparo à Pesquisa do Estado da Bahia; Orientador: Aristeu Vieira da Silva;

Taise Cristina Santa Barbara Silva Queiroz

Análise Molecular de Protozoários da Família Sarcocystidae em amostras teciduais de órgãos de ovinos no Município de Feira Santana, BA; 2015; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana, Fundação de Amparo à Pesquisa do Estado da Bahia; Orientador: Aristeu Vieira da Silva;

Kathleen de Almeida Ferreira

Avaliação da técnica de concentração de ovos de Toxocara canis a partir de amostras de solo artificialmente contaminados; 2015; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana, Fundação de Amparo à Pesquisa do Estado da Bahia; Orientador: Aristeu Vieira da Silva;

Kathleen de Almeida Ferreira

Pesquisa de helmintos de interesse zoonótico em amostras de solo de uma comunidade rural da cidade de Feira de Santana-BA; 2014; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana, Conselho Nacional de Desenvolvimento Científico e Tecnológico; Orientador: Aristeu Vieira da Silva;

Lindsei de Cerqueira Leite

Ocorrência de bactérias em ostras comercializadas para consumo humano; 2014; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana, Universidde Estadual de Feira de Santana; Orientador: Aristeu Vieira da Silva;

Taise Cristina Santa Barbara Silva Queiroz

Prevalência de enteroparasitos em população rural de Feira de Santana, BA; 2014; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana, Conselho Nacional de Desenvolvimento Científico e Tecnológico; Orientador: Aristeu Vieira da Silva;

Jeovania Andrade Bittencourt Sena

Isolamento de Toxoplasma gondii de amostras de tecidos de frango; 2014; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana, UEFS; Orientador: Aristeu Vieira da Silva;

Caroline Araújo da Silva

Isolamento de Toxoplasma gondii de amostras de tecidos de frango; 2014; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana, UEFS; Orientador: Aristeu Vieira da Silva;

JADSON NASCIMENTO BORGES

Investigação da presença de protozoários parasitos em amostras de solo de uma comunidade rural do estado da Bahia; 2014; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana, UEFS; Orientador: Aristeu Vieira da Silva;

Édlla Virginia Rios Lima

Detecção de protozoários e helmintos na superfície externa de dípteros sinantrópicos; 2013; Iniciação Científica; (Graduando em Odontologia) - Universidade Estadual de Feira de Santana, Universidade Estadual de Feira de Santana; Orientador: Aristeu Vieira da Silva;

Luana Maria Silva de Macedo e Marques Guerra

Pesquisa de larvas de Toxocara em amostras de tecidos de frangos comercializados em Feira de Santana, BA; 2013; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana, Universidde Estadual de Feira de Santana; Orientador: Aristeu Vieira da Silva;

Priscylla Marcelly Vilanova Oliveira do Nascimento

Análise da concentração de metais pesados em tecidos de ostras (Crassostrea sp); 2013; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana, Conselho Nacional de Desenvolvimento Científico e Tecnológico; Orientador: Aristeu Vieira da Silva;

JADSON NASCIMENTO BORGES

Detecção de cistos de Sarcocystis em amostras de embutidos preparados com carne suína; 2013; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana, Fundação de Amparo à Pesquisa do Estado da Bahia; Orientador: Aristeu Vieira da Silva;

Kathleen de Almeida Ferreira

Pesquisa de Toxocara canis em vísceras de ovinos comercializadas em mercados públicos de Feira de Santana, BA; 2013; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana, Conselho Nacional de Desenvolvimento Científico e Tecnológico; Orientador: Aristeu Vieira da Silva;

Leandro Silvestre de Oliveira Gomes

Estudo da prevalência e fatores de risco para a infecção por Toxoplasma gondii em cães de uma comunidade rural no estado da Bahia; ; 2012; Iniciação Científica; (Graduando em Odontologia) - Universidade Estadual de Feira de Santana, Fundação de Amparo à Pesquisa do Estado da Bahia; Orientador: Aristeu Vieira da Silva;

Larissa Gama Costa

Prevalência de infecções por Cryptosporidium em cães de uma comunidade rural do interior da Bahia; 2012; Iniciação Científica; (Graduando em Odontologia) - Universidade Estadual de Feira de Santana, Fundação de Amparo à Pesquisa do Estado da Bahia; Orientador: Aristeu Vieira da Silva;

Michelly Thainá Neves Cardoso Santos Novais

Identificação de moscas sinantrópicas vetores de parasitos; 2012; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Estadual de Feira de Santana, Fundação de Amparo à Pesquisa do Estado da Bahia; Orientador: Aristeu Vieira da Silva;

Bruna Cássia da Silva

Ovos embrionados de galinha como modelos experimentais da toxoplasmose congênita; 2009; Iniciação Científica; (Graduando em Farmácia e Bioquímica) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Daniele Fink Zanette

Prevalência da leptospirose e neosporose em bovinos e cães de propriedades de Umuarama; 2009; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Danilo Ratti da Silva

Leptospirose em suínos de granjas da região de Toledo, PR; 2009; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

LUAN DUARTE CALDATO

Comparação da multiplex-PCR e da nested-PCR na genotipagem de amostras de Toxoplasma gondii isoladas de suínos; Parte I: Prevalência e isolamento de cepas de Toxoplasma gondii; 2009; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Noemila Debora Kozerski

Roedores sinantrópicos como reservatórios de agentes de zoonoses: 2; Leptospira; 2009; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Patricia Rodrigues Ribeiro

Roedores sinantrópicos como reservatórios de agentes de zoonoses: 1; Toxoplasma gondii; 2009; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Rodrigo Mattei

Roedores sinantrópicos como reservatórios de agentes de zoonoses: 1; Toxoplasma gondii; 2009; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense, Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Ronaldo César da Rosa

Roedores sinantrópicos como reservatórios de agentes de zoonoses: 2; Leptospira; 2009; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense, Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Daniele Fink Zanette

Detecção de anticorpos anti-Brucella abortus em cães da comunidade Porto Figueira, PR; 2009; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense, Fundação Araucária de Apoio Ao Desenvolvimento Científico e Tecnológico do; Orientador: Aristeu Vieira da Silva;

Noemila Debora Kozerski

Frequência de Cryptosporidium sp em roedores sinantrópicos dos gêneros Rattus e Mus capturados na área urbana de Umuarama, PR; 2009; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense, Fundação Araucária de Apoio Ao Desenvolvimento Científico e Tecnológico do; Orientador: Aristeu Vieira da Silva;

Danilo Ratti da Silva

Detecção de anticorpos anti-Brucella abortus em humanos na cidade ribeirinha de Porto Figueira, PR; 2009; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense, Conselho Nacional de Desenvolvimento Científico e Tecnológico; Orientador: Aristeu Vieira da Silva;

Thays Mizuki Lucas

Ovos embrionados como modelo experimental da toxoplasmose congênita; 2008; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense, Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Thiago de Oliveira Zamprogna

Prevalência da leptospirose e neosporose em bovinos e cães de propriedades de Umuarama ? PR; 2008; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense, Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Rodrigo Mattei

Comparação da multiplex PCR e da nested PCR na genotipagem de amostras de Toxoplasma gondii isoladas de suínos; 2008; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense, Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Ronaldo César da Rosa

Comparação da multiplex PCR e da nested PCR na genotipagem de amostras de Toxoplasma gondii isoladas de suínos; 2008; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense, Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Dayse Vaniele da Silva

Estudo da toxplasmose em uma comunidade rural: 1; Prevalência e fatores de risco em seres humanos; 2008; Iniciação Científica; (Graduando em Enfermagem) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Aline Dalmolin

Detecção de anticorpos anti-Toxoplasma gondii em galinhas criadas extensivamente em propriedades de criação de gado de leite do município de Umuarama - PR; 2008; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense, Fundação Araucária de Apoio Ao Desenvolvimento Científico e Tecnológico do; Orientador: Aristeu Vieira da Silva;

Isabela Maria Polido Guerra

Ocorrência da toxoplasmose em bovinos de propriedades leiteiras do município de Umuarama-PR; 2008; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense, Fundação Araucária de Apoio Ao Desenvolvimento Científico e Tecnológico do; Orientador: Aristeu Vieira da Silva;

Roger Estevam Soares

Detecção de anticorpos anti-Toxoplasma gondii em amostras de tecidos de camundongos cronicamente infectados; 2008; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense, Conselho Nacional de Desenvolvimento Científico e Tecnológico; Orientador: Aristeu Vieira da Silva;

Jaqueline de Santana da Silva

Padronização da técnica de inibição in vitro da eclosão de ovos de helmintos e avaliação da atividade de compostos biológicos sobre ovos de trichostrongílideos; 2008; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Paranaense, Fundação Araucária de Apoio Ao Desenvolvimento Científico e Tecnológico do; Orientador: Aristeu Vieira da Silva;

Fernando César Bellinato

Infecção experimental de galinhas domésticas (Gallus gallus) com cepas geneticamente distintas de Toxoplasma gondii; 2007; 0 f; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense, Conselho Nacional de Desenvolvimento Científico e Tecnológico; Orientador: Aristeu Vieira da Silva;

Isabela Maria Polido Guerra

Prevalência da toxoplasmose em equinos e bovinos de uma comunidade rural de Eldorado, MS; 2007; 0 f; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense, Fundação Araucária de Apoio Ao Desenvolvimento Científico e Tecnológico do; Orientador: Aristeu Vieira da Silva;

Dayse Vaniele da Silva

Estudo da toxoplasmose em uma comunidade rural: 1; Prevalência fatores de risco em seres humanos; 2007; Iniciação Científica; (Graduando em Enfermagem) - Universidade Paranaense, Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Thays Mizuki Lucas

Toxoplasmose natural e experimental em Gallus gallus; 2007; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense, Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Nathalie Dantas

Estudo da toxoplasmose em uma comunidade rural: 1; Prevalência e fatores de risco em humanos; 2007; Iniciação Científica; (Graduando em Ciências Biológicas Com Ênfase Em Biotecnologia) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Patrícia Ribeiro dos Santos

Estudo da toxoplasmose em uma comunidade rural: 1; Prevalência e fatores de risco em humanos; 2007; Iniciação Científica; (Graduando em Enfermagem) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

João Marco Pansera Bottin

Toxoplasmose experimental em roedores: produção de cistos teciduais e criopreservação de Toxoplasma gondii; 2007; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Edson Assis Bastos Júnior

Toxoplasmose experimental em roedores: produção de cistos teciduais e criopreservação de Toxoplasma gondii; 2007; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Rodrigo Mattei

Comparação da multiplex-PCR e da nested-PCR na genotipagem de amostras de Toxoplasma gondii isoladas de suínos; Parte I: Prevalência e isolamento de cepas de Toxoplasma gondii; 2007; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Ronaldo César da Rosa

Comparação da multiplex-PCR e da nested-PCR na genotipagem de amostras de Toxoplasma gondii isoladas de suínos; Parte I: Prevalência e isolamento de cepas de Toxoplasma gondii; 2007; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Aline Dalmolin

Estudo da toxoplasmose em uma comunidade rural: 2; Prevalência e fatores de risco em animais; 2007; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Andressa Castaldo da Silva

Estudo da toxoplasmose em uma comunidade rural: 2; Prevalência e fatores de risco em animais; 2007; Iniciação Científica; (Graduando em Enfermagem) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Fabiane Beatriz Isbrescht

Comparação da multiplex-PCR e da nested-PCR na genotipagem de amostras de Toxoplasma gondii isoladas de suínos; 2006; 0 f; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense, Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

HERIC BOARETO

Comparação da multiplex-PCR e da nested-PCR na genotipagem de amostras de Toxoplasma gondii isoladas de suínos; 2006; 0 f; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense, Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Gustavo Bernart

Comparação da multiplex-PCR e da nested-PCR na genotipagem de amostras de Toxoplasma gondii isoladas de suínos; 2006; 0 f; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Maria Aparecida Vasconcelos

Comparação da multiplex-PCR e da nested-PCR na genotipagem de amostras de Toxoplasma gondii isoladas de suínos; 2006; 0 f; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Edson Assis Bastos Júnior

Perfil epidemiológico da toxoplasmose canina: análise fenotípica de cepas de Toxoplasma gondii isoladas de cães - Fase I; 2006; 0 f; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Isabela Maria Polido Guerra

Perfil epidemiológico da toxoplasmose canina: análise fenotípica de cepas de Toxoplasma gondii isoladas de cães - Fase I; 2006; 0 f; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Franciéli dos Santos Silva

Uso do extrato etílico de Bouchea fluminensis no pós-operatório em cães submetidos a artrotomia do joelho - Estudo experimental; 2006; 0 f; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Marcelo Guimarães Fuentes

Uso do extrato etílico de Bouchea fluminensis no pós-operatório em cães submetidos a artrotomia do joelho - Estudo experimental; 2006; 0 f; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Vinícius de Oliveira Cruz

Uso do extrato etílico de Bouchea fluminensis no pós-operatório em cães submetidos a artrotomia do joelho - Estudo experimental; 2006; 0 f; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Francislaine Aparecida dos Reis Lívero

Perfil epidemiológico da toxoplasmose canina; 2005; 0 f; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense, Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

João Marco Pansera Bottin

Perfil epidemiológico da toxoplasmose canina; 2005; 0 f; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense, Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

HERIC BOARETO

Perfil epidemiológico da toxoplasmose canina; 2005; 0 f; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Keila de Paula Neiverth

Perfil epidemiológico da toxoplasmose canina; 2005; 0 f; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Paulo Luiz da Cunha Junior

Desenvolvimento de células de sarcoma TG180 em camundongos; 2005; 0 f; Iniciação Científica; (Graduando em Farmácia e Bioquímica) - Universidade Paranaense, Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Luciene Virginia Boso

Desenvolvimento de células de sarcoma TG180 em camundongos; 2005; 0 f; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Fernando César Bellinato

Perfil epidemiológico da toxoplasmose canina - Análise fenotípica de cepas de Toxoplasma gondii isoladas de cães - Fase I; 2005; 0 f; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense, Fundação Araucária de Apoio Ao Desenvolvimento Científico e Tecnológico do; Orientador: Aristeu Vieira da Silva;

Paulo Luiz da Cunha Junior

Desenvolvimento de células de sarcoma TG-180 em camundongos; Uso potencial na avaliação de drogas anti-tumorais e na preparação de antígenos para provas diagnósticas; 2004; 0 f; Iniciação Científica; (Graduando em Farmácia e Bioquímica) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Gisele Nunes Piton

Desenvolvimento de células de sarcoma TG-180 em camundongos; Uso potencial na avaliação de drogas anti-tumorais e na preparação de antígenos para provas diagnósticas; 2004; 0 f; Iniciação Científica; (Graduando em Farmácia) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Fernando César Bellinato

Perfil epidemiológico da toxoplasmose canina: análise fenotípa de cepas de Toxoplasma gondii isoladas de cães - Fase I; 2004; 0 f; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Jane Tominaga

Perfil epidemiológico da toxoplasmose canina: análise fenotípa de cepas de Toxoplasma gondii isoladas de cães - Fase I; 2004; 0 f; Iniciação Científica; (Graduando em Farmácia e Bioquímica) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Everton Butzge

Perfil epidemiológico da toxoplasmose canina: análise fenotípa de cepas de Toxoplasma gondii isoladas de cães - Fase I; 2004; 0 f; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Lyokelly |Pinho Araújo

Parasitologia: O mundo invisível das moscas; 2012; Orientação de outra natureza; (Ciências Biológicas) - Universidade Estadual de Feira de Santana, Fundação de Amparo à Pesquisa do Estado da Bahia; Orientador: Aristeu Vieira da Silva;

Valdeci Messa

Diagnóstico de Zoonoses Parasitárias; 2007; Orientação de outra natureza; (Ciências Biológicas Com Ênfase Em Biotecnologia) - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

André Felipe Moreira Silva

Toxoplasmose Experimental em Roedores; 2006; Orientação de outra natureza - Colégio Estadual de Ensino Médio e Fundamental Almirante Tamandaré, Fundação Araucária de Apoio Ao Desenvolvimento Científico e Tecnológico do; Orientador: Aristeu Vieira da Silva;

Kelly Cristina de Oliveira Silva Polete

Estágio em Parasitologia Veterinária; 2004; 0 f; Orientação de outra natureza - Universidade Paranaense; Orientador: Aristeu Vieira da Silva;

Foi orientado por

Jose Rafael Modolo

PLANEJAMENTO DE SAÚDE ANIMAL E SAÚDE PÚBLICA; 1993; 0 f; Orientação de outra natureza - Fac Med Vet Zoot Unesp de Botucatu; Orientador: Jose Rafael Modolo;

Hélio Langoni

Toxoplasmose ovina: Avaliação de métodos diretos na detecção do seu agente em cordeiros sorologicamente positivos, abatidos para consumo humano; Botucatu, 1999; 1999; 0 f; Dissertação (Mestrado em Medicina Veterinária) - Universidade Estadual Paulista Júlio de Mesquita Filho, Fundação de Amparo à Pesquisa do Estado de São Paulo; Orientador: Helio Langoni;

Hélio Langoni

Toxoplasmose experimental em ratos (Rattus norvegicus); Avaliação da resposta sorológica, da bioprova e comparação de oligonucleotídeos na reação em cadeia pela polimerase (PCR); 2003; 0 f; Tese (Doutorado em Doenças Tropicais) - Universidade Estadual Paulista Júlio de Mesquita Filho, Fundação de Amparo à Pesquisa do Estado de São Paulo; Orientador: Helio Langoni;

Hélio Langoni

Pesquisa de aglutininas anti-brucella em soro de equídeos, através da prova de soroaglutinação rápida e lenta e do 2-mercaptoetanol; 1994; 0 f; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Estadual Paulista Júlio de Mesquita Filho, Fundação de Amparo à Pesquisa do Estado de São Paulo; Orientador: Helio Langoni;

Hélio Langoni

Residência (R2) em Zoonoses e Saúde Pública; 1996; 0 f; Orientação de outra natureza - Universidade Estadual Paulista Júlio de Mesquita Filho, Fundação Para o Aprimoramento Profissional; Orientador: Helio Langoni;

Hélio Langoni

Residência (R1) em Zoonoses e Saúde Pública; 1995; 0 f; Orientação de outra natureza - Universidade Estadual Paulista Júlio de Mesquita Filho, Fundação Para o Aprimoramento Profissional; Orientador: Helio Langoni;

Hélio Langoni

Estágio na Disciplina de Zoonoses; 1994; 0 f; Orientação de outra natureza - Universidade Estadual Paulista Júlio de Mesquita Filho; Orientador: Helio Langoni;

Hélio Langoni

Estágio na Disciplina de Zoonoses; 1993; 0 f; Orientação de outra natureza - Universidade Estadual Paulista Júlio de Mesquita Filho; Orientador: Helio Langoni;

Produções bibliográficas

  • RIBEIRO, Marcio Garcia ; Silva, Aristeu Vieira da . Safety issues of raw milk: evaluation of bacteriological and physicochemical characteristics of human milk from a bank in a teaching hospital, focusing on Staphylococcus species. REVISTA DO INSTITUTO DE MEDICINA TROPICAL DE SÃO PAULO , v. 63, p. e54, 2021.

  • DE OLIVEIRA ZAMPROGNA, THIAGO ; RIBEIRO, DAYANA ; AZEVEDO, VASCO A.C. ; LARA, GUSTAVO HENRIQUE BATISTA ; MOTTA, RODRIGO GARCIA ; DA SILVA, RODRIGO COSTA ; SIQUEIRA, Amanda Keller ; DE NARDI JÚNIOR, GERALDO ; LISTONI, Fernando José Paganini ; DE SOUZA ARAÚJO MARTINS, LORRAYNE ; DA SILVA, ARISTEU VIEIRA ; PORTILHO, FÁBIO VINÍCIUS RAMOS ; DA ROCHA MOTA, ANDRÉ ; RODRIGUES, CAROLINA APARECIDA ; DE ALMEIDA, BEATRIZ OLIVEIRA ; Ribeiro, Márcio Garcia . Bacteriological, cytological, and molecular investigation of Corynebacterium pseudotuberculosis, mycobacteria, and other bacteria in caseous lymphadenitis and healthy lymph nodes of slaughtered sheep. BRAZILIAN JOURNAL OF MICROBIOLOGY , v. 52, p. 431-438, 2021.

  • SALERNO, T. ; SIQUEIRA, A.K. ; PINTO, J. P. A. N. ; CUNHA, M.L.R.S. ; Sivestre, P.K. ; CONDAS, L.A.Z. ; LARA, G. H. B. ; PEREIRA, J. G. ; Da SILVA, A. V. ; LISTONI, F. J. P. ; Martins, L.S.A. ; MOTTA, R.G. ; RIBEIRO, Márcio Garcia . Safety issues of raw milk: evaluation of bacteriological and physicochemical characteristics of human milk from a bank in a teaching hospital, focusing on Staphylococcus species. REVISTA DO INSTITUTO DE MEDICINA TROPICAL DE SÃO PAULO , v. 63, p. 1-11, 2021.

  • von SOHSTEN, A. L. ; Da SILVA, A. V. ; RUBINSKY-ELEPHANT, G. ; SANTANA, I. S. F. ; CORREIA, J. E. ; CRUZ, L.A. ; SANTOS, E. M. R. ; OLIVEIRA, P. M. V. . Chickens bred extensively as sentinels from soil contamination by Toxocara. EXPERIMENTAL PARASITOLOGY , v. 211, p. 107852, 2020.

  • BRITO JUNIOR, PEDRO DE ALCÂNTARA ; ROCHA, JOSIANE MOREIRA ; SILVA, CAROLINE ARAÚJO DA ; OLIVEIRA, PRISCYLLA MARCELLY VILANOVA ; CORREIA, JOELANDE ESQUIVEL ; CRUZ, LUCIARA ALVES DA ; SEVÁ, ANAIÁ DA PAIXÃO ; OLIVEIRA, TÉO VEIGA DE ; Silva, Aristeu Vieira da ; ALVAREZ, MARTÍN ROBERTO DEL VALLE ; ALBUQUERQUE, GEORGE RÊGO . Survey of anti-Toxoplasma gondii antibodies in wild mammals captured from Atlantic Forest fragments in Bahia, northeastern Brazil. REVISTA BRASILEIRA DE PARASITOLOGIA VETERINARIA , v. 29, p. e004720, 2020.

  • ROCHA, D. S. ; NILSSON, M. G. ; MACIEL, B. M. ; PENA, H. F. J. ; ALVES, B. F. ; Da SILVA, A. V. ; GONDIM, L. F. P. ; ALBUQUERQUE, G. R. . GENETIC DIVERSITY OF TOXOPLASMA GONDII ISOLATES FROM FREE-RANGE CHICKENS IN BAHIA, BRAZIL. JOURNAL OF PARASITOLOGY , v. 1, p. 1-10, 2018.

  • REZENDE-GONDIM, M. M. ; DA SILVA, A.V. ; SCHARES, G. ; GONDIM, L. F. P. . In contrast to Toxoplasma gondii, Neospora caninum tachyzoites did not sustain multiplication in vitro at increased incubation temperatures. Veterinary Parasitology (Print) , v. 234, p. 19-24, 2017.

  • von SOHSTEN, A. L. ; DA SILVA, A.V. ; RUBINSKY-ELEFANT, G ; GUERRA, L. M. S. M. M. . Anti- Toxocara spp. IgY antibodies in poultry sold in street markets from Feira de Santana, Bahia, Northeastern Brazil. Veterinary Parasitology: Regional Studies and Reports , v. 8, p. 86-89, 2017.

  • CARMO, E. L. ; MORAIS, R. A. P. B. ; LIMA, M. S. ; MORAES, C. C. G. ; ALBUQUERQUE, G. R. ; DA SILVA, A.V. ; POVOA, M. M. . Anti-Toxoplasma gondii antibodies in beef cattle slaughtered in the metropolitan region of Belém, Brazilian Amazon. REVISTA BRASILEIRA DE PARASITOLOGIA VETERINARIA , v. 26, p. 226-230, 2017.

  • SIQUEIRA, A. K. ; SALERMO, T. ; LARA, G. H. B. ; CONDAS, L. A. Z. ; PEREIRA, V. C. ; RIBOLI, D. F. M. ; LISTONI, F.J.P. ; DA SILVA, A.V. ; LEITE, D. S. ; CUNHA, M. L. R. S. ; RIBEIRO, M.G. . Enterotoxin genes, multidrug resistance, and molecular typing of Staphylococcus spp. isolated from organic bovine milk. BRAZILIAN JOURNAL VETERINARY RES. AND ANIMAL SCIENCE , v. 54, p. 81-87, 2017.

  • SANT'ANA, D. M. G. ; GOES, M. B. ; HERMES-ULIANA, C. ; PEREIRA-SEVERI, L.S. ; BATISTA, E. M. ; MANTOVANI, L. C. ; DA SILVA, A.V. ; ARAUJO, E. J. A. . Acute infection with an avirulent strain of Toxoplasma gondii causes decreasing and atrophy of nitrergic myenteric neurons of rats. ACTA HISTOCHEMICA , p. 1-10, 2017.

  • GOES, M. B. ; HERMES-ULIANA, C. ; ZAGO, M. C. B. ; ZANONI, J. N. ; DA SILVA, A.V. ; MIRANDA NETO, M. H. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Chronic infection with Toxoplasma gondii induces death of submucosal enteric neurons and damage in the colonic mucosa of rats. Experimental Parasitology , v. 164, p. 56-63, 2016.

  • CARMO, E. L. ; MORAIS, R. A. P. B. ; OLIVEIRA, A. S. ; FIGUEREDO, J. E. ; FIGUEREDO, M. C. ; DA SILVA, A.V. ; BICHARA, C. N. C. ; POVOA, M. . Soroepidemiologia da infecção pelo Toxoplasma gondii no município de Novo Repartimento, Estado do Pará, Brasil. Revista Pan-Amazônica de Saúde (Online) , v. 7, p. 79-87, 2016.

  • da SILVA, R. C. ; LIMA, V. Y. ; DA SILVA, A.V. ; SOUZA, L.C. ; LANGONI, H. . Seroepidemiological survey for canine leptospirosis in the coast of São Paulo State, Brazil. Veterinária e Zootecnia (UNESP) , v. 23, p. 495-503, 2016.

  • RAPOSO, R. S. ; MERIGUETI, Y. F. ; RUBINSKY-ELEFANT, G ; CERAZO, L. L. ; PEREIRA, L. ; ZAMPIERI, B. P. ; DA SILVA, A.V. ; LAPOZI, C. B. . Kinetic and avidity of IgY anti-Toxocara antibodies in experimentally infected chickens. Experimental Parasitology , p. 33-41, 2016.

  • MORAIS, R. A. P. B. ; FREIRE, A. B. C. ; BARBOSA, D. R. L. ; SILVA, L. C. T. ; PINEHIRO, A. F. ; COSTA, S. S. ; RAMOS, F. L. P. ; BICHARA, C. N. C. ; LIMA, L. J. B. ; DA SILVA, A.V. ; SOUZA, S. R. P. ; PIQUEIRA NETO, L. P. ; GONCALVES, N. V. ; POVOA, M. M. ; CARMO, E. L. . Surto de toxoplasmose aguda no Município de Ponta de Pedras, Arquipélago do Marajó, Estado do Pará, Brasil: características clínicas, laboratoriais e epidemiológicas. Revista Pan-Amazônica de Saúde (Online) , v. 7, p. 143-152, 2016.

  • MOTTA, RODRIGO GARCIA ; MOTTA, IGOR GARCIA ; MARTINEZ, ANTONIO CAMPANHA ; Da SILVA, A. V. ; PAES, ANTONIO CARLOS ; MARTINS, L. S. A. ; SILVA, RODRIGO COSTA DA ; RIBEIRO, MARCIO GARCIA . Unusual caudal vena cava thrombosis in a cow, secondary to Trueperella (Arcanobacterium) pyogenes infection. PESQUISA VETERINARIA BRASILEIRA , v. 36, p. 587-590, 2016.

  • RIBEIRO, L. A. ; SANTOS, L. K. N. S. S. ; BRITO JUNIOR, P. A. ; MACIEL, B. M. ; Da SILVA, A. V. ; ALBUQUERQUE, G. R. . Detection of Toxoplasma gondii DNA in Brazilian oysters (Crassostrea rhizophorae). Genetics and Molecular Research , v. 14, p. 4658-4665, 2015.

  • MOTTA, R. G. ; Da SILVA, A. V. ; GIUFFRIDA, R. ; SIQUEIRA, Amanda Keller ; PAES, A. C. ; MOTA, I. G. ; LISTONI, F.J.P. ; RIBEIRO, M.G. . Indicadores de qualidade e composição de leite informal comercializado na região Sudeste do Estado de São Paulo. Pesquisa Veterinária Brasileira (Online) , v. 35, p. 417-423, 2015.

  • von SOHSTEN, A. L. ; DA SILVA, A.V. . Toxocaríase humana: risco de infecção alimentar?. Veterinária e Zootecnia (UNESP) , v. 22, p. 501-512, 2015.

  • ARAÚJO, E. J. A. ; ZANIOLO, L. M. ; VICENTINO-VIEIRA, S. L. ; GOIS, M. B. ; Zanoni, J.N. ; Da SILVA, A. V. ; SANTANA, D.M.G. . Toxoplasma gondii causes death and plastic alteration in the jejunal myenteric plexus. World Journal of Gastroenterology , v. 21, p. 4788-4801, 2015.

  • MANGIA, S. ; MORAES, L. F. ; TAKAHIRA, R. K. ; MOTA, R. G. ; FRANCO, M. M. J. ; MEGID, J. ; DA SILVA, A.V. ; PAES, A. C. . Efeitos colaterais do uso da ribavirina, prednisona e DMSO em cães naturalmente infectados pelo vírus da cinomose. Pesquisa Veterinária Brasileira (Impresso) , v. 34, p. 449-454, 2014.

  • RIBEIRO, C. M. ; DA SILVA, A.V. ; PIZON, D. ; CASSOL, P. C. ; PIZZI, E. ; MACHADO, T. R. ; KATAGIRI, S. . Susceptibilidade à infecção por helmintos gastrintestinais em bovinos leiteiros da Mesorregião do Sudoeste Paranaense, Brasil. Veterinária e Zootecnia (UNESP) , v. 21, p. 154-159, 2014.

  • SAAB, A. B. ; ZAMPROGNA, T. O. ; LUCAS, T. M. ; MARTINI, K. C. ; MELLO, P. L. ; DA SILVA, A.V. ; MARTINS, L.A. . Prevalência e etiologia da mastite bovina em Nova Tebas - PR. Semina. Ciências Agrárias (Online) , v. 35, p. 835-843, 2014.

  • GERONIMO, E. ; GONCALVES, D. D. ; Da SILVA, A. V. ; EVERS, F. ; NINO, B. S. L. ; von SOHSTEN, A. L. ; NAVARRO, I. T. ; FREIRE, Roberta Lemos ; MOURA, R. A. ; MORI, F. M. R. L. . Leishmania spp. antibodies in stray dogs housed in a private shelter in the Northwest Region of Parana State, Brazil. African Journal of Microbiology Research , v. 8, p. 1995-1999, 2014.

  • FERNANDES, K. C. ; ALMEIDA, Rodrigo de ; MESSA, V. ; DA SILVA, A.V. . Contaminação por enteroparasitos em verduras de supermercados e feiras de Umuarama - PR. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR (Impresso) , v. 17, p. 115-119, 2014.

  • SILVA, J. S. ; CORREIA, J. E. ; DA SILVA, A.V. ; SANTANA, P. C. S. . Identificação de helmintos encontrados em uma estação de tratamento de esgoto de Feira de Santana, Bahia, Brasil. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR (Impresso) , v. 17, p. 37-42, 2014.

  • MAIOLINO, Sérgio Ricardo ; RIBEIRO, Marcio Garcia ; MOTTA RODRIGO GARCIA ; Da SILVA, A. V. ; MAIOLINO, G. S. ; LISTONI, Fernando José Paganini . Eficácia ?in vitro? e ?in vivo' da cefoperazona sódica, gentamcina e ciprofloxacino no tratamento intramamário da mastite clínica bovina. Veterinária e Zootecnia (UNESP) , v. 21, p. .-., 2014.

  • SIQUEIRA, Amanda Keller ; ALVES, T. S. ; FERRAZ, M. M. G. ; FRANCO, Marília M. Junqueira ; MOTTA RODRIGO GARCIA ; LISTONI, Fernando José Paganini ; Da SILVA, A. V. ; RIBEIRO, Marcio Garcia ; LEITE, Domingos da Silva . Resistência antimicrobiana em coliformes totais isolados de tanques de refrigeração de leite bovino. Atas de Saúde Ambiental , v. 2, p. 2-15, 2014.

  • FERNANDES, M. C. ; RIBEIRO, M.G. ; TAKAI, S. ; LEITE, D.S. ; PINTO, J. P. A. N. ; BRANDAO, P. E. ; SANTAREM, V. A. ; LISTONI, F.J.P. ; Da SILVA, A. V. . Identification of pathogens and virulence profile of Rhodococcus equi and Escherichia coli strains obtained from sand of parks. Brazilian Journal of Microbiology (Impresso) , v. 44, p. 485-492, 2013.

  • LANGONI, H. ; da Silva, Aristeu V. ; KATAGIRI, S. ; CAGNINI, F. ; RIBEIRO, C. M. . Infecção por Neospora caninum e suas implicações na performance reprodutiva de bovino leiteiros. Veterinária e Zootecnia (UNESP) , v. 20, p. 124-130, 2013.

  • LANGONI, H. ; DA SILVA, A.V. ; SEGISMUNDO, R. ; LUCHEIS, Simone Baldini ; PAES, A. C. . Variáveis epidemiológicas e alterações clínicas, hematológicas e urinárias em cães sororreagentes para Leptospira spp. Semina. Ciências Agrárias (Online) , v. 34, p. 765-776, 2013.

  • SHIMABUKURO, F.H. ; COSTA, V. M. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. ; CARVALHO, L. R. ; DOMINGUES, Paulo Francisco . Occurrence of prozone effect in microscopic agglutination test for leptospirosis in the serum of mice experimentally infected with pathogenic strain of Leptospira interrogans serovar Canicola. Memórias do Instituto Oswaldo Cruz (Impresso) , v. 108, p. 668-670, 2013.

  • SILVA, S. O. ; RICHTZENHAIN, L. J. ; BARROS, I. N. ; GOMES, A. M. ; DA SILVA, A.V. ; KOZERSKI, N. D. ; ARAÚJO, J. B. ; KEID, L. B. . A new set of primers directed to 18S rRNA gene for molecular identification of Cryptosporidium spp. and their performance in the detection and differentiation of oocysts shed by synanthropic rodents. Experimental Parasitology , v. 135, p. 551-557, 2013.

  • OLIVEIRA, J. L. P. ; KOZERSKI, N. D. ; SILVA, D. R. ; Da SILVA, A. V. ; MARTINS, L.A. . Fatores de risco para mastite e qualidade do leite no município de Altônia, Paraná. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR (Impresso) , v. 16, p. 61-72, 2013.

  • ARAÚJO, E.J.A. ; CABANAS, R. M. P. ; SANT'ANA, D. M. G. ; Da SILVA, A. V. . Myenteric neuronal plasticity induced by Toxoplasma gondii (genotype III) on the duodenum of rats. Anais da Academia Brasileira de Ciências (Impresso) , v. 84, p. 737-745, 2012.

  • Zaniolo, Larissa Marchi ; Da SILVA, A. V. ; de Mello Gonçales SantAna, Débora ; José de Almeida Araújo, Eduardo . Toxoplasma gondii infection causes morphological changes in caecal myenteric neurons. Experimental Parasitology , v. 130, p. 103-109, 2012.

  • LANGONI, H. ; CITADELLA, J. C. C. ; MACHADO, G. P. ; FACCIOLI, Patrícia Yoshida ; LUCHEIS, Simone Baldini ; Da SILVA, A. V. . Aspectos microbiolõgicos e citológicos do leite na mastite caprina subclínica. Veterinária e Zootecnia (UNESP) , v. 19, p. 815-822, 2012.

  • SANT'ANA, D. M. G. ; GOES, M. B. ; ZANONI, J. N. ; Da SILVA, A. V. ; SILVA, C. J. T. ; ARAÚJO, E. J. A. . Intraepithelial lymphocytes, goblet cells and VIP-IR submucosal neurons of jejunum rats infected with Toxoplasma gondii. International Journal of Experimental Pathology (Print) , v. 93, p. 279-286, 2012.

  • MELLO, P. L. ; AGOSTININ, R.O. ; BARZON, E. M. ; COLOMBO, R. B. ; Da SILVA, A. V. ; MARTINS, L.A. . Prevalência da mastite e associação dos agentes etiológicos com a contagem de células somáticas de vacas leiteiras da região Sudoeste do Paraná. Veterinária e Zootecnia (UNESP) , v. 19, p. 513-521, 2012.

  • SIQUEIRA, A. K. ; SALERMO, T. ; LARA, G. H. B. ; CONDAS, L. A. Z. ; LISTONI, F.J.P. ; PAES, A. C. ; Da SILVA, A. V. ; LEITE, D. S. ; RIBEIRO, M.G. . Indicadores de qualidade do leite bovino orgânico em duas propriedades leiteiras certificadas do Estado de São Paulo. Arquivos do Instituto Biológico (Online) , v. 79, p. 411-414, 2012.

  • SILVA, D. V. ; MARQUES, J. M. ; CORRÊA, N.B. ; VELAZQUES, L.G. ; da SILVA, R. C. ; LANGONI, H. ; von SOHSTEN, A. L. ; da Silva, Aristeu V. . Evaluation of modified agglutination test and enzyme-linked immunosorbent assay in detection of Toxoplasma gondii antibody in human sera. Arquivos de Ciências da Saúde da UNIPAR (Impresso) , v. 16, p. 17-20, 2012.

  • KOZERSKI, N. D. ; CALDATO, L. D. ; ARAÚJO, J. B. ; MESSA, V. ; von SOHSTEN, A. L. ; SILVA, A. V. . Occurrence of Cryptosporidum sp in sinantropic Rattus Fischer, 1803 and Mus Linnaeus, 1758 captured in the urban area of Umuarama, PR, Brazil. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR (Impresso) , v. 15, p. 133-136, 2012.

  • MARTINS, A. A. ; ZAMPROGNA, T. O. ; LUCAS, T. M. ; CUNHA, I. A. L. ; GARCIA, J. L. ; SILVA, A. V. . Frequency and risk factors for neosporosis in dairy farms of Umuarama, PR, Brazil. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR (Impresso) , v. 15, p. 137-142, 2012.

  • PIAU JÚNIOR, R. ; MENDEZ, L. D. V. ; VALENTIM-ZABOTT, M. ; RIBEIRO, R. P. ; Da SILVA, A. V. ; OTUTUMI, LUCIANA KAZUE . Morphometry of white muscle fibers and performance of Nile tilapia (Oreochromis niloticus) fingerlings treated with methyltestosterone or a homeopathic complex. Homeopathy (Edinburgh. Print) , v. 101, p. 154-158, 2012.

  • ALMEIDA, P. H. A. ; SANTANA, P. C. S. ; DA SILVA, A.V. . Prevalência de protozoários e helmintos entéricos em residentes de São Cristóvão, Feira de Santana, Bahia, Brasil. Arquivos de Ciências da Saúde da UNIPAR (Impresso) , v. 16, p. 61-66, 2012.

  • HERMES-ULIANA, C. ; PEREIRA-SEVERI, L.S. ; LUERDES, R.B. ; FRANCO, C. L. M. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Chronic infection with Toxoplasma gondii causes myenteric neuroplasticity of the jejunum of rats. Autonomic Neuroscience: Basic & Clinical , v. 160, p. 3-8, 2011.

  • LIMA, V. Y. ; LANGONI, H. ; Da SILVA, A. V. ; PEZERICO, S.B. ; CASTRO, A. P. B. C. ; da SILVA, R. C. ; ARAUJO JUNIOR, J. P. . Chlamydophila psittaci and Toxoplasma gondii infection in pigeons (Columba livia) from São Paulo State, Brazil. Veterinary Parasitology (Print) , v. 175, p. 9-14, 2011.

  • da SILVA, R. C. ; LANGONI, H. ; SU, C. ; Da SILVA, A. V. . Genotypic characterization of Toxoplasma gondii in sheep from Brazilian slaughterhouses: New atypical genotypes and the clonal type II strain identified. Veterinary Parasitology (Print) , v. 175, p. 173-177, 2011.

  • Soares, R.M. ; SILVEIRA, L. H. ; Da SILVA, A. V. ; RAGOZO, A. ; GALLI, S. ; LOPES, E. G. ; GENNARI, S.M. ; PENA, H. F. J. . Genotyping Toxoplasma gondii isolates of free range chickens from Pantanal area from Brazil. Veterinary Parasitology (Print) , v. 178, p. 29-34, 2011.

  • ARAUJO, D. A. ; Da SILVA, A. V. ; ZANETTE, D. F. ; SILVA, D. R. ; CORRÊA, N.B. ; VELAZQUES, L.G. ; PINTO NETO, A. . Investigação dos fatores associados à infecção pelo Toxoplasma gondii em cães e seres humanos de Porto Figueira, PR. Veterinária e Zootecnia (UNESP) , v. 18, p. 98-111, 2011.

  • RIBEIRO, M.G. ; TAKAI, S. ; GUAZZELLI, A. ; LARA, G. H. B. ; Da SILVA, A. V. ; FERNANDES, M. C. ; CONDAS, L. A. Z. ; SIQUEIRA, A. K. ; Salerno, Tatiana . Virulence genes and plasmid profiles in Rhodococcus equi isolates from domestic pigs and wild boars (Sus scrofa) in Brazil. Research in Veterinary Science , v. 91, p. 478-481, 2011.

  • RIBEIRO, M.G. ; TAKAI, S. ; VARGAS, A. C. ; GUARALDI, A. L. M. ; CARMELO, T. C. F. ; OHNO, R. ; OKANO, H. ; Da SILVA, A. V. . Identification of virulence?associated plasmids in Rhodococcus equi from humans with and without acquired immune deficiency syndrome in Brazil. The American Journal of Tropical Medicine and Hygiene , v. 85, p. 510-513, 2011.

  • CAMOSSI, L.G. ; GRECCA JÚNIOR, H. ; CORREA, A. P. F. L. ; Richini-Pereira, Virginia B. ; da SILVA, R. C. ; Da SILVA, A. V. ; LANGONI, H. . Detection of Toxoplasma gondii DNA in the milk of naturally infected ewes. Veterinary Parasitology (Print) , v. 177, p. 256-261, 2011.

  • BRAGA, C.F. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Infecção toxoplásmica causa hipertrofia da parede do cólon de frangos. Arquivo Brasileiro de Medicina Veterinária e Zootecnia (Online) , v. 63, p. 340-347, 2011.

  • ALVES, M. S. ; Da SILVA, A. V. ; BIANCHI, L. R. O. ; ARAÚJO, E. J. A. ; Sant'Ana, Débora de Mello Gonçales . Toxoplasma gondii induces death of gastric myenteric neurons in rats. International Journal of Morphology (Online) , v. 29, p. 293-298, 2011.

  • ASSIS, A.C.B. ; Da SILVA, A. V. ; Silva, Rodrigo Costa da ; da SILVA, R. C. ; LANGONI, H. . Comparação da PCR, baciloscopia e cultura no diagnóstico da tuberculose humana. Veterinária e Zootecnia (UNESP) , v. 18, p. 384-392, 2011.

  • Silva, Lilia Simeire ; Sartori, Ana Lúcia ; Zaniolo, Larissa Marchi ; da Silva, Aristeu Vieira ; de Mello Gonçales SantAna, Débora ; de Almeida Araújo, Eduardo José ; Da SILVA, A. V. . Toxoplasma gondii: myenteric neurons of intraperitoneally inoculated rats show quantitative and morphometric alterations. Experimental Parasitology , v. 129, p. 5-10, 2011.

  • ZANETTE, D. F. ; PINTO NETO, A. ; Da SILVA, A. V. ; MARTINS, L.A. . Detecção de anticorpos anti-Brucella abortus em cães da comunidade Porto Camargo ? PR. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR (Impresso) , v. 14, p. 41-44, 2011.

  • LANGONI, H. ; BASTOS, V. S. M. ; LIMA, V. Y. ; Da SILVA, A. V. ; da SILVA, R. C. . Ação do diazepam(R) frente a infecção experimental com Leptospira interrogans sorovar Pomona em hamster (Mesocricetus auratus). Veterinária e Zootecnia (UNESP) , v. 18, p. 640-652, 2011.

  • LANGONI, H. ; SAKIYAMA, D. T. P. ; GUIMARAES, F. F. ; CAMOSSI, L.G. ; Da SILVA, A. V. . Contagem de células somáticas e de microrganismos mesófilos aeróbios em leite crú orgânico produzido em Botucatu (SP). Veterinária e Zootecnia (UNESP) , v. 18, p. 653-660, 2011.

  • CORRÊA, N.B. ; VELAZQUES, L.G. ; MARQUES, J. M. ; Da SILVA, A. V. . Levantamento soroepidemiológico da leishmaniose tegumentar e doença de chagas em uma comunidade rural da região sul do Estado do Mato Grosso do Sul - Brasil. Arquivos de Ciências da Saúde da UNIPAR (Impresso) , v. 15, p. 23-28, 2011.

  • ROSA, R. C. ; MATTEI, R. J. ; da SILVA, R. C. ; MERLINI, L. S. ; LANGONI, H. ; Da SILVA, A. V. . Anticorpos anti-Toxoplasma gondii em suínos criados em granjas de elevado e baixo padrão sanitário no noroeste do Paraná. Revista Acadêmica: Ciências Agrárias e Ambientais (PUCPR. Impresso) , v. 9, p. 1-4, 2011.

  • SILVA, D. R. ; PINTO NETO, A. ; Da SILVA, A. V. ; MARTINS, L.A. . Detecção de anticorpos anti-Brucella abortus em humanos na cidade ribeirinha de Porto Figueira - Paraná. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR (Impresso) , v. 14, p. 37-39, 2011.

  • MACHADO, J.G. ; HOFFMANN, J.L. ; KRAUSE, V.L.K. ; Da SILVA, A. V. ; DIAS-MELICIO, L.A. ; LANGONI, H. . Cell-mediated immune response to Leishmania chagasi experimental infection of BALB/c immunosuppressed mice. The Journal of Venomous Animals and Toxins Including Tropical Diseases (Online) , v. 16, p. 131-146, 2010.

  • da SILVA, R. C. ; LIMA, V. Y. ; TANAKA, E. M. ; Da SILVA, A. V. ; SOUZA, L. C. ; LANGONI, H. . Risk factors and presence of antibodies to Toxoplasma gondii in dogs from the coast of São Paulo State, Brazil. Pesquisa Veterinária Brasileira (Impresso) , v. 30, p. 161-166, 2010.

  • Da SILVA, A. V. ; da SILVA, R. C. ; LUCAS, T. M. ; ZAMPROGNA, T. O. . Toxoplasma gondii em suínos com ênfase na contribuição brasileira. Scientia Medica (Porto Alegre. Online) , v. 20, p. 120-130, 2010.

  • ODORIZZI, L. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. ; MOREIRA, N. M. ; GONÇALVES, G.F. ; Da SILVA, A. V. . Quantitative and morphometric changes of subpopulations of myenteric neurons in swines with toxoplasmosis. Autonomic Neuroscience: Basic & Clinical , v. 155, p. 68-72, 2010.

  • SILVA, J. M. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Efeitos da infecção crônica por Toxoplasma gondii sobre a parede intestinal de gatos domésticos. Revista Brasileira de Parasitologia Veterinária , v. 19, p. 1-7, 2010.

  • Salerno, Tatiana ; RIBEIRO, M.G. ; LANGONI, H. ; SIQUEIRA, A. K. ; COSTA, E.O. ; Melville, Priscilla Anne ; BUENO, V.F.F. ; YAMAMURA, A. A. M. ; Roesler, Uwe ; Silva, Aristeu Vieira da . In vitro algaecide effect of sodium hypochlorite and iodine based antiseptics on Prototheca zopfii strains isolated from bovine milk. Research in Veterinary Science , v. 88, p. 211-213, 2010.

  • SILVA, P.C. ; ARAÚJO, E. J. A. ; SHIRAISHI, C. S. ; Da SILVA, A. V. ; GONÇALVES, G.F. ; SANT'ANA, D. M. G. . Toxoplasma gondii: a morphometric analysis of the wall and epithelial cells of pigs intestine. Experimental Parasitology (Online) , v. 125, p. 380-383, 2010.

  • PEREIRA, L.S. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Hypertrophy of NADH-diaphorase positive myenteric neurons in rat jejunum after acute infection caused by Toxoplasma gondii. The Journal of Venomous Animals and Toxins Including Tropical Diseases (Online) , v. 16, p. 298-310, 2010.

  • CAMOSSI, L.G. ; Silva, A.V. ; LANGONI, H. . Inquérito sorológico para toxoplasmose em equinos na região de Botucatu-SP. Arquivo Brasileiro de Medicina Veterinária e Zootecnia (Online) , v. 62, p. 484-488, 2010.

  • Silva, Rodrigo C. da ; Silva, Aristeu V. da ; LANGONI, H. . Recrudescence of Toxoplasma gondii infection in chronically infected rats (Rattus norvegicus). Experimental Parasitology , v. 125, p. 409-412, 2010.

  • SANTAREM, V. A. ; DIAS, A.P. ; FELIX, A. ; RODENAS, R. S. ; Da SILVA, A. V. . Contaminação por ovos de Toxocara spp. em praças públicas das regiões central e periurbana de Mirante do Paranapanema, São Paulo, Brasil. Veterinária e Zootecnia (UNESP) , v. 17, p. 47-53, 2010.

  • AIGNER, C.P. ; Da SILVA, A. V. ; SANDRINI, F. ; OSORIO, P. S. ; POIARES, L. ; LARGURA, A. . Real-time PCR based quantification of Toxoplasma gondii in tissue samples of serologically positive outdoor chicken. Memórias do Instituto Oswaldo Cruz (Online) , v. 105, p. 935-937, 2010.

  • PIASSA, F.R. ; ARAÚJO, J. B. ; ROSA, R. C. ; MATTEI, R. J. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Prevalence and risk factors fro Toxoplasma gondii infection in certified and non-certified pig breeding farms in the Toledo microrregion, PR, Brazil. Revista Brasileira de Parasitologia Veterinária (Impresso) , v. 19, p. 152-157, 2010.

  • BONAPAZ, R. S. ; HERMES, C. ; SANTOS, F. N. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Effects of infection with Toxoplasma gondii oocysts on the intestinal wall and the myenteric plexus of chicken (Gallus gallus). Pesquisa Veterinária Brasileira (Impresso) , v. 30, p. 787-792, 2010.

  • ARAÚJO, J. B. ; da Silva, Aristeu V. ; Rosa, Ronaldo C. ; Mattei, Rodrigo J. ; da SILVA, R. C. ; Richini-Pereira, Virginia B. ; LANGONI, H. . Isolation and multilocus genotyping of Toxoplasma gondii in seronegative rodents in Brazil. Veterinary Parasitology (Print) , v. 174, p. 328-331, 2010.

  • LARA, G. H. B. ; Ribeiro, Márcio Garcia ; LEITE, C. Q. F. ; Paes, Antonio Carlos ; GUAZZELLI, A. ; Silva, Aristeu Vieira da ; Santos, Adolfo Carlos Barreto ; LISTONI, F. J. P. . Occurrence of Mycobacterium spp. and other pathogens in lymph nodes of slaughtered swine and wild boars (Sus scrofa). Research in Veterinary Science , v. 90, p. 185-188, 2010.

  • BALDINI-PERUCA, L. C. ; DEFFUNE, E. ; Da SILVA, A. V. ; LANGONI, H. . Soroepidemiologia da toxoplasmose em doadores de sangue do Hemocentro, Hospital das Clínicas da Faculdade de Medicina, Botucatu, São Paulo. Veterinária e Zootecnia (UNESP) , v. 17, p. 399-406, 2010.

  • GAZIM, Z. C. ; FERREIRA, F. B. P. ; Da SILVA, A. V. ; BOLOGNESE, K. C. ; MERLIN, E. ; MESSA, V. ; JESUS, R. A. ; COUTINHO, C. A. ; SILVA, L. C. M. . Efficiency study of the tick biotherapic in the infestation control of Rhipicephalus (boophilus) microplus on dairy cows of the dutch race. International Journal of High Dilution Research , v. 9, p. 156-164, 2010.

  • LUCACIN, E. ; PINTO-NETO, A. ; MOTA, M.F. ; ACCO, A. ; SOUZA, M.I.L. ; ALBERTON, J. ; DA SILVA, A.V. . Effects of flunixin meglumine on reproductive parameters in beef cattle. Animal Reproduction , v. 7, p. 75-79, 2010.

  • GRECCA JÚNIOR, H. ; DA SILVA, A.V. ; LANGONI, H. . AssociaÃÃo entre a presenÃa de anticorpos anti-Leishmania sp. e anti-Neospora caninum em cÃes de Bauru, SP. Arquivo Brasileiro de Medicina Veterinária e Zootecnia , v. 62, p. 224-227, 2010.

  • Da SILVA, A. V. ; GONÇALVES, G.F. ; LÍVERO, F.A.R. ; BOTTIN, J.M.P. ; BELINATO, F. C. ; BASTOS JÚNIOR, E.A. ; da SILVA, R. C. ; LANGONI, H. . Avaliação de fatores epidemiológicos na ocorrência de anticorpos anti-Toxoplasma gondii em cães atendidos em um Hospital Universitário. Veterinária e Zootecnia , v. 16, p. 239-247, 2009.

  • SIQUEIRA, A. K. ; Ribeiro, Marcio G. ; LEITE, D. S. ; TIBA, M.R. ; Moura, Claudia de ; LOPES, M. D. ; Prestes, Nereu Carlos ; Salerno, Tatiana ; Da SILVA, A. V. . Virulence factors in Escherichia coli strains isolated from urinary tract infection and pyometra cases and from feces of healthy dogs. Research in Veterinary Science , v. 86, p. 206-210, 2009.

  • SUGAUARA, E.Y.Y. ; SANT'ANA, D. M. G. ; Da SILVA, A. V. ; SOUZA, E. A. ; ARAÚJO, E. J. A. . Hypertrophy of the neurons in the ileum from rats infected with cysts of Toxoplasma gondii (Genotype II). Acta Scientiarum. Biological Sciences (Online) , v. 31, p. 195-201, 2009.

  • PINHEIRO JUNIOR, J. W. ; MOTA, R. A. ; OLIVEIRA, A. A. F. ; FARIA, E. B. ; GONDIM, L. F. P. ; Da SILVA, A. V. ; ANDERLINI, G. A. . Prevalence and risk factors associated to infection by Toxoplasma gondii in ovine in the State of Alagoas, Brazil. Parasitology Research , v. 105, p. 709-715, 2009.

  • Shiraishi, Celina Sayuri ; AZEVEDO, J.F. ; Silva, Aristeu Vieira da ; Sant&amp ; ARAÚJO, E.J.A. . Análise morfométrica da parede intestinal e dinâmica de mucinas secretadas no íleo de frangos infectados por Toxoplasma gondii. Ciência Rural (UFSM. Impresso) , v. 39, p. 2146-2153, 2009.

  • SOARES, J. ; MOREIRA, N. M. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Infecção crônica por Toxoplasma gondii induzindo a hipertrofia de neurônios do plexo mientérico do cólon descendente de Rattus norvegicus. Revista Brasileira de Parasitologia Veterinária , v. 18, p. 57-60, 2009.

  • Pezerico, Sandia B. ; LANGONI, H. ; Da SILVA, A. V. ; da SILVA, R. C. . Evaluation of Toxoplasma gondii placental transmission in BALB/c mice model. Experimental Parasitology , v. 123, p. 168-172, 2009.

  • BOTTIN, J.M.P. ; BASTOS JÚNIOR, E.A. ; LUCAS, T. M. ; ZAMPROGNA, T. O. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Comparação da formação de cistos teciduais, peso de órgãos e cinética de anticorpos em camundongos Swiss inoculados com Toxoplasma gondii. Veterinária e Zootecnia (UNESP) , v. 16, p. 519-527, 2009.

  • MARQUES, J. M. ; ISBRESCHT, F.B. ; LUCAS, T. M. ; GUERRA, I.M.G. ; DALMOLIN, A. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Detecção de anticorpos anti-Toxoplasma gondii em animais de uma comunidade rural do Mato Grosso do Sul, Brasil. Semina. Ciências Agrárias (Online) , v. 30, p. 909-918, 2009.

  • LINDE, G. A. ; MESSA, V. ; CUNHA JÚNIOR, P.L. ; Da SILVA, A. V. ; EIRA, A. F. ; COLAUTO, Nelson Barros . Antineoplasic activity of Agaricus brasiliensis basidiocarps on different maturation phases. Brazilian Journal of Microbiology (Impresso) , v. 40, p. 901-905, 2009.

  • LANGONI, H. ; LAURINO, F. ; FACCIOLI, P. Y. ; Da SILVA, A. V. ; MENOZZI, B. D. . Cultivo microbiológico e a sensibilidade no isolamento de patógenos nas mastites bovinas. Veterinária e Zootecnia (UNESP) , v. 16, p. 708-715, 2009.

  • BARBOSA, B. J. P. ; ARAÚJO, E. J. A. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. . Atrofia neuronal mientérica do íleo de ratos infectados cronicamente por uma cepa genótipo I de Toxoplasma gondii. Arquivos de Ciências Veterinárias e Zoologia da Unipar , v. 12, p. 101-108, 2009.

  • DIAS, L. S. ; SANTAREM, V. A. ; ALMEIDA, M. S. R. ; Da SILVA, A. V. . Biodiversidade de moscas Calliphoridae no lixão urbano de Presidente Prudente, São Paulo, Brasil. Arquivos do Instituto Biológico (Online) , v. 76, p. 659-663, 2009.

  • NOBREGA, D. B. ; LANGONI, H. ; JOAQUIM, J. G. F. ; Da SILVA, A. V. ; FACCIOLI, Patrícia Yoshida ; MATOS, A. V. R. ; MENOZZI, B. D. . Utilização de composto homeopático no tratamento da mastite bovina. Arquivos do Instituto Biológico (Online) , v. 76, p. 523-537, 2009.

  • Da SILVA, A. V. ; SILVA, A. W. T. ; ARAUJO, D. A. ; VELAZQUES, L.G. ; CORRÊA, N.B. . Soroepidemiologia da Doenças de Chagas no Porto Figueira, Distrito de Alto Paraíso, PR. Arquivos de Ciências da Saúde da UNIPAR (Impresso) , v. 13, p. 211-215, 2009.

  • PINTO NETO, A. ; LUCCA, F. M. ; ALBERTON, J. ; MOTA, M. F. ; LUCACIN, E. ; MAIA, A.B. ; ACCO, A. ; FONSECA, J F ; SILVA FILHO, J. M. ; Da SILVA, A. V. ; BRANDAO, F. Z. . Avaliação do uso do flunixim meglumine sobre a concentração sérica de progesterona e ciclo estral. Revista Brasileira de Ciência Veterinária , v. 15, p. 10-14, 2008.

  • Pupo, S.C. ; DAVINSON, G. P. ; MARTNEZ-SANCHEZ, G. ; TAKEMURA, O.S. ; Da SILVA, A. V. ; GONÇALVES, G.F. ; DELAPORTE, Rosemeres Horwat . Avaliação da atividade antiinflamatória crônica do extrato etanólico de Bouchea fluminensis ? VERBENACEAE. Acta Farmaceutica Bonaerense , v. 27, p. 364-368, 2008.

  • GONÇALVES, G.F. ; PIPPI, Ney Luis ; LEME, M. C. ; CUSTÓDIO, A. P. ; Da SILVA, A. V. ; ROMAGNOLLI, P. ; PACHALY, J.R. ; BOTTIN, J.M.P. ; LÍVERO, F.A.R. . Correlação entre a pressão arterial média e o fluxo sangüíneo na artéria oftálmica externa em gatos (Felis catus Linnaeus, 1758). Brazilian Journal of Veterinary Research and Animal Science , v. 45, p. 57-66, 2008.

  • Da SILVA, A. V. ; BOARETO, H. ; ISBRESCHT, F.B. ; da SILVA, R. C. ; LANGONI, H. . Ocorrência de anticorpos anti-Toxoplasma gondii em suínos da região Oeste do Paraná, Brasil. Veterinária e Zootecnia , v. 15, p. 263-266, 2008.

  • SIQUEIRA, A. K. ; Ribeiro, M.G. ; Salerno, T. ; Takahira, R.K. ; LOPES, M. D. ; Prestes, N.C. ; Silva, A.V. . Perfil de sensibilidade e multirresistência em linhagens de Escherichia coli isoladas de infecção do trato urinário, de piometra e de fezes de cães. Arquivo Brasileiro de Medicina Veterinária e Zootecnia , v. 60, p. 1263-1266, 2008.

  • SUGAUARA, E.Y.Y. ; Sant'Ana, Débora de Mello Gonçales ; ALMEIDA, E.C. ; Reis, Anderson Brunetti ; Silva, Aristeu Vieira da ; ARAÚJO, E.J.A. . Alterations of the myenteric plexus of the ileum and the descending colon caused by Toxoplasma gondii (genotype III). Arquivos de Neuro-Psiquiatria , v. 66, p. 516-523, 2008.

  • GALLI, S. ; BELINATO, F. C. ; LUCAS, T. M. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Infecção experimental de frangos domésticos (Gallus gallus) com cepas geneticamente distintas de Toxoplasma gondii. Veterinária e Zootecnia , v. 15, p. 542-550, 2008.

  • LANGONI, H. ; SOUZA, L.C. ; Da SILVA, A. V. ; CUNHA, E.L.P. ; da SILVA, R. C. . Epidemiological aspects in leptospirosis. Research of anti-Leptospira spp antibodies, isolation and biomolecular research in bovines, rodents and workers in rural properties from Botucatu, SP, Brazil. Brazilian Journal of Veterinary Research and Animal Science , v. 45, p. 190-199, 2008.

  • MARQUES, J. M. ; SILVA, D. V. ; CORRÊA, N.B. ; VELAZQUES, L.G. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Prevalence and risk factors for human toxoplasmosis in a rural community. The Journal of Venomous Animals and Toxins Including Tropical Diseases (Online) , v. 14, p. 673-684, 2008.

  • Da SILVA, A. V. ; LANGONI, H. ; PEZERICO, S.B. ; LIMA, V. Y. . Utilization of modified agglutination test and indirect immunofluorescent antibody test for the detection of Toxoplasma gondii antibodies in naturally exposed horses. Brazilian Journal of Veterinary Research and Animal Science , v. 44, p. 27-32, 2007.

  • MANZANO, M. A. ; PACHALY, J.R. ; Da SILVA, A. V. ; MAJCZAK, K. H. ; CIFFONI, E.M.G. . A eutanásia animal na visão de estudantes de Medicina Veterinária e Ciências Biológicas. Revista Brasileira de Ciência Veterinária , v. 14, p. 155-158, 2007.

  • LANGONI, H. ; PEZERICO, S.B. ; da SILVA, R. C. ; CASTRO, A. P. B. C. ; Da SILVA, A. V. ; PADOVANI, C. R. . Serological profile of anti-Toxoplasma gondii antibodies in apparently healthy dogs of the city of Botucatu, SP, Brazil. Journal of Venomous Animals and Toxins Including Tropical Diseases (Online) , Botucatu, SP, Brazil, v. 12, n.1, p. 142-148, 2006.

  • LANGONI, H. ; DORES, C. B. ; da SILVA, R. C. ; PEZERICO, S.B. ; CASTRO, A. P. B. C. ; Da SILVA, A. V. . Detection of DNA of Toxoplasma gondii in sera samples of mice experimentally infected. Journal of Venomous Animals and Toxins Including Tropical Diseases (Online) , Botucatu, v. 12, n.2, p. 202-214, 2006.

  • Da SILVA, A. V. ; GIMENES BOSCO, S.M. ; LANGONI, H. ; BAGAGLI, E. . Study of Toxoplasma infection in Brazilian wild mammals: serological evidence in Dasypus novemcinctus Linnaeus, 1758 and Euphractus sexcinctus Wagler, 1830. Veterinary Parasitology , Holanda, v. 135, n.1, p. 81-83, 2006.

  • MORETTI, L. D. ; Silva, Aristeu Vieira da ; RIBEIRO, M.G. ; Paes, Antonio Carlos ; LANGONI, H. . Toxoplasma gondii genotyping in a dog co-infected with distemper virus and ehrlichiosis rickettsia. Revista do Instituto de Medicina Tropical de São Paulo , v. 48, p. 359-363, 2006.

  • SEVÁ, A. P. ; da SILVA, R. C. ; Da SILVA, A. V. ; CASTRO, A. P. B. C. ; MENOZZI, B. D. ; LANGONI, H. . Avaliação da virulência de cepas de Toxoplasma gondii em camundongos, isoladas de cães com sinais neurológicos, em Botucatu, SP. Veterinária e Zootecnia , v. 13, p. 33-43, 2006.

  • Da SILVA, A. V. ; PEZERICO, S.B. ; LIMA, V. Y. ; MORETTI, L. D. ; PINHEIRO, J. P. ; TANAKA, E. M. ; RIBEIRO, M.G. ; LANGONI, H. . Genotyping of Toxoplasma gondii strains isolated from dogs with neurological signs. Veterinary Parasitology (Print) , Amsterdam, v. 127, p. 23-27, 2005.

  • LIMA, K. C. ; MEGID, J. ; Da SILVA, A. V. ; CORTEZ, A. . The heminested RT-PCR for the study of rabies virus pathogenesis. Journal of Virological Methods , Amsterdam, v. 124, p. 79-85, 2005.

  • LUCHEIS, Simone Baldini ; Da SILVA, A. V. ; ARAÚJO JÚNIOR, J.P. ; LANGONI, H. ; MEIRA, D.A. ; MARCONDES-MACHADO, J. . Trypanosomatids in dogs belonging to individuals with chronic Chagas disease living in the town of Botucatu and surrounding region, state of São Paulo, Brazil. Journal of Venomous Animals and Toxins Including Tropical Diseases (Online) , Botucatu, SP, Brazil, v. 11, n.4, p. 492-509, 2005.

  • Da SILVA, A. V. ; MENDONÇA, A.O. ; PEZERICO, S.B. ; DOMINGUES, Paulo Francisco ; LANGONI, H. . Genotyping of Toxoplasma gondii strains detected in pork sausage. Parasitología Latinoamericana (En línea) , Santiago, v. 60, n.1-2, p. 65-68, 2005.

  • CAPORALI, E.H.G. ; Da SILVA, A. V. ; MENDONÇA, A.O. ; LANGONI, H. . Comparação de métodos para determinação da prevalência de anticorpos anti-Toxoplasma gondii em suínos dos estados de São Paulo e Pernambuco - Brasil. Arquivos de Ciências Veterinárias e Zoologia da Unipar , Umuarama, v. 8, n.1, p. 19-24, 2005.

  • Da SILVA, A. V. ; LANGONI, H. . Kinetics of serum antibody in Rattus norvegicus experimentally infected with genetically distinct strains of Toxoplasma gondii bradyzoites.. Veterinária e Zootecnia (UNESP) , Botucatu, v. 12, n.1/2, p. 69-76, 2005.

  • VICTÓRIA, C. ; Da SILVA, A. V. ; ELIAS, A. O. ; LANGONI, H. . Corynebacterium bovis e os padrões de contagem de células somáticas no Brasil.. Arquivos de Ciências Veterinárias e Zoologia da Unipar , Umuarama, v. 8, n.2, p. 161-164, 2005.

  • PREVIATO, P F G ; PINTO NETO, A. ; WERNER, Pedro R ; ACCO, A. ; MOTA, M. F. ; Da SILVA, A. V. ; FONSECA, J F . Alterações morfológicas nos órgãos genitais de cães e gatos provenientes de Vilas Rurais da região de Umuarama - PR. Arquivos de Ciências Veterinárias e Zoologia da Unipar , Umuarama, v. 8, n.2, p. 105-110, 2005.

  • ELIAS, A. O. ; VICTÓRIA, C. ; Da SILVA, A. V. ; LANGONI, H. . Características físico-químicas e contagem de células somáticas de leite proveniente de vacas naturalmente infectadas por Streptococcus spp. Arquivos de Ciências Veterinárias e Zoologia da Unipar , Umuarama, v. 8, n.2, p. 165-170, 2005.

  • GONÇALVES, G.F. ; PIPPI, Ney Luis ; LEME, M. C. ; CUSTÓDIO, A. P. ; FACHIN, L. ; LAGO, E. ; Da SILVA, A. V. ; PACHALY, J.R. . Fluxometria eco-power-doppler da artéria oftálmica externa em gatos (Felis catus Linnaeus, 1758). Arquivos de Ciências Veterinárias e Zoologia da Unipar , Umuarama, v. 8, n.2, p. 117-124, 2005.

  • MENDONÇA, A.O. ; DOMINGUES, Paulo Francisco ; Da SILVA, A. V. ; PEZERICO, S.B. ; LANGONI, H. . Detection of Toxoplasma gondii in swine sausage. Parasitología Latinoamericana (En línea) , Santiago, v. 59, n.1-2, p. 42-45, 2004.

  • CABRAL, K.G. ; LAMMLER, C. ; ZSCHOCK, M ; LANGONI, H. ; SÁ, M. E. P. ; VICTÓRIA, C. ; Da SILVA, A. V. . Pheno and genotyping of Staphylococcus aureus isolated from bovine milk samples from São Paulo State, Brazil. Canadian Journal of Microbiology , Ottawa, v. 50, n.11, p. 901-909, 2004.

  • RIBEIRO, M.G. ; SIQUEIRA, A K ; LANGONI, H. ; PAES, A. C. ; VICTÓRIA, C. ; Da SILVA, A. V. ; LISTONI, F.J.P. ; SOUZA, A H . Modified E-test by the addition of EDTA-Tris and dimethyl sulfoxide-DMSO on the potentiation of the effects of some antimicrobials in Pseudomonas aeruginosa strains isolated from bovine mastitis. Arquivo Brasileiro de Medicina Veterinária e Zootecnia , Belo Horizonte, v. 56, n.5, p. 676-678, 2004.

  • LANGONI, H. ; LINHARES, A. C. ; AVILA, F. A. ; Da SILVA, A. V. ; ELIAS, A. O. . Contribution to the study of diarrhea etiology in neonate dairy calves in São Paulo state, Brazil. Brazilian Journal of Veterinary Research and Animal Science , São Paulo, v. 41, p. 313-319, 2004.

  • CUNHA, E.L.P. ; da SILVA, R. C. ; Da SILVA, A. V. ; LANGONI, H. . The protective action of BaypamunHK in mice inoculated with Toxoplasma gondii. Brazilian Journal of Veterinary Research and Animal Science , São Paulo, v. 41, n.3, p. 169-172, 2004.

  • LANGONI, H. ; Da SILVA, A. V. ; PEZERICO, S.B. ; LIMA, V. Y. . Anti-leptospire agglutninins in equine sera from Sao Paulo, Goias and Mato Grosso do Sul, Brazil, 1996-2001.. Journal of Venomous Animals and Toxins Including Tropical Diseases (Online) , Botucatu, v. 10, n.4, p. 207-218, 2004.

  • Da SILVA, A. V. ; CUNHA, E.L.P. ; LANGONI, H. ; MOTA, R. A. ; MEIRELLES, L.R. ; GOTTSCHALK, S. . Toxoplasmose em ovinos e caprinos: Estudo soroepidemiológico em duas regiões do Estado de Pernambuco, Brasil. Ciência Rural , Santa Maria, v. 33, n.1, p. 115-119, 2003.

  • SHIMABUKURO, F.H. ; DOMINGUES, Paulo Francisco ; LANGONI, H. ; Da SILVA, A. V. ; PINHEIRO, J. P. ; PADOVANI, C. R. . Pesquisa de suínos portadores renais de leptospiras pelo isolamento microbiano e reação em cadeia pela polimerase em amostras de rins de animais sorologicamente positivos e negativos para leptospirose. Brazilian Journal of Veterinary Research and Animal Science , São Paulo, v. 40, p. 243-253, 2003.

  • BRITO, A. F. ; SOUZA, L.C. ; Da SILVA, A. V. ; LANGONI, H. . Epidemiological and serological aspects in canine toxoplasmosis in animals with nervous symptoms. Memórias do Instituto Oswaldo Cruz , Rio de Janeiro, v. 97, n.1, p. 31-35, 2002.

  • PIMENTEL, V. L. ; LANGONI, H. ; LUCHEIS, Simone Baldini ; Da SILVA, A. V. ; DENARDI, M. B. . Avaliação da dinâmica de anticorpos aglutinantes antileptospíricos, pós-vacinais, em cães pela prova de soroalgutinação microscópica. ARS Veterinária , Jaboticabal, v. 18, n.1, p. 54-61, 2002.

  • Da SILVA, A. V. ; CUTOLO, A. A. ; LANGONI, H. . Comparação da reação de imunofluorescência indireta e do método de aglutinação direta na detecção de anticorpos anti-toxoplasma em soros de ovinos, caprinos, caninos e felinos. Arquivos do Instituto Biológico (Impresso) , São Paulo, v. 69, n.1, p. 7-11, 2002.

  • MORETTI, L. D. ; UENO, T. E. ; RIBEIRO, M.G. ; AGUIAR, D. M. ; PAES, A. C. ; PEZERICO, S.B. ; Da SILVA, A. V. . Toxoplasmose em cães co-infectados com o vírus da cinomose. Semina (Londrina) , Londrina, v. 23, n.1, p. 97-100, 2002.

  • MARINHO, M. ; BALDINI, Simone ; Da SILVA, A. V. ; LISTONI, F.J.P. ; LANGONI, H. . Ação in vitro da enrofloxacina em microrganismos isolados de leite mastítico da região de Botucatu - SP. ARS Veterinária , Jaboticabal, v. 18, n.2, p. 120-124, 2002.

  • LANGONI, H. ; Da SILVA, A. V. ; CABRAL, K.G. ; CUNHA, E.L.P. ; CUTOLO, A. A. . Prevalência de toxoplasmose em gatos dos Estados de São Paulo e Paraná. Brazilian Journal of Veterinary Research and Animal Science , São Paulo, v. 38, n.5, p. 243-244, 2001.

  • Da SILVA, A. V. ; LANGONI, H. . The detection of Toxoplasma gondii by comparing citology, histopathology, bioassay in mice, and polymerase chain reaction (PCR). Veterinary Parasitology (Print) , Amsterdan, v. 97, p. 191-197, 2001.

  • Da SILVA, A. V. ; MANZANO, M. A. ; TEIXEIRA, C. R. ; DINIZ, R. E. S. . Utilização da World Wide Web (WWW) como fonte de recursos em Educação Ambiental. Educação. Teoria e Prática (Rio Claro) , Rio Claro, v. 9, n.16, 2001.

  • LANGONI, H. ; PULGA, M. E. ; DOMINGUES, Paulo Francisco ; Da SILVA, A. V. . Eficácia da enrofloxacina no tratamento de casos de mastite bovina de origem ambiental em propriedade leiteira. Revista Napgama, São Paulo, v. 4, n.1, p. 19-22, 2001.

  • LANGONI, H. ; MEIRELLES, L.R. ; GOTTSCHALK, S. ; CABRAL, K.G. ; Da SILVA, A. V. . Perfil sorológico da leptospirose bovina em regiões do Estado de São Paulo. Arquivos do Instituto Biológico , São Paulo, v. 67, n.1, p. 37-41, 2000.

  • GIMENES BOSCO, S.M. ; PEZERICO, S.B. ; CABRAL, K.G. ; LANGONI, H. ; Da SILVA, A. V. . Streptococcus suis em suínos e perfil de susceptibilidade a antimicrobianos. Arquivos do Instituto Biológico , São Paulo, v. 67, n.2, p. 157-160, 2000.

  • LANGONI, H. ; ARAÚJO, W. N. ; Da SILVA, A. V. ; SOUZA, L.C. . Tratamento da mastite bovina com amoxacilina e enrofloxacina bem como com a sua associação. Arquivos do Instituto Biológico , São Paulo, v. 67, n.2, p. 177-180, 2000.

  • LANGONI, H. ; ICHIHARA, S. M. ; Da SILVA, A. V. ; PARDO, R. B. ; TONIN, F.B. ; MENDONÇA, L. J. P. ; MACHADO, J. A. D. . Isolation of Brucella spp from milk of brucellosis positive cows in São Paulo and Minas Gerais states. Brazilian Journal of Veterinary Research and Animal Science , São Paulo, v. 37, n.6, p. 444-448, 2000.

  • CUNHA, E.L.P. ; MOTA, R. A. ; MEIRELLES, L.R. ; SILVA, A. C. C. ; Da SILVA, A. V. ; LANGONI, H. . Pesquisa de aglutininas anti-leptospiras em soros de caprinos no Estado de Pernambuco, Brasil. Revista Brasileira de Medicina Veterinária , Rio de Janeiro, v. 21, n.1, p. 38-40, 1999.

  • LANGONI, H. ; FAVA, C. ; CABRAL, K.G. ; Da SILVA, A. V. ; CHAGAS, S. A. P. . Aglutininas anti-leptospíricas em búfalos do Vale do Ribeira, Estado de São Paulo. Ciência Rural , Santa Maria, v. 29, p. 305-307, 1999.

  • LANGONI, H. ; Da SILVA, A. V. ; TONIN, F.B. ; PAES, A. C. ; CHI, K. D. . Inquérito sorológico para a rinotraqueíte infecciosa bovina (RIB) e diarréia a vírus dos bovinos (DVB) em bovinos. Veterinária Notícias , Uberlândia, v. 5, n.2, p. 121-124, 1999.

  • LANGONI, H. ; Da SILVA, A. V. ; ROSA, C. ; MARINHO, M. . Inquérito soroepidemiológico para a toxoplasmose em ovinos no Estado de São Paulo, Brasil. O Biológico (Online) (São Paulo) , São Paulo, v. 61, p. 35-39, 1999.

  • MOTA, R. A. ; CUNHA, E.L.P. ; GOTTSCHALK, S. ; SILVA, A. C. C. ; Da SILVA, A. V. ; LANGONI, H. . Pesquisa de aglutininas anti-leptospiricas em soros de ovinos no Estado de Pernambuco - Brasil. Pesquisa em Foco , São Luis, v. 7, p. 107-114, 1999.

  • LANGONI, H. ; SOUZA, L.C. ; Da SILVA, A. V. ; LUVIZOTTO, M. C. R. ; PAES, A. C. ; LUCHEIS, Simone Baldini . Incidence of leptospiral abortion in Brazilian dairy cattle. Preventive Veterinary Medicine , Amsterdan, v. 40, p. 271-275, 1999.

  • LANGONI, H. ; DOMINGUES, Paulo Francisco ; CHI, K. D. ; PARDO, R. B. ; Da SILVA, A. V. ; CABRAL, K.G. ; ROSA, C. . Participação de leveduras, algas e fungos na mastite bovina. Veterinária e Zootecnia , Rio de Janeiro, n.10, p. 89-98, 1998.

  • LANGONI, H. ; Da SILVA, A. V. ; CABRAL, K.G. ; DOMINGUES, Paulo Francisco . Aspectos etiológicos na mastite bovina: Flora bacteriana aeróbica. Revista Brasileira de Medicina Veterinária , Rio de Janeiro, v. 20, n.5, p. 204-209, 1998.

  • LANGONI, H. ; Da SILVA, A. V. ; PRESTES, N. C. ; CORDEIRO, L. A. ; MACHADO, G. J. . Etiologia e perfil de sensibilidade na mastite equina. Semina. Ciências Agrárias (Online) , Londrina, v. 19, n.1, p. 17-20, 1998.

  • LANGONI, H. ; Da SILVA, A. V. . Comportamento sorológico de aglutininas anti-brucela em soro de equídeos. Revista Brasileira de Medicina Veterinária , Rio de Janeiro, v. 19, p. 85-87, 1997.

  • LANGONI, H. ; Da SILVA, A. V. ; BALDINI, Simone ; HOMEM, V. S. F. ; LISTONI, F.J.P. ; CAMARGO, M. J. B. . Etiologia e sensibilidade antimicrobiana na infecção do trato urinário em cães. Semina. Ciências Agrárias (Online) , Londrina, v. 17, p. 25-29, 1996.

  • LANGONI, H. ; MARINHO, M. ; Da SILVA, A. V. ; BALDINI, Simone ; CABRAL, K.G. ; SILVA, E. D. . Pesquisa de aglutininas anti-leptospíricas em soros de ovinos no Estado de São Paulo, 1994, utilizando as provas de macroaglutinação em placa e soroaglutinação microscópica. Revista Brasileira de Medicina Veterinária , Rio de Janeiro, v. 17, p. 264-268, 1995.

  • GRANJEIRO, E. M. ; OLIVEIRA, S. S. ; Da SILVA, A. V. . Cursos de Educação Continuada com Foco na Fisiologia Humana e na Saúde Ambiental. In: Darly Fernando Andrade. (Org.). Educação no Século XXI: Meio Ambiente. 1ed.Belo Horizonte: Poisson, 2019, v. 38, p. 98-105.

  • DA SILVA, A.V. ; GIMENES BOSCO, S.M. . Histoplasmose. In: Jane Megid, Márcio Garcia Ribeiro, Antonio carlos Paes. (Org.). Doenças Infecciosas em Animais de Produção e Companhia. 1ed.Rio de Janeiro: Roca, 2015, v. 1, p. 929-935.

  • da SILVA, R. C. ; DA SILVA, A.V. . Toxoplasmose. In: Jane Megid, Márcio Garcia Ribeiro, Antonio Carlos Paes. (Org.). Doenças Infecciosas em Animais de Produção e de Companhia. 1ed.Rio de Janeiro: Roca, 2015, v. 1, p. 1040-1053.

  • BALDINI, Simone ; Da SILVA, A. V. . Cães & gatos: Os riscos de uma mordida. O Berrante, Botucatu, , v. 9, 10 out. 1993.

  • Da SILVA, A. V. . Novidades sobre a doença da arranhadura do gato. O Berrante, Botucatu, , v. 11.

  • Da SILVA, A. V. ; MORAES, C. C. G. ; KRYZANYAK, E. L. ; NASCIMENTO JR, J. A. N. ; CABRAL, K.G. ; HAANWIECKEL, M. C. S. ; GIUFFRIDA, R. ; BRANDÃO, W. . Técnicos propõem um programa de controle da tuberculose bovina. Jornal do Campo, Tupã, , v. 166, p. 8 - 8.

  • Da SILVA, A. V. ; LANGONI, H. . Alimentos de origem animal e a toxoplasmose humana. Higiene Alimentar, São Paulo, p. 34 - 39.

  • CUTOLO, A. A. ; LANGONI, H. ; ROCHA, N.S. ; Da SILVA, A. V. ; PIMENTEL, V. L. . Estudo histopatológico e da microbiota aeróbica pulmonar de cobaias (Cavia porcellus), 1997. RePET, Guaratinguetá, p. 7 - 12.

  • LANGONI, H. ; DEVELEY, A. ; DOMINGUES, Paulo Francisco ; BALDINI, Simone ; Da SILVA, A. V. ; SAVOLDI, F. ; GEORGETTI, F. ; LISTONI, F.J.P. . Eficácia do Leocillin no tratamento da mastite bovina. A Hora Veterinária, Porto Alegre, p. 37 - 40.

  • MEIRELLES, L.R. ; GOTTSCHALK, S. ; Da SILVA, A. V. ; CABRAL, K.G. ; LANGONI, H. . Monitoramento microbiológicoe avaliação de provas diagnósticas na mastite caprina. NAP GAMA, São Paulo, p. 17 - 19.

  • LANGONI, H. ; DOMINGUES, Paulo Francisco ; Da SILVA, A. V. ; CAUDURO, R. O. . Tratamento da mastite bovina com a cefaperina sódica em vacas em plena lactação. A Hora Veterinária, Porto Alegre, p. 37 - 39.

  • LANGONI, H. ; PULGA, M. E. ; DOMINGUES, Paulo Francisco ; Da SILVA, A. V. . Eficácia da enrofloxacina no tratamento de casos de mastite bovina de origem ambiental em propriedade leiteira. Nap Gama, São Paulo, p. 19 - 22.

  • LANGONI, H. ; DOMINGUES, Paulo Francisco ; Da SILVA, A. V. ; SOUZA, L. C. ; SHIMABUKURO, F.H. ; CAUDURO, R. O. . Eficácia da cefapirina benzatina no tratamento da mastite bovina subclínica na interrupção da lactação. Nap Gama, São Paulo, p. 7 - 9.

  • ARAÚJO, W. N. ; Da SILVA, A. V. ; LANGONI, H. . Toxoplasmose: Uma zoonose - Realidade e riscos. Cães & Gatos, São Paulo, p. 20 - 27.

  • MAIOLINO, S. R. ; RIBEIRO, M.G. ; MOTTA, R. G. ; DA SILVA, A.V. ; SUMAN, G. ; LISTONI, F.J.P. . Comparação da eficácia in vitro e in vivo da cefaperazona sódica, gentamicina e ciprofloxacino no tratamento intramamário, convencional e estendido, da mastite clínica bovina. In: V Congresso Brasileiro de Qualidade do Leite do Conselho Brasileiro de Qualidade do Leite, 2013, Botucatu. Veterinária e Zootecnia. Botucatu: Faculdade de Medicina Veterinária e Zootecnia, 2013. v. 20. p. 126-128.

  • Da SILVA, A. V. ; ZAMPROGNA, T. O. ; LUCAS, T. M. ; MARTINS, A. A. . Prevalence and risk factors for leptospirosis in cattle and dogs in Umuarama, PR, Brazil - Preliminary results. In: XIV ISAH Congress 2009, 2009, Vechta. Proceedings of the 14th International Congress of the Interntional Society for Animal Hygiene. Brno: Tribun EU, 2009. v. 1. p. 101-104.

  • ZAMPROGNA, T. O. ; LUCAS, T. M. ; MARTINS, A. A. ; GARCIA, J. L. ; Da SILVA, A. V. . Neosporosis in cows and dogs of dairy farms in Umuarama, PR, Brazil: Preliminary results. In: XIV ISAH Congress 2009, 2009, Vechta. Proceedings of the XIV ISAH Congress 2009. Brno: Tribun EU, 2009. v. 1. p. 167-169.

  • LUCAS, T. M. ; GALLI, S. ; ZAMPROGNA, T. O. ; ROSA, R. C. ; da SILVA, R. C. ; PENA, H. F. J. ; Soares, R.M. ; LANGONI, H. ; Da SILVA, A. V. . Chicken bred under extensive conditions as sentinels for Toxoplasma gondii environmental contamination: serology, isolation and molecular characterization. In: XIV ISAH Congress 2009, 2009, Vechta. Proceedings of the XIV ISAH Congress 2009. Brno: Tribun EU, 2009. v. 2. p. 805-807.

  • PIASSA, F.R. ; ARAÚJO, J. B. ; AIGNER, C.P. ; ROSA, R. C. ; MATTEI, R. J. ; SANDRINI, F. ; LARGURA, A. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Serology, virulence profile and quantification of Toxoplasma gondii in chicken bred under extensive conditions. In: XIV ISAH Congress 2009, 2009, Vechta. Proceedings of the XIV ISAH Congress 2009. Brno: Tribun EU, 2009. v. 2. p. 809-812.

  • LUCAS, T. M. ; ZAMPROGNA, T. O. ; Da SILVA, A. V. . Comparação da atividade da dexametasona, ciclosporina-A e ciclofosfamida na toxoplasmose experimental murina. In: 36o Congresso Brasileiro de Medicina Veterinária, 2009, Porto Seguro. Anais do 36o Congresso Brasileiro de Medicina Veterinária, 2009. v. 1.

  • LUCAS, T. M. ; MELLO, P. L. ; Da SILVA, A. V. ; da SILVA, R. C. ; LANGONI, H. . Prevalência de anticorpos anti-Toxoplasma gondii em bovinos e cães oriundos de propriedades rurais do município de Umuarama - Paraná. In: 36o Congresso Brasileiro de Medicina Veterinária, 2009, Porto Seguro. Anais do 36o Congresso Brasileiro de Medicina Veterinária, 2009. v. 1.

  • Da SILVA, A. V. . Genotipagem e Diagnóstico da Toxoplasmose. In: XV Congresso Brasileiro de Parasitologia Veterinária, 2008, Curitiba. Anais do XV Congresso Brasileiro de Parasitologia Veterinária. Jaboticabal: Colégio Brasileiro de Parasitologia Veterinária, 2008.

  • RIBEIRO, E.A. ; Da SILVA, A. V. ; RIBEIRO, E.A. ; ZAFANELLI, C. C. G. ; ZAFANELLI, M.C.G. ; FLAIBAN, E. . Relação entre medidas morfométricas, peso e avaliações visuais com o resultado de duas provas de ganho de peso a pasto na raça Tabapuã. In: VI Congresso Brasileiro de Raças Zebuínas, 2005, Uberaba. Anais do VI Congresso Brasileiro de Raças Zebuínas. Uberaba: Associação Brasileira de Criadores de Zebuínos, 2005. p. 284-289.

  • TOZONI-REIS, M.F.C. ; Da SILVA, A. V. . A formação de educadores ambientais: (re) construção de uma proposta de educação à distância. In: II Encontro Pesquisa em Educação Ambiental: abordagens epistemológicas e metodológicas, 2003, São Carlos. Anais do II Encontro Pesquisa em Educação Ambiental: abordagens epistemológicas e metodológicas. São Carlos: Universidade Federal de São Carlos, 2003.

  • da SILVA, R. C. ; ROLIM, R G ; TANAKA, E. M. ; LOPES, A L S ; ROCHA, F A ; CAVALHEIRO, J.S. ; MEDEIROS, M. I. M. ; BORGES, S R ; BERETTA, T C ; LIMA, V. Y. ; AOKI, V. L. ; SOUZA, L.C. ; Da SILVA, A. V. . Avaliação soroepidemiológica da toxoplasmose, leptospirose e leishmaniose canina. In: 16a Reunião Anual do Instituto Biológico, 2003, São Paulo. Arquivos do Instituto Biológico. São Paulo: Instituto Biológico, 2003. v. 70. p. 1-5.

  • Da SILVA, A. V. ; LANGONI, H. ; DOMINGUES, Paulo Francisco ; BOTERO, C. L. Q. ; TONIN, F.B. . In Vitro and In Vivo Efficacy of Kilol-Plus Against Bovine Mastitis Agents. In: Xth International Congress on Animal Hygiene, 2000, Maastricht. Prooceedings of Xth International Congress on Animal Hygiene. Amsterdan: International Society for Animal Health, 2000. v. 2. p. 665-669.

  • LANGONI, H. ; FAVA, C. ; CABRAL, K.G. ; Da SILVA, A. V. ; CHAGAS, S. A. P. . Epidemiological survey on antileptospira agglutinins on buffaloes from Vale do Ribeira. In: V World Buffalo Congress, 1997, Casserta. V World Buffalo Congress. Casserta, 1997. p. 622-625.

  • LANGONI, H. ; LUVIZOTTO, M. C. R. ; PAES, A. C. ; Da SILVA, A. V. . Papel da infecção bacteriana nas pneumonias dos leitões: Estudo retrospectivo de 6 anos. In: VII Congresso Brasileiro de Veterinários Especialistas em Suínos, 1995, Blumenau. Anais do VII Congresso Brasileiro de Veterinários Especialistas em Suínos. Blumenau: Associação Brasileira de Veterinários Especialistas em Suínos, 1995. p. 81-81.

  • LANGONI, H. ; CABRAL, K.G. ; Da SILVA, A. V. ; BALDINI, Simone . Inquérito soroepidemiológico para leptospirose suína. In: VII Congresso Brasileiro de Veterinários Especialistas em Suínos, 1995, Blumenau. Anais do VII Congresso Brasileiro de Veterinários Especialistas em Suínos. Blumenau: Associação Brasileira de Veterinários Especialistas em Suínos, 1995. p. 153-153.

  • MELO, M. O. ; Da SILVA, A. V. . Avaliação da dinâmica de anticorpos anti-Toxoplasma gondii em indivíduos de propriedades rurais de Feira de Santana, BA. In: XXV Seminário de Iniciação Científica da UEFS, 2021, Feira de Santana. Anais do XXV Seminário de Iniciação Científica da UEFS. Feira de Santana: Pró-Reitoria de Pesquisa e Pós-Graduação, 2021. v. 1. p. 1-1.

  • MELO, M. O. ; Da SILVA, A. V. . Análise da Distribuição Espacial da Infecção pelo Toxoplasma gondii em Humanos de uma Comunidade Rural de Feira de Santana, BA. In: XXIV SEMINÁRIO DE INICIAÇÃO CIENTÍFICA DA UEFS, 2020, Feira de Santana. Anais do XXIV SEMINÁRIO DE INICIAÇÃO CIENTÍFICA DA UEFS. Feira de Santana: Pró-Reitoria de Pesquisa e Pòs-Graduação, 2020. v. 1. p. 1-1.

  • SANTOS, E. M. R. ; Da SILVA, A. V. . Padronização do Ensaio Imunoenzimático para Detecção de Anticorpos Anti-Ascaridia em Soro de Frangos. In: XXIII Seminário de Iniciação Científica da UEFS, 2019, Feira de Santana. Anais do XXIII Seminário de Iniciação Científica da UEFS. Feira de Santana: Universidade Estadual de Feira de Santana, 2019. v. 1. p. 1-1.

  • OLIVEIRA, P. M. V. ; Da SILVA, A. V. ; OLIVEIRA, E. J. F. ; CRUZ, L.A. . Dificuldades na amplificação de DNA de Toxocara a partir de ovos do parasito. In: XXIII Seminário de Iniciação Científica da UEFS, 2019, Feira de Santana. Anais do XXIII Seminário de Iniciação Científica da UEFS. Feira de Santana: Pró-Reitoria de Pesquisa e Pós-Graduação da UEFS, 2019. v. 1. p. 1-4.

  • QUEIROZ, T. C. S. B. S. ; Da SILVA, A. V. ; SILVA, C. A. ; OLIVEIRA, E. J. F. . Detecção molecular de Trypanosoma cruzi em órgãos de mamíferos silvestres da fauna da Mata Atlântica ? Bahia. In: XXI Seminário de Iniciação Científica, 2017, Feira de Santana. Anais do XXI Seminário de Iniciação Científica. Feira de Santana: Universidade Estadual de Feira de Santana, 2017. v. 1. p. 1-4.

  • OLIVEIRA, P. M. V. ; OLIVEIRA, S. S. ; Da SILVA, A. V. . Pesquisa de Toxoplasma gondii em mamíferos silvestres de duas áreas do Estado da Bahia. In: XXI Seminário de Iniciação Científica da UEFS, 2017, F. Anais dos XXI Seminário de Iniciação Científica da UEFS. Feira de Santana: Universidade Estadual de Feira de Santana, 2017. v. 1. p. 1-4.

  • SILVA, C. A. ; Da SILVA, A. V. ; QUEIROZ, T. C. S. B. S. ; BORGES, J. N. ; OLIVEIRA, P. M. V. . Detecção de DNA de Toxoplasma gondii em animais silvestres no Estado da Bahia. In: XXI Seminário de Iniciação Científica da UEFS, 2017, Feira de Santana. Anais do XXI Seminário de Iniciação Científica da UEFS. Feira de Santana: Universidade Estadual de Feira de Santana, 2017. v. 1. p. 1-4.

  • SANTOS, E. M. R. ; Da SILVA, A. V. ; SANTANA, I. S. F. ; OLIVEIRA, P. M. V. . Detecção e caracterização de enteroparasitos em animais silvestres do Estado da Bahia. In: XXI Seminário de Iniciação Científica da UEFS, 2017, Feira de Santana. Anais do XXI Seminário de Iniciação Científica da UEFS. Feira de Santana: Universidade Estadual de Feira de Santana, 2017. v. 1. p. 1-4.

  • GUERRA, L. M. S. M. M. ; DA SILVA, A.V. . Infeccão por Toxoplasma e Toxocara em frangos. In: XVIII Seminário de Iniciação Científica, 2014, Feira de Santana. Anais do XVIII Seminário de Iniciação Científica. Feira deSantana: Universidade Estadual de Feira de Santana, 2014. v. 1. p. 1-1.

  • BORGES, J. N. ; DA SILVA, A.V. ; FERREIRA, K. A. ; GUERRA, L. M. S. M. M. ; OLIVEIRA, P. M. V. . Pesquisa de cistos de Sarcocystis e anticorpos anti-Toxoplasma gondii em amostras de embutidos comercializados em feiras livres de Feira de Santana - BA. In: XVIII Seminário de Iniciação Científica, 2014, Feira de Santana. Anais do XVIII Seminário de Iniciação Científica. Feira de Santana: Universidade Estadual de Feira de Santana, 2014. v. 1. p. 1-1.

  • FERREIRA, K. A. ; DA SILVA, A.V. ; BORGES, J. N. ; GUERRA, L. M. S. M. M. ; OLIVEIRA, P. M. V. . Pesquisa de Toxocara sp. e Toxoplasma gondii em vísceras de ovinos e suínos comercializadas em mercados públicos de Feira de Santana, BA. In: XVIII Seminário de Iniciação Científica, 2014, Feira de Santana. Anais do XVIII Seminário de Iniciação Científica. Feira de Santana: Universidade Estadual de Feira de Santana, 2014. v. 1. p. 1-1.

  • OLIVEIRA, P. M. V. ; SANTOS, S. A. A. ; ALBUQUERQUE, G. R. ; DA SILVA, A.V. . Pesquisa de cádmio, zinco, chumbo e cobre em ostras Crassostrea de estuários do litoral da Bahia. In: XVIII Seminário de Iniciação Científica, 2014, Feira de Santana. Anais do XVIII Seminário de Iniciação Científica. Feira de Santana: Universidade Estadual de Feira de Santana, 2014. v. 1. p. 1-1.

  • GUERRA, L. M. S. M. M. ; BORGES, J. N. ; FERREIRA, K. A. ; OLIVEIRA, P. M. V. ; DA SILVA, A.V. . Infecção por Toxocara e Toxoplasma em frangos: Resultados preliminares. In: XVII Seminário de Iniciação Científica, 2013, Feira de Santana. Anais do XVII Seminário de Iniciação Científica. Feira de Santana: Universidade Estadual de Feira de Santana, 2013. v. 1. p. 1-4.

  • LIMA, E. V. R. ; NOVAIS, M. T. C. ; SILVA, P. C. ; DA SILVA, A.V. . Resultados finais de detecção de helmintos e protozoários na superfície externa de dipteros sinantropicos. In: XVII Seminário de Iniciação Científica, 2013, Feira de Santana. Anais do XVII Seminário de Iniciação Científica. Feira de Santana: Universidade Estadual de Feira de Santana, 2013. v. 1. p. 1-4.

  • OLIVEIRA, P. M. V. ; FERREIRA, K. A. ; CARVALHO, M. V. F. ; CORDEIRO, M. ; DA SILVA, A.V. . Atividades de Vigilância, Controle e Prevenção da Raiva Animal e Humana Desenvolvidas pelo Centro de Controle de Zoonoses deFeira de Santana- BA. In: XVII Seminário de Iniciação Científica, 2013, Feira de Santana. Anais do XVII Seminário de Iniciação Científica. Feira de Santana: Universidade Estadual de Feira de Santana, 2013. v. 1. p. 1-1.

  • FERREIRA, K. A. ; OLIVEIRA, P. M. V. ; CARVALHO, M. V. F. ; CORDEIRO, M. ; DA SILVA, A.V. . Atividades de controle populacional e de vigilância epidemiológica da leishmaniose visceral executadas pelo Centro de Controle de Zoonoses de Feira de Santana- BA. In: XVII Seminário de Iniciação Científica, 2013, Feira de Santana. Anais do XVII Seminário de Iniciação Científica. Feira de Santana: Universidade Estadual de Feira de Santana, 2013. v. 1. p. 1-1.

  • BORGES, J. N. ; FERREIRA, K. A. ; OLIVEIRA, P. M. V. ; GUERRA, L. M. S. M. M. ; DA SILVA, A.V. . Pesquisa de cistos de Sarcocystis em amostras de embutidos comercializados em feiras livres de Feira de Santana - BA. In: XVII Seminário de Iniciação Científica, 2013, Feira de Santana. Anais do XVII Seminário de Iniciação Científica. Feira de Santana: Universidade Estadual de Feira de Santana, 2013. v. 1. p. 1-1.

  • GOMES, L. S. O. ; COSTA, L. G. ; CARVALHO, M. V. F. ; von SOHSTEN, A. L. ; da SILVA, R. C. ; LANGONI, H. ; da Silva, Aristeu V. . Pesquisa de anticorpos anti-Toxoplasma gondii em cães do município de Feira de Santana, BA ? Resultados preliminares. In: XVI SEMIC - Seminário de Iniciação Científica da UEFS, 2012, Feira de Santana. Anais e Resumos [do] XVI Seminário de Iniciação Científica da UEFS: Economia Verde, Sustentabilidade e Erradicação da Pobreza. Feira de Santana: Universidade Estadual de Feira de Santana, 2012. v. 1. p. 176-179.

  • LIMA, E. V. R. ; NOVAIS, M. T. C. ; SANTANA, P. C. S. ; da Silva, Aristeu V. . Resultados preliminares de detecção de helmintos e protozoários na superfície externa de dípteros sinantrópicos. In: XVI SEMIC - Seminário de Iniciação Científica da UEFS, 2012, Feira de Santana. Anais e Resumos [do] XVI Seminário de Iniciação Científica da UEFS: Economia Verde, Sustentabilidade e Erradicação da Pobreza. Feira de Santana: Universidade Estadual de Feira de Santana, 2012. v. 1. p. 0-0.

  • SILVA, J. S. ; da Silva, Aristeu V. ; CORREIA, J. E. ; SANTANA, P. C. S. ; RANGEL, A. L. ; MORENO, M. L. V. . Estudo ultra-estrutural de larvas de helmnintos encontrados na ETE Contorno de Feira de Santana - Bahia. In: XVI SEMIC - Seminário de Iniciação Científica da UEFS, 2012, Feira de Santana. Anais e Resumos [do] XVI Seminário de Iniciação Científica da UEFS: Economia Verde, Sustentabilidade e Erradicação da Pobreza. Feira de Santana: Universidade Estadual de Feira de Santana, 2012. v. 1. p. 132-135.

  • NOVAIS, M. T. C. ; ARAÚJO, L.P. ; CORREIA, J. E. ; QUIJANO, F. R. B. ; da Silva, Aristeu V. . Pesquisa de dipteros sinantrópicos em Feira de Santana - Resultados Preliminares. In: XVI SEMIC - Seminário de Iniciação Científica da UEFS, 2012, Feira de Santana. Anais e Resumos [do] XVI Seminário de Iniciação Científica da UEFS: Economia Verde, Sustentabilidade e Erradicação da Pobreza. Feira de Santana: Universidade Estadual de Feira de Santana, 2012. v. 1. p. 210-213.

  • COSTA, L. G. ; GOMES, L. S. O. ; CARVALHO, M. V. F. ; von SOHSTEN, A. L. ; da Silva, Aristeu V. . Pesquisa de oocistos de Cryptosporidium em cães do município de Feira de Santana, BA ? Resultados preliminares. In: XVI SEMIC - Seminário de Iniciação Científica da UEFS, 2012, Feira de Santana. Anais e Resumos [do] XVI Seminário de Iniciação Científica da UEFS: Economia Verde, Sustentabilidade e Erradicação da Pobreza. Feira de Santana: Universidade Estadual de Feira de Santana, 2012. v. 1. p. 172-175.

  • GOES, M. B. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; ZANONI, J. N. ; SANT'ANA, D. M. G. . Toxoplasma gondii causa morte de células enterogliais submucosas. In: I Simpósio Plasticidade Neural Entérica, 2011, Maringá. Resumos do I Simpósio Plasticidade Neural Entérica. Maringá: Programa de Pós-Graduação em Ciências Farmacêuticas, 2011. v. 1. p. P4-1-P4-4.

  • ARAÚJO, E. J. A. ; CABANAS, R. M. P. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. . Atrofia de neurônios mientéricos do duodeno de ratos infectados por uma cepa genótipo II de Toxoplasma gondii. In: I Simpósio Plasticidade Neural Entérica, 2011, Maringá. Resumos do I Simpósio Plasticidade Neural Entérica. Maringá: Programa de Pós-Graduação em Ciências Farmacêuticas, 2011. v. 1. p. P5-1-P5-4.

  • Zaniolo, Larissa Marchi ; ARAÚJO, E. J. A. ; NELISIS, J. ; GOES, M. B. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. . Efeitos da infecção crônica por Toxoplasma gondii cepa ME49 sobre fibras nervosas VIP-IR do jejuno de ratos. In: I Simpósio Plasticidade Neural Entérica, 2011, Maringá. Resumos do I Simpósio Plasticidade Neural Entérica. Maringá: Programa de Pós-Graduação em Ciências Farmacêuticas, 2011. v. 1. p. P6-1-P6-4.

  • HERMES-ULIANA, C. ; PEREIRA-SEVERI, L.S. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Avaliação dos efeitos da infecção aguda pelo Toxoplasma gondii sobre os neurônios mientéricos nitrérgicos em ratos. In: I Simpósio Plasticidade Neural Entérica, 2011, Maringá. Resumos do I Simpósio Plasticidade Neural Entérica. Maringá: Programa de Pós-Graduação em Ciências Farmacêuticas, 2011. v. 1. p. P8-1-P8-4.

  • Zaniolo, Larissa Marchi ; ARAÚJO, E. J. A. ; ZANONI, J. N. ; Da SILVA, A. V. ; PAOEAGUA, E. C. ; GOES, M. B. ; SANT'ANA, D. M. G. . Morte de neurônios do plexo mientérico do jejuno de ratos induzidas pela infecção por oocistos de Toxoplasma gondii. In: I Simpósio Plasticidade Neural Entérica, 2011, Maringá. Resumos do I Simpósio Plasticidade Neural Entérica. Maringá: Programa de Pós-Graduação em Ciências Farmacêuticas, 2011. v. 1. p. P9-1-P9-4.

  • ZANETTE, D. F. ; SILVA, D. R. ; ARAUJO, D. A. ; Da SILVA, A. V. ; PINTO NETO, A. . Pesquisa de anticorpos anti-Brucella canis e anti-B. abortus em cães de Porto Figueira, Alto Paraíso, PR. In: 9o Encontro de Iniciação Científica, 9o Fórum de Pesquisa UNIPAR, 2010, Umuarama. Anais do 9o Encontro de Iniciação Científica, 9o Fórum de Pesquisa UNIPAR. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2010. v. 1.

  • RIBEIRO, P. R. ; Da SILVA, A. V. ; MARTINS, L.A. . Pesquisa de Salmonella em amostras de conteúdo intestinal de roedores sinantrópicos capturados na área urbana de Umuarama, PR. In: 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR, 2010, Umuarama. Anais do 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2010. v. 1.

  • BARZON, E. M. ; MELLO, P. L. ; Da SILVA, A. V. ; MARTINS, L.A. . Fatores de risco para a mastite bovina na região de Realeza - PR. In: 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR, 2010, Umuarama. Anais do 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2010. v. 1.

  • KOZERSKI, N. D. ; CALDATO, L. D. ; MESSA, V. ; ARAÚJO, J. B. ; Da SILVA, A. V. ; MERLINI, L. S. . Ocorrência de Cryptosporidium sp em roedores sinantrópicos de Umuarama, PR. In: 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR, 2010, Umuarama. Anais do 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2010. v. 1.

  • MELLO, P. L. ; BARZON, E. M. ; AGOSTININ, R.O. ; Da SILVA, A. V. ; MARTINS, L.A. . Prevalência da mastite bovina na região de Realeza - PR. In: 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR, 2010, Umuarama. Anais do 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2010. v. 1.

  • SILVA, D. R. ; ARAUJO, D. A. ; GENEROSO, D. ; Da SILVA, A. V. ; LANGONI, H. ; MARTINS, L.A. . Pesquisa de anticorpos anti-Brucella abortus em humanos de Porto Figueira, Alto Paraíso, PR. In: 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR, 2010, Umuarama. Anais do 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2010. v. 1.

  • SILVA, D. R. ; SILVEIRA, L. H. ; Da SILVA, A. V. . Infecção pelo Toxoplasma gondii em galináceos e cães de propriedades rurais do Norte do Paraná. In: 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR, 2010, Umuarama. Anais do 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2010. v. 1.

  • COLOMBO, R. B. ; ALVES NETO, I. ; MELLO, P. L. ; BARZON, E. M. ; Da SILVA, A. V. ; MARTINS, L.A. . Etiologia da mastite bovina na região de Realeza - PR. In: 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR, 2010, Umuarama. Anais do 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2010. v. 1.

  • ZANIOLO, L. M. ; HERMES, C. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Efeitos da infecção crônica por Toxoplasma gondii cepa ME49 sobre o número de neurônios mientéricos NADH-dp do jejuno de ratos. In: 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR, 2010, Umuarama. Anais do 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2010. v. 1.

  • PALTANIN, A. ; PAOEAGUA, E. C. ; GOES, M. B. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Estudo quantitativo do plexo submucoso do jejuno de ratos infectados por oocistos de Toxoplasma gondii cepa ME49 genotipo II. In: 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR, 2010, Umuarama. Anais do 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2010. v. 1.

  • GOES, M. B. ; Da SILVA, A. V. ; ZANONI, J. N. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Análise morfométrica do pericário de neurônios VIPérgicos do plexo submucoso do jejuno de ratos infectados com Toxoplasma gondii. In: 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR, 2010, Umuarama. Anais do 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2010. v. 1.

  • GOES, M. B. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Análise quantitativa dos neurônios do plexo submucoso do cólon ascendente de ratos infectados com Toxoplasma gondii. In: 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR, 2010, Umuarama. Anais do 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2010. v. 1.

  • SILVA, M. L. ; GOES, M. B. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Estudo dos neurônios mientéricos do cólon ascendente de ratos infectados por oocistos de Toxoplasma gondii (cepa ME49). In: 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR, 2010, Umuarama. Anais do 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2010. v. 1.

  • PAOEAGUA, E. C. ; GOES, M. B. ; SANTOS, F. N. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Análise quantitativa dos neurônios mientéricos do jejuno de ratos infectados com oocistos de Toxoplasma gondii. In: 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR, 2010, Umuarama. Anais do 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2010. v. 1.

  • SILVA, C. J. T. ; GOES, M. B. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Estudo das células absortivas da mucosa intestinal de ratos infectados por Toxoplasma gondii. In: 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR, 2010, Umuarama. Anais do 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2010. v. 1.

  • SILVA, C. J. T. ; GOES, M. B. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Análise morfométrica da parede jejunal de ratos infectados por Toxoplasma gondii. In: 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR, 2010, Umuarama. Anais do 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2010. v. 1.

  • ARAÚJO, J. B. ; Richini-Pereira, Virginia B. ; LANGONI, H. ; Da SILVA, A. V. . Isolamento e genotipagem de Toxoplasma gondii em roedores sinantrópicos de Umuarama, PR. In: 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR, 2010, Umuarama. Anais do 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2010. v. 1.

  • PAOEAGUA, E. C. ; GOES, M. B. ; PALTANIN, A. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Efeitos de uma infecção crônica causada por oocistos de Toxoplasma gondii sobre o número de neruônios do plexo submucoso do jejuno de ratos. In: 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR, 2010, Umuarama. Anais do 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2010. v. 1.

  • ZAGO, M. C. B. ; GOES, M. B. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Análise morfométrica da espessura total da parede de ratos infectados por oocistos de Toxoplasma gondii. In: 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR, 2010, Umuarama. Anais do 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2010. v. 1.

  • ZAGO, M. C. B. ; GOES, M. B. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Análises morfométricas dos enterócitos do cólon descedente de ratos infectados por oocistos de Toxoplasma gondii cepa ME49 genótipo II. In: 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR, 2010, Umuarama. Anais do 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2010. v. 1.

  • OLIVEIRA, I. F. ; GOES, M. B. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Análise morfométrica dos enterócitos no cólon ascendente de ratos infectados por Toxoplasma gondii. In: 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR, 2010, Umuarama. Anais do 9o Encontro de Iniciação Científica e 9o Fórum de Pesquisa UNIPAR. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2010. v. 1.

  • HERMES, C. ; MUNIZ, E. ; AZEVEDO, J.F. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Análise morfométrica das túnicas mucosa e muscular do jejuno de ratos infectados por Toxoplasma gondii. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 233-233.

  • HERMES, C. ; MUNIZ, E. ; AZEVEDO, J.F. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Atrofia da parede intestinal e altura dos vilos no jejuno de ratos infectados por Toxoplasma gondii. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: CEDIC, 2009. v. 1. p. 234-234.

  • BRAGA, C.F. ; SILVA, P.C. ; SHIRAISHI, C. S. ; Da SILVA, A. V. ; GONÇALVES, G.F. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Avaliação da secreção de mucinas na parede intestinal de suínos infectados por Toxoplasma gondii. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 237-237.

  • BRAGA, C.F. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Análise da espessura da túnica muscular do cólon de frangos após 60 dias de infecção causada por Toxoplasma gondii. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 238-238.

  • CALDATO, L. D. ; KOZERSKI, N. D. ; MESSA, V. ; ARAÚJO, J. B. ; Da SILVA, A. V. . Pesquisa de Giardia e outros enteroparasitos em roedores sinantrópicos da área urbana de Umuarama/PR ? Resultados preliminares. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 241-241.

  • LUCAS, T. M. ; ZAMPROGNA, T. O. ; Da SILVA, A. V. . Comparação da atividade da dexametasona, ciclosporina-a e ciclofosfamida na toxoplasmose experimental murina. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 244-244.

  • RIBEIRO, P. R. ; ARAÚJO, J. B. ; Da SILVA, A. V. ; MARTINS, L.A. . Biometria de roedores sinantrópicos capturados na área urbana de Umuarama, PR. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 245-245.

  • MATTEI, R. J. ; ROSA, R. C. ; ARAÚJO, J. B. ; RIBEIRO, P. R. ; Da SILVA, A. V. . Bioprova para isolamento de Toxoplasma gondii em roedores sinantrópicos de Umuarama, PR. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 247-247.

  • ZANIOLO, L. M. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Plasticidade do plexo mientérico do ceco de ratos submetidos à infecção crônica causada por uma cepa genótipo III de Toxoplasma gondii. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 249-249.

  • LUEDERS, R. B. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Efeitos da infecção por oocistos de Toxoplasma gondii sobre o número de neurônios do duodeno de ratos. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 251-251.

  • SILVA, J. R. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Análise morfométrica dos neurônios mientéricos do cólon descendente de ratos infectados por cistos de Toxoplasma gondii (genótipo II). In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 253-253.

  • ROSA, R. C. ; MATTEI, R. J. ; PIASSA, F.R. ; ARAÚJO, J. B. ; da SILVA, R. C. ; PEREIRA, V. B. R. ; LANGONI, H. ; Da SILVA, A. V. . Genotipagem de Toxoplasma gondii isolado de galinhas em propriedades de Toledo, PR. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 254-254.

  • LUCAS, T. M. ; ZAMPROGNA, T. O. ; MELLO, P. L. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Prevalência de anticorpos anti-Toxoplasma gondii em bovinos e cães oriundos de propriedades rurais do município de Umuarama - Paraná. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 259-259.

  • MELLO, P. L. ; PIASSA, F.R. ; SILVA, D. R. ; GAIO, F.C. ; LANGONI, H. ; Da SILVA, A. V. . Detecção de anticorpos anti-Leptospira em suínos de granjas da região de Toledo, PR. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 263-263.

  • SILVA, L. S. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Estudo morfoquantitativo do plexo mientérico do duodeno de ratos infectados por Toxoplasma gondii inoculado pela via intraperitoneal. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 288-288.

  • GUERRA, I.M.G. ; Da SILVA, A. V. ; MARTINS, L.A. ; ALBERTON, L. R. ; da SILVA, R. C. ; LANGONI, H. . Prevalência de anticorpos para Toxoplasma gondii em bovinos de propriedades leiteiras de Umuarama ? PR. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009. v. 1. p. 292-292.

  • DALMOLIN, A. ; ROSA, R. C. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Detecção de anticorpos anti-Toxoplasma gondii em galinhas criadas extensivamente em propriedades de criação de gado de leite do município de Umuarama ? PR. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 368-368.

  • ZAMPROGNA, T. O. ; LUCAS, T. M. ; MARTINS, A. A. ; GARCIA, J. L. ; Da SILVA, A. V. . Frequência e fatores de risco da neosporose em propriedades de produção leiteira de Umuarama, PR. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 382-382.

  • SILVA, L. S. ; SANT'ANA, D. M. G. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. . Atrofia de neurônios do plexo mientérico do íleo de ratos inoculados com Toxoplasma gondii pela via intraperitoneal. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 406-406.

  • ARAUJO, D. A. ; ZANETTE, D. F. ; PINTO NETO, A. ; CORRÊA, N.B. ; VELAZQUES, L.G. ; SILVA, D. R. ; Da SILVA, A. V. . Detecção de anticorpos anti-Toxoplasma gondii em humanos residentes em Porto Figueira (Alto Paraíso ? PR). In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 416-416.

  • ZANETTE, D. F. ; PINTO NETO, A. ; SILVA, D. R. ; ARAUJO, D. A. ; Da SILVA, A. V. . Pesquisa de anticorpos anti ? Toxoplasma gondii em cães das propriedades de Porto Figueira ? PR. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 427-427.

  • BARZON, E. M. ; ARAÚJO, J. B. ; ROSA, R. C. ; MATTEI, R. J. ; KOZERSKI, N. D. ; LANGONI, H. ; Da SILVA, A. V. . Pesquisa de anticorpos anti-Leptospira em roedores sinantrópicos. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 429-429.

  • SANTANA, S. I. ; SANT'ANA, D. M. G. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. . Análise morfométrica do plexo mientérico do duodeno de gatos infectados por Toxoplasma gondii. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 457-457.

  • MELLO, B. C. ; SILVA, A. W. T. ; ARAUJO, D. A. ; Da SILVA, A. V. ; VELAZQUES, L.G. ; CORRÊA, N.B. . Soroepidemiologia da doença de Chagas no Porto Figueira, distrito de Alto Paraiso-Paraná. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 466-466.

  • PEREIRA, L.S. ; HERMES, C. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Efeitos de uma infecção crônica (90 dias) causada por Toxoplasma gondii sobre o número de neurônios nitrérgicos do jejuno de ratos. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 518-518.

  • PEREIRA, L.S. ; HERMES, C. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Análise morfométrica do pericário de neurônios mientéricos nitrérgicos do jejuno de ratos com uma infecção toxoplásmica crônica (90 dias). In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 519-519.

  • PIASSA, F.R. ; MATTEI, R. J. ; ROSA, R. C. ; CALDATO, L. D. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Prevalência e correlação de anticorpos anti-Toxoplasma gondii em suínos e galinhas de Toledo, PR. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 570-570.

  • ARAÚJO, J. B. ; ROSA, R. C. ; MATTEI, R. J. ; RIBEIRO, P. R. ; Da SILVA, A. V. . Pesquisa de anticorpos anti-Toxoplasma gondii de roedores sinantrópicos. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 669-669.

  • SILVA, B. C. ; Da SILVA, A. V. . Uso da azitromicina no tratamento da toxoplasmose. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 716-716.

  • SILVA, J. S. ; Da SILVA, A. V. . Padronização do teste de inibição da eclosão de ovos de helmintos gastrointestinais de ovinos. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 744-744.

  • ZAMPROGNA, T. O. ; LUCAS, T. M. ; MARTINS, A. A. ; Da SILVA, A. V. . Perfil sorológico da leptospirose bovina e canina em propriedades leiteiras de Umuarama - Paraná. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 867-867.

  • FERLA, G. L. G. ; KAZAMA, C. C. ; ARAUJO, D. A. ; Da SILVA, A. V. ; CORRÊA, N.B. ; VELAZQUES, L.G. . Soroepidemiologia da leishmaniose tegumentar (LTA) no distrito de Porto Figueira, município de Alto Paraíso, estado do Paraná. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 869-869.

  • SOARES, R. E. ; ARAÚJO, J. B. ; Da SILVA, A. V. . Detecção de anticorpos anti-Toxoplasma gondii em amostras de tecidos de camundongos cronicamente infectados. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1. p. 1015-1015.

  • KOZERSKI, N. D. ; CALDATO, L. D. ; MESSA, V. ; ARAÚJO, J. B. ; Da SILVA, A. V. . Avaliação de roedores sinantrópicos como reservatórios de Cryptosporidium em Umuarama - PR ? Resultados preliminares. In: 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense, 2009, Umuarama. Anais do 8o Encontro de Iniciação Científica, 8o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2009. v. 1.

  • da SILVA, R. C. ; Da SILVA, A. V. ; LANGONI, H. . Serological inquiry and islation of Toxoplasma gondii of sheeps from a brazilian slaughterhouse. In: Toxoplasma Centennial Congress, 2008, Armação de Búzios. Abstract book of Toxoplasma Centennial Congress. Campos dos Goytacazes: Universidade Estadual do Norte Fluminense, 2008. v. 1. p. 43-43.

  • HERMES, C. ; MUNIZ, E. ; AZEVEDO, J.F. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Análise morfométrica dos enterócitos no jejuno de ratos infectados por Toxoplasma gondii. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. p. 7-7.

  • SHIRAISHI, C. S. ; HERMES, C. ; AZEVEDO, J.F. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Análise morfométrica da mucosa e muscular da mucosa de frangos infectados por cepa genótipo III de Toxoplasma gondii. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 10-10.

  • BRAGA, C.F. ; SHIRAISHI, C. S. ; Da SILVA, A. V. ; GONÇALVES, G.F. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Análise morfométrica da parede do jejuno de suínos infectados por Toxoplasma gondii durante 30 e 60 dias. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 54-54.

  • BRAGA, C.F. ; SHIRAISHI, C. S. ; Da SILVA, A. V. ; GONÇALVES, G.F. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Análise da altura e do diâmetro nuclear de enterócitos do jejuno de suínos infectados por Toxoplasma gondii durante 30 e 60 dias. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 56-56.

  • DALMOLIN, A. ; ROSA, R. C. ; Da SILVA, A. V. . Detecção de anticorpos anti-Toxoplasma gondii em galinhas criadas extensivamente em propriedades de criação de gado de leite do município de Umuarama ? PR. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 60-60.

  • CABANAS, R. M. P. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Atrofia neuronal mientérica no duodeno de ratos induzida por uma cepa genótipo I de Toxoplasma gondii. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 69-69.

  • SILVA, D. V. ; CORRÊA, N.B. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Comparação dos métodos de aglutinação direta e imunoensaio enzimático com a imunofluorescência indireta no diagnóstico da toxoplasmose humana. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 81-81.

  • ROSA, R. C. ; MATTEI, R. J. ; PIASSA, F.R. ; Da SILVA, A. V. . Freqüência de anticorpos anti-Toxoplasma gondii em galinhas de propriedades rurais de Toledo, PR. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 401-401.

  • ROSA, R. C. ; MATTEI, R. J. ; PIASSA, F.R. ; ARAÚJO, J. B. ; AIGNER, C.P. ; Da SILVA, A. V. . Dose infectante de Toxoplasma gondii e perda de peso de camundongos. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 403-403.

  • PIASSA, F.R. ; ROSA, R. C. ; MATTEI, R. J. ; Da SILVA, A. V. . Ausência de anticorpos anti-Toxoplasma gondii em suínos de granjas de alto padrão sanitário em Toledo, PR. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 649-649.

  • SILVA, D. V. ; CORRÊA, N.B. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Análise da correlação entre os títulos de anticorpos anti-Toxoplasma gondii em amostras de soro humano pelos métodos de imunofluorescência, ensaio imunoenzimático e aglutinação direta. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 119-119.

  • GUERRA, I.M.G. ; MARTINS, L.A. ; ALBERTON, L. R. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Ocorrência da toxoplasmose em bovinos de propriedades leiteiras de Umuarama ? PR. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 122-122.

  • ZANIOLO, L. M. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Análise quantitativa do plexo mientérico do ceco de ratos submetidos à infecção crônica por taquizoítos de Toxoplasma gondii (genótipo III). In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 183-183.

  • Da SILVA, A. V. ; AIGNER, C.P. ; SANDRINI, F. . Quantificação de Toxoplasma gondii pela PCR em tempo real em tecidos de galinhas soropositivas criadas extensivamente no Paraná. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 222-222.

  • MATTEI, R. J. ; ROSA, R. C. ; MERLINI, L. S. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Comparação da freqüência de anticorpos anti-Toxoplasma gondii em suínos provenientes de propriedades e em um abatedouro no noroeste do Paraná. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 228-228.

  • ZAMPROGNA, T. O. ; LUCAS, T. M. ; MARTINS, A. A. ; GARCIA, J. L. ; Da SILVA, A. V. . Detecção de anticorpos anti-Neospora caninum em cães e bovinos de propriedades leiteiras de Umuarama, PR. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 243-243.

  • BONAPAZ, R. S. ; HERMES, C. ; AZEVEDO, J.F. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Atrofia da parede intestinal de Gallus gallus infectados por oocistos teciduais de Toxoplasma gondii. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 318-318.

  • SANTANA, S. I. ; SANT'ANA, D. M. G. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. . Avaliação quantitativa dos neurônios NADH-diaforase positivos do duodeno de gatos infectados por Toxoplasma gondii. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 319-319.

  • LUCAS, T. M. ; ZAMPROGNA, T. O. ; GARCIA, J. L. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Pesquisa de anticorpos anti?Leishmania spp e anti?Toxoplasma gondii em cães de propriedades rurais de Umuarama ? PR. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 390-390.

  • SILVA, J. R. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. ; Da SILVA, A. V. . Análise morfológica mientérica do cólon descendente de ratos infectados por Toxoplasma gondii (cepa genótipo II). In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 411-411.

  • PEREIRA, L.S. ; SOARES, J. ; ROMAGNOLLI, P. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Efeitos da infecção crônica por Toxoplasma gondii sobre o número de neurônios mientéricos do colo ascendente de ratos. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 475-475.

  • ARAÚJO, J. B. ; Da SILVA, A. V. ; MANZANO, M. A. . Caracterização dos zoológicos brasileiros. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 544-544.

  • PEREIRA, L.S. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Avaliação morfométrica do pericário de neurônios mientéricos do jejuno de ratos submetidos à infecção aguda por Toxoplasma gondii. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 558-558.

  • LUCAS, T. M. ; Da SILVA, A. V. . Padronização da via de infecção e dose infectante para uso de ovos embrionados como modelo da toxoplasmose congênita. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 571-571.

  • BARBOSA, B. J. P. ; SOARES, J. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Análise morfométrica dos neurônios mientéricos do íleo de ratos submetidos à infecção crônica por taquizóitos de T. gondii (genótipo I). In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 576-576.

  • ZAMPROGNA, T. O. ; LUCAS, T. M. ; MARTINS, A. A. ; Da SILVA, A. V. . Detecção de anticorpos anti-Leptospira em bovinos e cães de propriedades leiteiras de Umuarama, PR. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 593-593.

  • CERANTO, M. A. C. ; ARAÚJO, J. B. ; Da SILVA, A. V. ; MANZANO, M. A. . Educação ambiental nos zoológicos: aspectos quantitativos. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 678-678.

  • MESSA, V. ; Da SILVA, A. V. ; MANZANO, M. A. . Avaliação da soroalbumina e do soro fetal bovino como adjuvantes na criopreservação de Toxoplasma gondii. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 688-688.

  • SILVA, L. S. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Estudo quantitativo dos neurônios do plexo mientérico do cólon descendente de ratos infectados intraperitonealmente por Toxoplasma gondii. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 701-701.

  • MESSA, V. ; Da SILVA, A. V. ; MANZANO, M. A. . Influência do sexo na perda de peso e contagem de taquizoítos no líquido peritoneal de camundongos infectados com Toxoplasma gondii. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 710-710.

  • LUEDERS, R. B. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. ; Da SILVA, A. V. . Efeitos da infecção por oocistos de T. gondii sobre o número de neurônios do jejuno de ratos. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 712-712.

  • SANTOS, F. N. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; BONAPAZ, R. S. ; ARAÚJO, E. J. A. . Avaliação dos efeitos da infecção pelo Toxoplasma gondii sobre a população neuronal de frangos de corte. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 720-720.

  • MANZANO, M. A. ; CERANTO, M. A. C. ; ARAÚJO, J. B. ; Da SILVA, A. V. . Atividades desenvolvidas e dificuldades encontradas para as práticas de educação ambiental em zoológicos brasileiros. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 757-757.

  • MANTOVANI, L. C. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Estudo quantitativo dos neurônios nadph-diaforase positivos do plexo mientérico do colon descendente de ratos infectados pelo Toxoplasma gondii. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 952-952.

  • SOARES, R. E. ; ARAÚJO, J. B. ; Da SILVA, A. V. . Detecção de anticorpos anti-Toxoplasma gondii em amostras de tecidos de camundongos cronicamente infectados. In: 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa, 2008, Umuarama. Anais do 7o Encontro de Iniciação Científica, 7o Fórum de Pesquisa da Universidade Paranaense. Umuarama: Coordenadoria de Editoração e Divulgação Científica, 2008. v. 1. p. 326-326.

  • da SILVA, R. C. ; Da SILVA, A. V. ; LANGONI, H. . Serological differentiation between acute and chronic stages in experimental Toxoplasma infection of normal and immunosupressed rats (Rattus norvegicus). In: XII International Congress in Animal Hygiene ISAH-2007, 2007, Tartu. Proceedings of XIII International Congress in Animal Hygiene. Tartu: Estonian University of Life Sciences, 2007. v. 2. p. 885-889.

  • Da SILVA, A. V. ; LUCAS, T. M. . O camundongo, o rato e o ovo embrionado: modelos experimentais de toxoplasmose congênita. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 29-30.

  • SHIMABUKURO, F.H. ; COSTA, V. M. ; da SILVA, R. C. ; CARVALHO, L. R. ; Da SILVA, A. V. ; LANGONI, H. ; DOMINGUES, Paulo Francisco . Avaliação sorológica e detecção molecular de Leptospiras em tecidos de camundongos experimentalmente infectados com estirpes patogênicas de Leptospira interrogans. In: II Congresso Nacional de Saúde Pública Veterinária, 2007, Fortaleza. Anais do II Congresso Nacional de Saúde Pública Veterinária. Fortaleza: Associação Brasileira de Saúde Pública Veterinária, 2007. v. 1. p. 139-139.

  • MERLINI, N. B. ; LEME, M. C. ; SANTANA, T. B. ; PAIVA, M. L. ; MEGDA, W. ; CUNHA NETO, C. A. V. ; CERCI, G. S. ; REOLON, J. ; STEL, R. F. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. ; BELETTINI, S. T. ; GONÇALVES, G.F. . Anastomose término-terminal intestinal em suínos com sutura de Ultresh. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 15-16.

  • BASTOS JÚNIOR, E.A. ; BOTTIN, J.M.P. ; SAAB, A. B. ; Da SILVA, A. V. . Avaliação da resistência parasitária em três rebanhos ovinos no Estado do Paraná. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 18-18.

  • BOARETO, H. ; ISBRESCHT, F.B. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Detecção de anticorpos anti-Toxoplasma gondii em suínos de granjas e abatedouro dos municípios de Umuarama e Francisco Beltrão. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 23-24.

  • LÍVERO, F.A.R. ; Da SILVA, A. V. . Etiologia e prevalência de hemoparasitoses em pequenos animais. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 26-27.

  • REOLON, J. ; MERLINI, N. B. ; MEGDA, W. ; CERCI, G. S. ; CUNHA NETO, C. A. V. ; PAIVA, M. L. ; SANTANA, T. B. ; GOMES, J. O. ; Da SILVA, A. V. ; GONÇALVES, G.F. . Pressão intra-ocular em galinhas (Gallus gallus) infectadas com Toxoplasma gondii. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 30-31.

  • REOLON, J. ; MERLINI, N. B. ; MEGDA, W. ; CERCI, G. S. ; CUNHA NETO, C. A. V. ; PAIVA, M. L. ; SANTANA, T. B. ; GOMES, J. O. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. ; Da SILVA, A. V. ; GONÇALVES, G.F. . Pressão intraocular em suínos infectados com Toxoplasma gondii. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 31-31.

  • GUERRA, I.M.G. ; DALMOLIN, A. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Prevalência de anticorpos anti-Toxoplasma gondii em eqüídeos numa fazenda de Itaquiraí - MS. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 32-32.

  • ZAFANELLI, C. C. G. ; SANTOS, S. A. ; Da SILVA, A. V. ; MERLINI, L. S. . Prevalência de enteroparasitoses na população do município de Maria Helena - Paraná. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 33-34.

  • SABEC, M. H. ; BORBA, C. R. ; MARTINS, L.A. ; Da SILVA, A. V. ; MOTA, M. F. . Qualidade microbiológica do leite ao chegar no laticínio e pasteurizado de produtores da Associação dos Produtores e Entregadores de Leite de Umuarama. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 37-37.

  • LUCAS, T. M. ; MATTEI, R. J. ; MESSA, V. ; ROSA, R. C. ; ARAÚJO, E. J. A. ; ZAMPROGNA, T. O. ; SANT'ANA, D. M. G. ; Da SILVA, A. V. . Reisolamento de Toxoplasma gondii de suínos experimentalmente infectados. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 37-38.

  • DALMOLIN, A. ; MARTINS, L.A. ; ALBERTON, L. R. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Toxoplasmose em bovinos leiteiros de Umuarama, PR. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 39-39.

  • DALMOLIN, A. ; GUERRA, I.M.G. ; MARQUES, J. M. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Toxoplasmose em uma comunidade rural de Eldorado, MS. Prevalência de anticorpos em eqüinos. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 39-39.

  • ROSA, R. C. ; MARQUES, J. M. ; LUCAS, T. M. ; ZAMPROGNA, T. O. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Toxoplasmose em uma comunidade rural. Detecção de anticorpos anti-Toxoplasma gondii em suínos e ovinos. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 40-40.

  • ISBRESCHT, F.B. ; MARQUES, J. M. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Toxoplasmose em uma comunidade rural. Prevlência de anticorpos em cãese gatos. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 40-41.

  • GUERRA, I.M.G. ; MARQUES, J. M. ; DALMOLIN, A. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Toxoplasmose em uma comunidade rural: Prevalência de anticorpos em bovinos. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 41-41.

  • BELINATO, F. C. ; GALLI, S. ; LUCAS, T. M. ; Da SILVA, A. V. . Toxoplasmose experimental em galinhas. I. Avaliaçõ de parâmetrs clínicos e patológicos. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 41-41.

  • BELINATO, F. C. ; GALLI, S. ; Da SILVA, A. V. . Toxoplasmose experimental em galinhas. II. Avaliação de parâmetros produtivos. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 42-42.

  • BOTTIN, J.M.P. ; BASTOS JÚNIOR, E.A. ; LUCAS, T. M. ; ZAMPROGNA, T. O. ; Da SILVA, A. V. . Toxoplasmose experimental murina. I. Avaliação de parâmetros patológicos. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 42-43.

  • BOTTIN, J.M.P. ; BASTOS JÚNIOR, E.A. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Toxoplasmose experimental murina. II. Avaliação da produção de anticorpos séricos. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 43-43.

  • BORBA, C. R. ; SABEC, M. H. ; MARTINS, L.A. ; Da SILVA, A. V. ; MOTA, M. F. . Avaliação da qualidade do leite obtido por diferentes tipos de ordenha. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 51-51.

  • BORBA, C. R. ; SABEC, M. H. ; BIANCHI, W. A. ; MARTINS, L.A. ; Da SILVA, A. V. ; MOTA, M. F. . Avaliação dos constituintes do leite da Associação de Produtores e Entregadores de Leite de Umuarama em diferentes tipos de ordenha. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 53-54.

  • CRUZ, V.O. ; Da SILVA, A. V. ; DELAPORTE, Rosemeres Horwat ; TAKEMURA, O.S. ; Pupo, S.C. ; PEREIRA, S. R. ; TRAINOTTI, A.C. ; GONÇALVES, G.F. . Avaliação da toxicidade oral aguda do extrato etanólico de Boucheia fluminensis em coelhos. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 54-54.

  • CABANAS, R. M. P. ; ARAÚJO, E. J. A. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. . Efeitos da infecção crônica induzida por taquizoítos de uma cepa tipo I de Toxoplasma gondii sobre neurônios mientéricos do duodeno de ratos. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 59-59.

  • CABANAS, R. M. P. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Estudo quantitativo dos neurônios mientéricos do duodeno de ratos após 30 dias da inoculação com taquizoítos de uma cepa tipo III de T. gondii. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 59-60.

  • BORDIN, C. M. ; ROMERO, A. B. ; MANZANO, M. A. ; Da SILVA, A. V. . Estudo das árvores que compõem a arborização urbana no município de São Jorge do Patrocínio - PR. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 75-75.

  • ROMERO, A. B. ; BORDIN, C. M. ; MANZANO, M. A. ; Da SILVA, A. V. . Levantamento das espécies utilizadas na arborização urbana em dois bairros do município de São Jorge do Patrocínio. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 77-77.

  • SHIRAISHI, C. S. ; REIS, A. B. ; AZEVEDO, J.F. ; HERMES, C. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Ação da toxoplasmose sobre os vilos intestinais do jejuno de suínos infectados com Toxoplasma gondii. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 113-113.

  • ODORIZZI, L. ; MOREIRA, N. M. ; SARTORI, A.L. ; SANT'ANA, D. M. G. ; Da SILVA, A. V. ; GONÇALVES, G.F. ; ARAÚJO, E. J. A. . Análise da infecção por Toxoplasma gondii sobre o número de neurônios NADH-diaforase positivos do jejuno de suínos. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 115-116.

  • SHIRAISHI, C. S. ; REIS, A. B. ; AZEVEDO, J.F. ; HERMES, C. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Análise morfométrica da túnica mucosa do jejuno de suínos infectados por Toxoplasma gondii. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 116-116.

  • SHIRAISHI, C. S. ; REIS, A. B. ; AZEVEDO, J.F. ; HERMES, C. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Análise morfométrica dos enterócitos do jejuno de suínos infectados por Toxoplasma gondii. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 117-117.

  • SOARES, J. ; BARBOSA, B. J. P. ; SUGAUARA, E.Y.Y. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Análise morfométrica dos neurônios mientéricos do íleo de ratos submetidos à infecção crônica por taquizoítos de T. gondii (genótipo III). In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 118-119.

  • GOMES, J. O. ; REOLON, J. ; PEREIRA, L.S. ; ROMAGNOLLI, P. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Análise quantitativa dos neurônios mientéricos do colo ascendente de ratos após 30 dias de inoculação com taquizoítos de T. gondii. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 120-120.

  • SARTORI, A.L. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Análise morfométrica do corpo celular e do núcleo de neurônios mientéricos de ratos infectados cronicamente por Toxoplasma gondii. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 124-125.

  • PEREIRA, L.S. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. ; Da SILVA, A. V. . Efeitos da infecção aguda por oocistos de Toxoplasma gondii sobre o número de neurônios nitrérgicos do jejuno de ratos. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 130-130.

  • LUCAS, T. M. ; MARQUES, J. M. ; ZAMPROGNA, T. O. ; ROSA, R. C. ; GALLI, S. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Toxoplasmose em uma comunidade rural: Freqüência de anticorpos em galinhas. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 133-134.

  • LUCAS, T. M. ; BELINATO, F. C. ; GALLI, S. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Toxoplasmose experimental em galinhas. III. Avaliação da produção de anticorpos séricos. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 134-134.

  • SOARES, J. ; BARBOSA, B. J. P. ; SUGAUARA, E.Y.Y. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Análise da área do pericário de neurônios mientéricos do íleo de ratos com infecção crônica por taquizoítos de T. gondii (genótipo I). In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 162-162.

  • SOARES, J. ; BARBOSA, B. J. P. ; SUGAUARA, E.Y.Y. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Conseqüências da infecção aguda por cistos de T. gondii (genótipo II) sobre a área do pericário de neurônios mientéricos do íleo de ratos. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 173-174.

  • SANTOS, P. R. ; SILVA, A. C. ; SARTORI, A.L. ; BARBOSA, B. J. P. ; SHIRAISHI, C. S. ; SOARES, J. ; SILVA, C. C. S. E. ; HERMES, C. ; Da SILVA, A. V. . Medidas profiláticas para controle da toxoplasmose humana. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 183-184.

  • BARBOSA, B. J. P. ; SUGAUARA, E.Y.Y. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; SOARES, J. ; ARAÚJO, E. J. A. . Repercussões da infecção crônica por Toxoplasma gondii (genótipo III) sobre o número de neurônios mientéricos do íleo de ratos. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 194-194.

  • SILVA, D. V. ; Da SILVA, A. V. . Revisão da literatura: Lesões da toxoplasmose em fetos e neonatos. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 194-195.

  • TRAINOTTI, A.C. ; LOLLI, G. C. ; TAKEMURA, O.S. ; CRUZ, V.O. ; PEREIRA, S. R. ; Pupo, S.C. ; Da SILVA, A. V. ; GONÇALVES, G.F. ; DELAPORTE, Rosemeres Horwat . Avaliação dos efeitos antiinflamatórios do extrato etanólico de Bouchea fluminensis, Verbenaceae, através de testes bioquímicos do exsudato. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 203-203.

  • SILVA, A. C. ; SANTOS, P. R. ; BARBOSA, B. J. P. ; SHIRAISHI, C. S. ; SOARES, J. ; SILVA, C. C. S. E. ; HERMES, C. ; Da SILVA, A. V. . Métodos laboratoriais sorológicos utilizados para identificar a toxoplasmose humana. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 210-210.

  • MOTTA, T. B. ; MARQUES, J. M. ; VELAZQUES, L.G. ; Da SILVA, A. V. ; CORRÊA, N.B. . Ocorrência de doença de Chagas em uma população rural do município de Eldorado (MS), avaliada pela metodologia de imunofluorescência indireta. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 211-211.

  • ZANINI FILHO, M. C. ; MARQUES, J. M. ; Da SILVA, A. V. ; CORRÊA, N.B. . Prevalência de Doenças de Chagas, na comunidade Floresta Branca no município de Eldorado - MS, avaliados pela metodologia ELISA. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 260-260.

  • MARQUES, J. M. ; SILVA, D. V. ; SANTOS, P. R. ; CORRÊA, N.B. ; VELAZQUES, L.G. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Toxoplasmose em uma comunidade rural: Fatores de risco para a infecção humana. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 261-262.

  • SILVA, D. V. ; MARQUES, J. M. ; CORRÊA, N.B. ; VELAZQUES, L.G. ; Da SILVA, A. V. . Toxoplasmose em uma comunidade rural: Prevalência de anticorpos em humanos. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 262-262.

  • BARBOSA, B. J. P. ; SOARES, J. ; SUGAUARA, E.Y.Y. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Estudo quantitativo dos neurônios do plexo mientérico do íleo de ratos infectados por Toxoplasma gondii (Genótipo I). In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 263-263.

  • GALLI, S. ; LUCAS, T. M. ; BELINATO, F. C. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Detecção de anticorpos e isolamento de Toxoplasma gondii de galinhas provenientes de pequenas criações do Paraná e Mato Grosso do Sul. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 413-413.

  • MARTINS, A. A. ; Da SILVA, A. V. . Prevalência e fatores de risco da leptospirose e neosporose em bovinos leiteiros de Umuarama, PR. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 416-416.

  • MARQUES, J. M. ; SILVA, D. V. ; CORRÊA, N.B. ; VELAZQUES, L.G. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Toxoplasmose em uma comunidade rural: Associação entre a freqüência de anticorpos séricos em humanos e animais. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 417-417.

  • BONAPAZ, R. S. ; ARAÚJO, E. J. A. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. . Análise da parede intestinal de Gallus gallus submetidos a infecção experimental por Toxoplasma gondii. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 417-417.

  • SILVA, J. M. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Análise da parede intestinal de gatos submetidos a infecção experimental por Toxoplasma gondii. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 417-417.

  • TORRES, J. R. P. ; SARTORI, A.L. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Análise morfométrica dosneurônios mientéricos do juno de ratos após 30 dias de inoclação com taquizoítos de cepa tipo I do T. gondii. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 418-418.

  • TORRES, J. R. P. ; SARTORI, A.L. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Análise morfométrca dos neurônios mientéricos do jejuno de ratos após 30 dias de inoclação cm tquizoítos de cepa tipo III do T. gondii. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 418-419.

  • ODORIZZI, L. ; MOREIRA, N. M. ; SARTORI, A.L. ; SANT'ANA, D. M. G. ; Da SILVA, A. V. ; GONÇALVES, G.F. ; ARAÚJO, E. J. A. . Análise quantitativ dos neurônios mientéricos NADPH-diaforase positivos do jejuno desuínos após 30 dias de infecção por Toxoplasma gondii. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 419-419.

  • BERRES, P. C. S. ; Da SILVA, A. V. ; GONÇALVES, G.F. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Localização do Toxoplasma gondii na paredeintestinal e plexo mientérico de suínos através de técnicas imunohistoquímicas. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 419-420.

  • SUGAUARA, E.Y.Y. ; ALMEIDA, E. C. ; MOREIRA, N. M. ; SARTORI, A.L. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Efeito da infecção por Toxoplasma gondii (genótipo III) sobre a áre do pericário de neurônios mientéricos do colo descendente de ratos. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 420-421.

  • Pupo, S.C. ; PEREIRA, S. R. ; LOLLI, G. C. ; CRUZ, V.O. ; TAKEMURA, O.S. ; Da SILVA, A. V. ; TRAINOTTI, A.C. ; GONÇALVES, G.F. ; DELAPORTE, Rosemeres Horwat . Avaliação da atividade antiinflamatória crônic do extrato etanólico de Bouchea fluminensis - Verbenaceae. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 422-422.

  • MARTINI, K. C. ; ZAMPROGNA, T. O. ; LUCAS, T. M. ; Da SILVA, A. V. ; MARTINS, L.A. . Avaliação da bacia leiteira de Nova Tebas - PR através da contagem de células somáticas e California Mastitis Test - Dados preliminares. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 422-423.

  • AIGNER, C.P. ; GALLI, S. ; POIARES, L. ; OSORIO, P. ; SANDRINI, F. ; LARGURA, A. ; Da SILVA, A. V. . Detecção de anticospos séricos anti-Toxoplasma e DNA de Toxoplasma em tecidos de Gallus gallus. In: VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal, 2007, Umuarama. Anais do VI Encontro de Iniciação Científica, VI Fórum de Pesquisa da UNIPAR, II Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2007. v. 1. p. 427-427.

  • MESSA, V. ; ORTIZ, A. D. ; GAZIM, Z. C. ; Da SILVA, A. V. . Eficácia in vitro de tintura hidroalcoólica de Chenopodium ambrosioides sobre a postura e eclosão de Boophilus microplus. In: IX Mostra de Trabalhos Científicos - XV Jornada Farmacêutica de Umuarama, 2006, Umuarama. Anais da XV Jornada Farmacêutica de Umuarama, IV Workshop do Curso de Tecnologia em Estética e Cosmetologia, IX Mostra de Trabalhos Científicos do Curso de Farmácia. Umuarama: Universidade Paranaense, 2006. p. 13-13.

  • MESSA, V. ; FERNANDES, K. C. ; ALMEIDA, Rodrigo de ; Da SILVA, A. V. . Pesquisa de enteroparasitos em amostras de verduras comercializadas em Umuarama, PR. In: IX Mostra de Trabalhos Científicos - XV Jornada Farmacêutica de Umuarama, 2006, Umuarama. Anais da XV Jornada Farmacêutica de Umuarama, IV Workshop do Curso de Tecnologia em Estética e Cosmetologia e IX Mostra de Trabalhos Científicos do Curso de Farmácia. Umuarama: Universidade Paranaense, 2006. p. 14-14.

  • GUERRA, I.M.G. ; LÍVERO, F.A.R. ; BOTTIN, J.M.P. ; BELINATO, F. C. ; BASTOS JÚNIOR, E.A. ; Da SILVA, A. V. . Associação entre variáveis hematológicas e a infecção pelo Toxoplasma gondii em cães. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR e I Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2006. p. 27-27.

  • FERRARI, Moacir ; Da SILVA, A. V. . Reconhecimento de parasitos e utilização de produtos anti-parasitários em propriedades leiteiras da região de Umuarama, PR. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR e I Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2006. p. 21-22.

  • BELINATO, F. C. ; BOTTIN, J.M.P. ; LÍVERO, F.A.R. ; BASTOS JÚNIOR, E.A. ; GUERRA, I.M.G. ; Da SILVA, A. V. . Associação entre a infecção pelo Toxoplasma gondii e outras doenças em cães. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR e I Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2006. p. 14-14.

  • VASCONCELOS, M. A. ; ISBRESCHT, F.B. ; BOARETO, H. ; BERNART, G. ; Da SILVA, A. V. . Prevalência, isolamento e caracterização de Toxoplasma gondii em suínos. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anasia do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR e I Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2006. p. 18-19.

  • BOARETO, H. ; Da SILVA, A. V. . Revisão: Criopreservação de cepas de Toxoplasma gondii. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR e I Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2006. p. 13-13.

  • LÍVERO, F.A.R. ; BOTTIN, J.M.P. ; BELINATO, F. C. ; BASTOS JÚNIOR, E.A. ; GUERRA, I.M.G. ; Da SILVA, A. V. . Fatores epidemiológicos associados à infecção pelo Toxoplasma gondii em cães de Umuarama, PR. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR e I Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2006. p. 14-15.

  • BERNART, G. ; BOARETO, H. ; VASCONCELOS, M. A. ; ISBRESCHT, F.B. ; Da SILVA, A. V. ; VELAZQUES, L.G. . Prevalência de anticorpos anti-Toxoplasma em suínos abatidos em Umuarama, PR. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade. Umuarama: CEDIC, 2006. p. 20-20.

  • BOTTIN, J.M.P. ; Da SILVA, A. V. . Revisão de literatura: Formação de cistos teciduais de Toxoplasma gondii em camundongos. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR e I Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2006. p. 16-17.

  • ISBRESCHT, F.B. ; Da SILVA, A. V. . Potencial de extratos de Musa spp. no tratamento da leishmaniose. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR e I Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2006. p. 168-169.

  • CERVINHANI, P. B. ; Pupo, S.C. ; Da SILVA, A. V. ; GONÇALVES, G.F. ; CRUZ, V.O. ; TAKEMURA, O.S. ; DELAPORTE, Rosemeres Horwat . Avaliação da toxicidade oral aguda do extrato etanólico de Bouchea fluminensis em coelhos. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR e I Encontro Científico do Mestrado em Ciência Animal. Umuarama: CEDIC, 2006. p. 44-44.

  • MARQUES, J. M. ; Da SILVA, A. V. . Estudo da toxoplasmose em uma comunidade rural: prevalência e fatores de risco em seres humanos e animais. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade. Umuarama: CEDIC, 2006. p. 351-351.

  • BASTOS JÚNIOR, E.A. ; Da SILVA, A. V. . Métodos e influências ambientais na recuperação de larvas de helmintos nas pastagens. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade. Umuarama: CEDIC, 2006. p. 15-16.

  • GIMENES, T. C. ; ALBERTON, J. ; Da SILVA, A. V. ; PINTO NETO, A. . Avaliação morfo-fisiológica dos ovários e útero de novilhas e vacas da região de Umuarama - PR. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade. Umuarama: CEDIC, 2006. p. 23-23.

  • CABANAS, R. M. P. ; BARBOSA, B. J. P. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Efeitos da infecção por cistos teciduais de Toxoplasma gondii sobre o plexo mioentérico do duodeno de ratos. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade. Umuarama: CEDIC, 2006. p. 87-87.

  • SOUZA, E. A. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Estudo quantitativo dos nuerônios mientéricos do colo descendente de ratos submetidos à infecção por taquizoítos de Toxoplasma gondii. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade. Umuarama: CEDIC, 2006. p. 88-88.

  • SOUZA, E. A. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Efeitos da infecção por cistos teciduais de Toxoplasma gondii sobre os neurônios mientéricos do colo descendente de rato. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuaram. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade. Umuarama: CEDIC, 2006. p. 88-89.

  • CABANAS, R. M. P. ; BARBOSA, B. J. P. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Estudo quantitativo dos neurônios do plexo mientérico do duodeno de ratos infectados por taquizoítos de Toxoplasma gondii. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade. Umuarama: CEDIC, 2006. p. 89-89.

  • BARBOSA, B. J. P. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Análise quantitativa dos neurônios do plexo mientérico do íleo de ratos com infecção aguda por cistos de Toxoplasma gondii. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade. Umuarama: CEDIC, 2006. p. 90-91.

  • BARBOSA, B. J. P. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Avaliação quantitativa dos neurônios do plexo mientérico do íleo de ratos com infecção aguda por taquizoítos de Toxoplasma gondii. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade. Umuarama: CEDIC, 2006. p. 91-91.

  • SARTORI, A.L. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Estudo quantitativo dos neurônios mioentéricos do jejuno de ratos após 24 horas da inoculação com cistos teciduais de T. gondii pela via oral. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade. Umuarama: CEDIC, 2006. p. 91-92.

  • SARTORI, A.L. ; TORRES, J. R. P. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Análise quantitativa dos neurônios mientéricos do jejuno de ratos após 24 horas da inoculação com taquizoítos de T. gondii pela via oral. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade. Umuarama: CEDIC, 2006. p. 92-93.

  • SARTORI, A.L. ; TORRES, J. R. P. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Estudo quantitativo dos neurônios mientéricos do jejuno de ratos após 30 dias da inoculação com taquizoítos de T. gondii por via oral. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade. Umuarama: CEDIC, 2006. p. 92-92.

  • TORRES, J. R. P. ; SARTORI, A.L. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Análise da parede intestinal e do plexo mioentérico de ratos infectados por Toxoplasma gondii. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade. Umuarama: CEDIC, 2006. p. 354-354.

  • GALLI, S. ; Da SILVA, A. V. . Isolamento e estudo biológico de cepas de Toxoplasma gondii de galinhas (Gallus gallus). In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade. Umuarama: CEDIC, 2006. p. 351-351.

  • GALLI, S. ; Da SILVA, A. V. . Estudo da toxoplasmose experimental em galinhas (Gallus gallus). In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade. Umuarama: CEDIC, 2006. p. 351-352.

  • Pupo, S.C. ; Da SILVA, A. V. ; GONÇALVES, G.F. ; CRUZ, V.O. ; TAKEMURA, O.S. ; DELAPORTE, Rosemeres Horwat . Avaliação da atividade antiinflamatória do extrato etanólico de Boucheia fluminensis - Verbenaceae. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade. Umuarama: CEDIC, 2006. p. 350-350.

  • RIVA, E. ; DREER, M. K. P. ; ZAFANELLI, M.C.G. ; LAGO, E. ; ZAFANELLI, C. C. G. ; MAESTA, A. A. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Soroprevalência de toxoplasmose em cães da Sociedade de Amparo aos Animais, Umuarama - PR, 2005. In: V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade, 2006, Umuarama. Anais do V Encontro de Iniciação Científica, V Fórum de Pesquisa da UNIPAR, I Encontro Científico do Mestrado em Ciência Animal e I Encontro Universidade e Comunidade. Umuarama: CEDIC, 2006. p. 13-14.

  • WOLLMANN, C. T. ; Da SILVA, A. V. . Automedicação e os acadêmicos da área de Saúde da UNIPAR, Umuarama, PR. In: XIV Jornada Farmacêutica de Umuarama e VIII Mostra de Trabalhos Científicos do Curso de Farmácia, 2005, Umuarama. Anais da XIV Jornada Farmacêutica de Umuarama - VIII Mostra de TRabalhos Científicos do Curso de Farmácia. Umuarama: Universidade Paranaense, 2005. p. 11-11.

  • HENKES, Sheila ; MESSA, V. ; Da SILVA, A. V. . Contaminação de praças públicas de Umuarama-PR, por larvas de ancilostomídeos. In: XIV Jornada Farmacêutica de Umuarama e VIII Mostra de Trabalhos Científicos do Curso de Farmácia, 2005, Umuarama. Anais da XIV Jornada Farmacêutica de Umuarama - VIII Mostra de Trabalhos Científicos do Curso de Farmácia. Umuarama: Universidade Paranaense, 2005. p. 12-12.

  • BALDO, F. ; MESSA, V. ; GAZIM, Z. C. ; Da SILVA, A. V. . Avaliação preliminar da ação do extrato aquoso da Ruta graveolens sobre a atividade reprodutiva in vitro de teleóginas de Boophilus microplus. In: XIV Jornada Farmacêutica de Umuarama e VIII Mostra de Trabalhos Científicos do Curso de Farmácia, 2005, Umuarama. Anais da XIV Jornada Farmacêutica de Umuarama e VIII Mostra de Trabalhos Científicos do Curso de Farmácia. Umuarama: Universidade Paranaense, 2005. p. 79-79.

  • FROEHNER, J.S.D. ; Da SILVA, A. V. ; GAZIM, Z. C. . Desenvolvimento de um bioterápico a partir de Ctenocephalides spp e teste preliminar no tratamento da infestação por pulas em cães sem raça definida. In: IV Encontro de Iniciação Científica, IV Fórum de Pesquisa da UNIPAR e II Encontro Paranaense de Ética, 2005, Umuarama. Anais do IV Encontro de Iniciação Científica, IV Fórum de Pesquisa e II Encontro Paranaense de Ética. Umuarama: Universidade Paranaense, 2005. p. 11-12.

  • LÍVERO, F.A.R. ; BOTTIN, J.M.P. ; NEIVERTH, K. P. ; BOARETO, H. ; GONÇALVES, G.F. ; RIBEIRO, E.A. ; Da SILVA, A. V. . Análise de leucogramas de cães sorologicamente positivos ou negativos para toxoplasmose, atendidos no Hospital Veterinário da UNIPAR, Umuarama, PR. In: IV Encontro de Iniciação Científica, IV Fórum de Pesquisa da UNIPAR e II Encontro Paranaense de Ética, 2005, Umuarama. Anais do IV Encontro de Iniciação Científica, IV Fórum de Pesquisa e II Encontro Paranaense de Ética. Umuarama: Universidade Paranaense, 2005. p. 12-12.

  • BOTTIN, J.M.P. ; BOARETO, H. ; NEIVERTH, K. P. ; LÍVERO, F.A.R. ; GONÇALVES, G.F. ; RIBEIRO, E.A. ; Da SILVA, A. V. . Análise do eritrograma de cães atendidos no Hospital Veterinário da UNIPAR, Umuarama, PR, positivos ou negativos para toxoplasmose. In: IV Encontro de Iniciação Científica, IV Fórum de Pesquisa da UNIPAR e II Encontro Paranaense de Ética, 2005, Umuarama. Anais do IVEncontro de Iniciação Científica, IV Fórum de Pesquisa e II Encontro Paranaense de Ética. Umuarama: Universidade Paranaense, 2005. p. 18-19.

  • ALBERTON, J. ; LUCCA, F. M. ; SILVA, E.M. ; SILVA, Rodrigo Raizer da ; ARAÚJO, E.B. ; MOTA, M. F. ; PINTO NETO, A. ; Da SILVA, A. V. . Avaliação do ganho de peso compensatório de novilhas e vacas mestiças submetidas a um programa alimentar a base de cana-de-açúcar e fonte proteíca. In: IV Encontro de Iniciação Científica, IV Fórum de Pesquisa e II Encontro Paranaense de Ética, 2005, Umuarama. IV Encontro de Iniciação Científica, IV Fórum de Pesquisa da UNIPAR e II Encontro Paranaense de Ética. Umuarama: Universidade Paranaense, 2005. p. 23-23.

  • FONTANA, C.C. ; GAZIM, Z. C. ; Da SILVA, A. V. ; FERREIRA, F. B. P. . Efeito do tratamento de vacas Bos taurus com bioterápico de carrapatos Boophilus microplus na postura e eclosão de ovos de carrapatos. In: IV Encontro de Iniciação Científica, IV Fórum de Pesquisa da UNIPAR e II Encontro Paranaense de Ética, 2005, Umuarama. Anais do IVEncontro de Iniciação Científica, IV Fórum de Pesquisa e II Encontro Paranaense de Ética. Umuarama: Universidade Paranaense, 2005. p. 23-24.

  • Da SILVA, A. V. ; DREER, M. K. P. ; RIVA, E. ; MARTINS, E.V. ; ISBRESCHT, F.B. . Detecção de anticorpos anti-Toxoplasma gondii em soros de suínos abatidos em Umuarama, PR. In: IV Encontro de Iniciação Científica, IV Fórum de Pesquisa e II Encontro Paranaense de Ética, 2005, Umuarama. IV Encontro de Iniciação Científica, IV Fórum de Pesquisa da UNIPAR e II Encontro Paranaense de Ética. Umuarama: Universidade Paranaense, 2005. p. 27-28.

  • CUNHA JÚNIOR, P.L. ; BOSO, L. V. ; MESSA, V. ; Da SILVA, A. V. . Avaliação de parâmetros de inoculação e desenvolvimento de células de sarcoma TG180 em camundongos. In: IV Encontro de Iniciação Científica, IV Fórum de Pesquisa e II Encontro Paranaense de Ética, 2005, Umuarama. Anais do IVEncontro de Iniciação Científica, IV Fórum de Pesquisa e II Encontro Paranaense de Ética. Umuarama: Universidade Paranaense, 2005. p. 153-153.

  • BOTTIN, J.M.P. ; BELINATO, F. C. ; LÍVERO, F.A.R. ; MARECO, W. S. ; GONÇALVES, G.F. ; Da SILVA, A. V. . Detecção de anticorpos anti-Toxoplasma gondii em amostras de plasma de cães da região de Umuarama - PR. In: III Encontro de Iniciação Científica e III Fórum de Pesquisa, 2004, Umuarama. Anais do III Encontro de Iniciação Científica e III Fórum de Pesquisa. Umuarama: Universidade Paranaense, 2004. p. 261-262.

  • PITON, G. N. ; CUNHA JÚNIOR, P.L. ; ACCO, A. ; Da SILVA, A. V. . Desenvolvimento de células de sarcoma TG180 em camundongos: uso potencial na avaliação de drogas anti-tumorais e na preparação de antígenos para provas diagnósticas. In: III Encontro de Iniciação Científica e III Fórum de Pesquisa, 2004, Umuarama. Anais do III Encontro de Iniciação Científica e III Fórum de Pesquisa. Umuarama: Universidade Paranaense, 2004. p. 54-55.

  • BOARETO, H. ; BELINATO, F. C. ; BUTZGE, E. ; TOMINAGA, J. ; BOTTIN, J.M.P. ; LÍVERO, F.A.R. ; GONÇALVES, G.F. ; SANCHES, A.W.D. ; Da SILVA, A. V. . Perfil epidemiológico da toxoplasmose canina: análise fenotípica de cepas de Toxoplasma gondii isoladas de cães. In: III Encontro de Iniciação Científica e III Fórum de Pesquisa, 2004, Umuarama. Anais do III Encontro de Iniciação Científica e III Fórum de Pesquisa. Umuarama: Universidade Paranaense, 2004. p. 278-278.

  • Da SILVA, A. V. ; PIAU JÚNIOR, R. ; da SILVA, R. C. ; LANGONI, H. ; BOTTIN, J.M.P. ; BELINATO, F. C. ; BOARETO, H. ; LÍVERO, F.A.R. ; BUTZGE, E. . Detecção de anticorpos anti-Toxoplasma gondii em amostras de soro de ovinos do Hospital Veterinário - Universidade Paranaense - UMUARAMA - PR. In: VI Mostra Científica em Medicina Veterinária, 2004, Umuarama. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR (Impresso). Umuarama: Universidade Paranaense, 2004. v. 7. p. 104-104.

  • PIAU JÚNIOR, R. ; BAYONDARKSTADE, J.E. ; RIBEIRO, E.A. ; SANCHES, A.W.D. ; Da SILVA, A. V. . Alterações morfológicas macroscópicas e microcópicas no coração, rins, baço e ovários de Bos indicus alimentados com gossipol. In: VI Mostra Científica em Medicina Veterinária, 2004, Umuarama. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR (Impresso). Umuarama: Centro de Divulgação Científica - CEDIC - UNIPAR, 2004. v. 7. p. 94-94.

  • PIAU JÚNIOR, R. ; BAYONDARKSTADE, J.E. ; RIBEIRO, E.A. ; Da SILVA, A. V. ; TOESCA, F. R. . Efeitos do gossipol sobre o peso corporal e relação hepatossomática em Bos indicus. In: VI Mostra Científica em Medicina Veterinária, 2004, Umuarama. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR (Impresso). Umuarama: Universidade Paranaense, 2004. v. 7. p. 21-21.

  • PIAU JÚNIOR, R. ; BAYONDARKSTADE, J.E. ; RIBEIRO, E.A. ; Da SILVA, A. V. . Ausência de manifestações clínicas em Bos indicus alimentados com gossipol. In: VI Mostra Científica em Medicina Veterinária, 2004, Umuarama. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR (Impresso). Umuarama: Universidade Paranaense, 2004. v. 7. p. 22-22.

  • PEZERICO, S.B. ; Da SILVA, A. V. ; da SILVA, R. C. ; LANGONI, H. . Avaliação da transmissão transplacentária de cepas genotipicamente distintas de Toxoplasma gondii, em camundongas Balb/c. In: VI Mostra Científica em Medicina Veterinária, 2004, Umuarama. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR (Impresso). Umuarama: Universidade Paranaense, 2004. v. 7. p. 83-83.

  • LUCHEIS, Simone Baldini ; Da SILVA, A. V. ; ARAÚJO JÚNIOR, J.P. ; LANGONI, H. ; MEIRA, D.A. ; MARCONDES-MACHADO, J. . Tripanossomatídeos em cães pertencentes a indivíduos com doença de Chagas crônica, habitantes de Botucatu e região, Estado de São Paulo, Brasil.. In: VI Mostra Científica em Medicina Veterinária, 2004, Umuarama. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR (Impresso). Umuarama: Universidade Paranaense, 2004. v. 7. p. 84-84.

  • Da SILVA, A. V. ; ASSIS, A.C.B. ; da SILVA, R. C. ; LANGONI, H. . Importância do Mycobacterium bovis na tuberculose humana. In: VI Mostra Científica em Medicina Veterinária, 2004, Umuarama. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR (Impresso). Umuarama: Universidade Paranaense, 2004. v. 7. p. 86-86.

  • DORES, C. B. ; Da SILVA, A. V. ; da SILVA, R. C. ; CASTRO, A. P. B. C. ; LANGONI, H. . Utilização de PCR na detecção de Toxoplasma gondii em soros de camundongos experimentalmente infectados. In: VI Mostra Científica em Medicina Veterinária, 2004, Umuarama. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR. Umuarama: Universidade Paranaense, 2004. v. 7. p. 87-87.

  • PIAU JÚNIOR, R. ; BAYONDARKSTADE, J.E. ; RIBEIRO, E.A. ; Da SILVA, A. V. ; TOESCA, F. R. . Efeitos do gossipol sobre o peso hepático, cardíaco, do baço e volume de bile em Bos indicus. In: VI Mostra Científica em Medicina Veterinária, 2004, Umuarama. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR (Impresso). Umuarama: Universidade Paranaense, 2004. v. 7. p. 93-93.

  • Da SILVA, A. V. ; MENDONÇA, A.O. ; PEZERICO, S.B. ; DOMINGUES, Paulo Francisco ; LANGONI, H. . Genotipagem de cepas de Toxoplasma gondii isoladas de lingüiças frescas preparadas com carne suína. In: VI Mostra Científica em Medicina Veterinária, 2004, Umuarama. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR (Impresso). Umuarama: Universidade Paranaense, 2004. v. 7. p. 99-99.

  • BELINATO, F. C. ; BOARETO, H. ; TOMINAGA, J. ; BUTZGE, E. ; BOTTIN, J.M.P. ; LÍVERO, F.A.R. ; MARECO, W. S. ; da SILVA, R. C. ; LANGONI, H. ; GONÇALVES, G.F. ; Da SILVA, A. V. . Anticorpos plasmáticos anti-Toxoplasma gondii em cães da região de Umuarama - PR. In: VI Mostra Científica em Medicina Veterinária, 2004, Umuarama. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR (Impresso). Umuarama: Universidade Paranaense, 2004. v. 7. p. 105-105.

  • PACHALY, J.R. ; ZAFANELLI, M.C.G. ; LAGO, E. ; ACCO, A. ; CIFFONI, E.M.G. ; Da SILVA, A. V. ; ALMOSNY, N R P . Evaluation of allometrically scaled doses of doramectin in the treatment of generalized demodicosis in domestic dogs (Canis familiaris Linnaeus, 1758). In: VI Mostra Científica em Medicina Veterinária, 2004, Umuarama. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR (Impresso). Umuarama: Universidade Paranaense, 2004. v. 7. p. 46-46.

  • PACHALY, J.R. ; ZAFANELLI, M.C.G. ; LAGO, E. ; ACCO, A. ; CIFFONI, E.M.G. ; Da SILVA, A. V. ; ALMOSNY, N R P . Evaluation of allometrically scaled doses of doramectin in the treatment of sarcoptic mange in domestic dogs (Canis familiaris Linnaeus, 1758). In: VI Mostra Científica em Medicina Veterinária, 2004, Umuarama. Umuarama: Universidade Paranaense, 2004.

  • PACHALY, J.R. ; ZAFANELLI, M.C.G. ; LAGO, E. ; ACCO, A. ; CIFFONI, E.M.G. ; Da SILVA, A. V. ; ALMOSNY, N R P . Evaluation of allometrically scaled doses of doramectin in the treatment of notoedric mange in domestic cats (Felis catus Linnaeus, 1758). In: VI Mostra Científica em Medicina Veterinária, 2004, Umuarama. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR (Impresso). Umuarama: Universidade Paranaense, 2004. v. 7. p. 48-48.

  • TOSTES, Raimundo Alberto ; BANDARRA, E.P. ; SANCHES, Ozimar C ; Da SILVA, A. V. . Avaliação do acúmulo de pigmento férrico e cúprico em casos de hepatite crônica canina. In: XI Congresso Nacional de Patologia Veterinária, 2003, Botucatu. Resumos do XI Congresso Nacional de Patologia Veterinária. Botucatu: Faculdade de Medicina Veterinária e Zootecnia, 2003. v. 1. p. 11-11.

  • TOSTES, Raimundo Alberto ; BANDARRA, E.P. ; LAUFERAMORIM, Renne ; Da SILVA, A. V. . Avaliação histológica da fibrose na doença hepática crônica canina: análise semiquantitativa por escores, análise digital morfométrica e detecção imunoistoquímica de adenovírus canino tipo 1 (CAV-1). In: XI Congresso Nacional de Patologia Veterinária, 2003, Botucatu. Resumos dos XI Congresso Nacional de Patologia Veterinária. Botucatu: Faculdade de Medicina Veterinária e Zootecnia, 2003. v. 1. p. 117-117.

  • PEZERICO, S.B. ; Da SILVA, A. V. ; LANGONI, H. . Avaliação da transmissão transplacentária de cepas de Toxoplasma gondii genotipicamente distintas, em camundongas BALB/c. Resultados preliminares. In: V Mostra Cientifica em Medicina Veterinária da UNIPAR, 2003, Umuarama. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR (Impresso). Umuarama: Associação Paranaense de Ensino e Cultura, 2003. v. 6. p. 205-205.

  • Da SILVA, A. V. ; PEZERICO, S.B. ; LIMA, V. Y. ; MORETTI, L. D. ; PINHEIRO, J. P. ; TANAKA, E. M. ; RIBEIRO, M.G. ; LANGONI, H. . Caracterização genotípica de cepas de Toxoplasma gondii isoladas de cães com sintomatologia nervosa. In: V Mostra Cientifica em Medicina Veterinária da UNIPAR, 2003, Umuarama. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR. Umuarama: Associação Paranaense de Ensino e Cultura, 2003. v. 6. p. 199-199.

  • Da SILVA, A. V. ; LANGONI, H. . Cinética de anticorpos séricos anti-Toxoplasma em ratos Fischer infectados com cepas de diferentes virulâncias. In: V Mostra Cientifica em Medicina Veterinária da UNIPAR, 2003, Umuarama. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR. Umuarama: Associação Paranaenese de Ensino e Cultura, 2003. v. 6. p. 200-200.

  • Da SILVA, A. V. ; LANGONI, H. . Comparação de oligonucleotídeos na PCR para detecção de Toxoplasma gondii em tecido muscular e nervoso de ratos Fischer experimentalmente infectados. In: V Mostra Cientifica em Medicina Veterinária da UNIPAR, 2003, Umuarama. Arquivos de Ciências Veterinárias e Zoologia da UNIPAR. Umuarama: Associação Paranaense de Ensino e Cultura, 2003. v. 6. p. 201-201.

  • von SOHSTEN, A. L. ; CORREIA, J. E. ; RUBINSKY-ELEFANT, G ; DA SILVA, A.V. . Factors associated with human infection by Toxocara in residents of a rural area. In: XXV Congresso Brasileiro de Parasitologia, 2017, Búzios. Anais dos XXV Congresso Brasileiro de Parasitologia. Uberlândia: Sociedade Brasileira de Patologia Tropical, 2017. v. 1. p. 1-1.

  • CORREIA, J. E. ; DA SILVA, A.V. ; GOMES, S. S. B. S. ; CARVALHO, H. M. B. . High prevalence of Toxoplasma infection in a rural community. In: XXV Congresso Brasileiro de Parasitologia, 2017, Búzios. Anais dos XXV Congresso Brasileiro de Parasitologia. Uberlândia: Sociedade Brasileira de Patologia Tropical, 2017. v. 1. p. 1-1.

  • AVERY, R. ; OLIVEIRA, S. S. ; DA SILVA, A.V. ; MEIJA, R. ; SILVA, M. M. ; CHRISTIFFERSON, R. C. ; RINALDI, L. ; MALONE, J. B. . Comparison of Kat-Katz, mini-Flotac, and multi-parallel real-time polymerase chain reaction techniques for detection of soil-transmitted helminths in Feira de Santana, Brazil. In: 11th International Symposium on Geospatial Health, 2017, Baltimore. Proceedings of 11th International Symposium on Geospatial Health. Baton Rouge: GnosisGIS, 2017. v. 1. p. 1-1.

  • SILVA, A. X. ; CARNEIRO, L. M. ; LIMA, G. C. ; SANTANA, P. C. S. ; CORREIA, J. E. ; CRUZ, L.A. ; DA SILVA, A.V. ; OLIVEIRA, S. S. . Levantamento de Schistosoma mansoni em área urbana periférica do município de Feira de Santana, Bahia. In: 52o Congresso da Sociedade Brasileira de Medicina Tropical, 2016, Maceió. Anais do 52o Congresso da Sociedade Brasileira de Medicina Tropical, 2016. v. 1. p. 1-1.

  • OLIVEIRA, S. S. ; GRANJEIRO, E. M. ; DA SILVA, A.V. . Alternativas de diálogo entre universidades e escolas por meio da realização de cursos extracurriculares na Área de Saúde Ambiental e Fisiologia Humana. In: VI EREBIO/NE-Encontro Regional de Ensino de Biologia do Nordeste, 2016, Vitória da Conquista. Anais do VI EREBIO/NE, 2016. v. 1. p. 1-1.

  • MERIGUETI, Y. F. ; RAPOSO, R. S. ; ZAMPIERI, B. P. ; CERAZO, L. L. ; PEREIRA, L. ; RUBINSKY-ELEFANT, G ; DA SILVA, A.V. ; LAPOZI, C. B. ; SANTAREM, V. A. . Infección experimental de pollos con Toxocara canis: cinética y avidez de anticuerpos IgY. In: XXV Congreso Panamericano de Ciencias Veterinarias, 2016, Ciudad de Panamá. Anais do XXV Congreso Panamericano de Ciencias Veterinarias. Ciudad de Panmá: Colegio Panameo de Medicos Veterinarios, 2016. v. 1. p. 76-76.

  • ALVES, T. S. ; FERRAZ, M. M. G. ; FRANCO, Marília M. Junqueira ; MOTTA, R. G. ; LISTONI, Fernando José Paganini ; DA SILVA, A.V. ; RIBEIRO, M.G. ; LEITE, D. S. ; SIQUEIRA, A. K. . Resistance to beta-lactamam antibiotics in Escherichia coli, Klebsiella spp, and Enterobacter spp isolated from raw cow milk. In: 28o Congresso Brasileiro de Microbiologia, 2015, Florianópolis. Anais do 28o Congresso Brasileiro de Microbiologia, 2015. v. 1. p. 1-1.

  • ARAÚJO, L.P. ; LIMA, E. V. R. ; NOVAIS, M. T. C. ; CORREIA, J. E. ; DA SILVA, A.V. . Detecção de helmintos parasitos na superfície de Diptera em duas cidades do estado da Bahia. In: XXIV Congresso Brasileiro de Parasitologia, 2015, Salvador. Anais do XXIV Congresso Brasileiro de Parasitologia. Goiânia: Sociedade Brasileira de Parasitologia, 2015. v. 1. p. A010-A010.

  • SANTOS, S. A. A. ; DA SILVA, A.V. ; ALBUQUERQUE, G. R. ; GONDIM, L. F. P. . Detecção de DNA de Toxoplasma gondii em ostras (Crassostrea rhizophorae), Bahia, Brasil. In: XXIV Congresso Brasileiro de Parasitologia, 2015, Salvador. Anais do XXIV Congresso Brasileiro de Parasitologia. Goiânia: Sociedade Brasileira de Parasitologia, 2015. v. 1. p. P232-P232.

  • ALMEIDA, P. H. A. ; SANTOS, S. A. A. ; DA SILVA, A.V. . Detecção de Toxoplasma gondii em fezes de Achatina fulica por PCR-RFLP e sequenciamento. In: XXIV Congresso Brasileiro de Parasitologia, 2015, Salvador. Anais do XXIV Congresso Brasileiro de Parasitologia. Goiânia: Sociedade Brasileira de Parasitologia, 2015. v. 1. p. P235-P235.

  • SILVA, J. S. ; CORREIA, J. E. ; DA SILVA, A.V. ; SANTANA, P. C. S. . Identificação de helmintos encontrados em uma estação de tratamento de esgoto de Feira de Santana, Bahia, Brasil. In: XXIV Congresso Brasileiro de Parasitologia, 2015, Salvador. Anais do XVIII Seminário de Iniciação Científica. Goiânia: Sociedade Brasileira de Parasitologia, 2015. v. 1. p. P389-P389.

  • FERREIRA, K. A. ; BORGES, J. N. ; DA SILVA, A.V. . Contaminação do solo por helmintos e protozoários em uma comunidade rural, Feira de Santana - BA. In: XXIV Congresso Brasileiro de Parasitologia, 2015, Salvador. Anais do XXIV Congresso Brasileiro de Parasitologia. Goiânia: Sociedade Brasileira de Parasitologia, 2015. v. 1. p. P410-P410.

  • BORGES, J. N. ; FERREIRA, K. A. ; GUERRA, L. M. S. M. M. ; OLIVEIRA, P. M. V. ; DA SILVA, A.V. . Detecção de Toxoplasma, Sarcocystis e Toxocara em produtos cárneos comercializados em Feira de Santana , BA. In: XXIV Congresso Brasileiro de Parasitologia, 2015, Salvador. Anais do XXIV Congresso Brasileiro de Parasitologia. Goiânia: Sociedade Brasileira de Parasitologia, 2015. v. 1. p. P416-P416.

  • SILVA, C. A. ; GUERRA, L. M. S. M. M. ; CARVALHO, M. V. F. ; GONDIM, L. F. P. ; ALBUQUERQUE, G. R. ; DA SILVA, A.V. . Isolamento e virulência de Toxoplasma de frangos criados extensivamente em Feira de Santana, BA. In: XXIV Congresso Brasileiro de Parasitologia, 2015, Salvador. Anais do XXIV Congresso Brasileiro de Parasitologia. Goiânia: Sociedade Brasileira de Parasitologia, 2015. v. 1. p. P513-P513.

  • QUEIROZ, T. C. B. S. ; DA SILVA, A.V. ; GOMES, S. S. B. S. ; CRUZ, L.A. ; ROCHA, A. S. O. ; SILVA, C. A. ; FERREIRA, K. A. ; BORGES, J. N. . Prevalência de helmintos e protozoários intestinais em população rural de Feira de Santana, BA. In: XXIV Congresso Brasileiro de Parasitologia, 2015, Salvador. Anais do XXIV Congresso Brasileiro de Parasitologia. Goiânia: Sociedade Brasileira de Parasitologia, 2015. v. 1. p. P600-P600.

  • ALMEIDA, P. H. A. ; SANTOS, S. A. A. ; DA SILVA, A.V. . Nematódeos em Achatina fulica (Gastropoda: Pulmonata) da área urbana do município de Feira de Santana - BA. In: XXIV Congresso Brasileiro de Parasitologia, 2015, Salvador. Anais do XXIV Congresso Brasileiro de Parasitologia. Goiânia: Sociedade Brasileira de Parasitologia, 2015. v. 1. p. P626-P626.

  • von SOHSTEN, A. L. ; GUERRA, L. M. S. M. M. ; RUBINSKY-ELEFANT, G ; DA SILVA, A.V. . Toxocara spp. em frangos comercializados vivos em feiras - livres de Feira de Santana, Bahia, Brasil. In: XVIII Seminário de Iniciação Científica, 2015, Salvador. Anais do XXIV Congresso Brasileiro de Parasitologia. Goiânia: Sociedade Brasileira de Parasitologia, 2015. v. 1. p. P686-P686.

  • von SOHSTEN, A. L. ; FERREIRA, K. A. ; BORGES, J. N. ; GUERRA, L. M. S. M. M. ; RUBINSKY-ELEFANT, G ; CRUZ, L.A. ; DA SILVA, A.V. . Toxocara spp. em frangos criados extensivamente e associações com variáveis epidemiológicas. In: XXIV Congresso Brasileiro de Parasitologia, 2015, Salvador. Anais do XXIV Congresso Brasileiro de Parasitologia. Goiânia: Sociedade Brasileira de Parasitologia, 2015. v. 1. p. P687-P687.

  • Rosa, Ronaldo C. ; Mattei, Rodrigo J. ; PIASSA, F.R. ; ARAÚJO, J. B. ; da SILVA, R. C. ; PEREIRA, V. B. R. ; LANGONI, H. ; Su, Chunlei ; DA SILVA, A.V. . Genotyping of Toxoplasma gondii isolates in free-range chickens from brazilian certified pig farms. In: II Simpósio Brasileiro de Toxoplasmose, 2013, São Paulo. Anais do II Simpósio Brasileiro de Toxoplasmose. São Paulo: Colégio Brasileiro de Parasitologia Veterinária, 2013.

  • SIQUEIRA, A. K. ; FERRAZ, M. M. G. ; SALERMO, T. ; LARA, G. H. B. ; LISTONI, F. J. P. ; LAMBERTINI, C. ; Da SILVA, A. V. ; Paes, Antonio Carlos ; Ribeiro, Márcio Garcia ; LEITE, D. S. . Detection of extended-expectrum B-lactamase (ESBL) producing Enterobacteriaceae in organic bovine milk. In: International Meeting on Emerging Diseases and Surveillance, 2013, Viena. Proceedings of International Meeting on Emerging Diseases and Surveillance. Brookline: International Society for Infectious Diseases, 2013. v. 1. p. 74-74.

  • SANTOS, S. A. A. ; ALMEIDA, P. H. A. ; DA SILVA, A.V. . Achatina fulica Bowdich, 1822 (STYLOMMATOPHORA, ACHATINIDAE) em um município do Semi-árido baiano: ocorrência, habitat e morfologia. In: XVIII Encontro de Zoologia do Nordeste 'Do oceano ao Sertão', 2013, Macéio. Anais do XVIII Encontro de Zoologia do Nordeste. Macéio: Universidade Federal de Alagoas, 2013. v. 1. p. 99-99.

  • ALMEIDA, P. H. A. ; SANTOS, S. A. A. ; DA SILVA, A.V. . Achatina fulica Bowdich, 1822 (STYLOMMATOPHORA, ACHATINIDAE): Um novo vetor de Giardia?. In: XVIII Encontro de Zoologia do Nordeste 'Do oceano ao Sertão', 2013, Macéio. Anais do XVIII Encontro de Zoologia do Nordeste. Macéio: Universidade Federal de Alagoas, 2013. v. 1. p. 100-100.

  • SIQUEIRA, A. K. ; FRANCO, M. M. J. ; MOTTA, R. G. ; YAMASHITA, G. ; FERRAZ, M. M. G. ; DA SILVA, A.V. ; PAES, A. C. ; RIBEIRO, M.G. ; LEITE, D. S. . Detection of ESBL-producing Enterobacteriaceae in informally marketed bovine milk. In: 5th Congress of European Microbiologists, 2013, Leipzig. FEMS 2013 5th Congress of European MicrobiologistsProgram Book, 2013. v. 1. p. 1-1.

  • SIQUEIRA, A. K. ; FERRAZ, M. M. G. ; FRANCO, M. M. J. ; MOTTA, R. G. ; LAMBERTINI, C. ; LISTONI, F.J.P. ; DA SILVA, A.V. ; RIBEIRO, M.G. ; LEITE, D. S. . Multidrug resistant coliform isolated from collective and individual bulk tank milk. In: 5th Congress of European Microbiologists, 2013, Leipzig. FEMS 2013 5th Congress of European Microbiologists Program Book, 2013. v. 1. p. 326-326.

  • SIQUEIRA, A. K. ; FERRAZ, M. M. G. ; MOTTA, R. G. ; FRANCO, M. M. J. ; Salerno, Tatiana ; LARA, G. H. B. ; DA SILVA, A.V. ; PAES, A. C. ; RIBEIRO, M.G. ; LEITE, D. S. . Enterobacter spp. producing ESBL in non pasteurized dairy milk. In: 5th Congress of European Microbiologists, 2013, Leipzig. FEMS 2013 5th Congress of European Microbiologists Program Book, 2013. v. 108. p. 326-326.

  • ALMEIDA, P. H. A. ; DA SILVA, A.V. ; da SILVA, R. C. ; SANTOS, S. A. A. . Detecção de Toxoplasma gondii e Cryptosporidium spp em Achatina fulica BOWDICH (1822). In: XXIII Congresso Brasileiro de Parasitologia, 2013, Florianopolis. Anais do XXIII Congresso Brasileiro de Parasitologia, 2013. v. 1. p. 865-865.

  • Da SILVA, A. V. ; ALMEIDA, P. H. A. ; SANTANA, P. C. S. . Prevalência de protozoários e helmintos entéricos em residentes de São Cristovão, Feira de Santana, Bahia. In: XVI Congresso Médico Amazônico, 2012, Belém. Anais do XVI Congresso Médico Amazônico. Belém: Sociedade Médico-Cirúrgica do Pará, 2012. v. 1. p. 8092-8092.

  • Da SILVA, A. V. ; CORREIA, J. E. ; MONTEIRO, T. T. D. ; ARAÚJO, L.P. ; NOVAIS, M. T. C. . Descobrindo a Ciência pela Parasitologia. In: XVI Congresso Médico Amazônico, 2012, Belém. Anais do XVI Congresso Médico Amazônico. Belém: Sociedade Médico-Cirúrgica do Pará, 2012. v. 1. p. 1019-1019.

  • CARMO, E. L. ; NEVES, C. S. A. ; SANTOS, M. M. ; MARINHO, R. R. ; MONTEIRO, N. S. ; Da SILVA, A. V. ; POVOA, M. . Animais domésticos como indicadores da exposição humana ao Toxoplasma gondii na região metropolitana de Belém, Pará. In: XVI Congresso Médico Amazônico, 2012, Belém. Anais do XVI Congresso Médico Amazônico. Belém: Sociedade Médico-Cirúrgica do Pará, 2012. v. 1. p. 8085-8085.

  • CARMO, E. L. ; NEVES, C. S. A. ; MARINHO, R. R. ; Da SILVA, A. V. ; LIMA, M. S. ; MORAES, C. C. G. ; POVOA, M. . Inquérito sorológico para Toxoplasma gondii em bovinos abatidos na região metropolitana de Belém, Pará. In: XVI Congresso Médico Amazônico, 2012, Belém. Anais do XVI Congresso Médico Amazônico. Belém: Sociedade Médico-Cirúrgica do Pará, 2012. v. 1. p. 30052-30052.

  • CARMO, E. L. ; FIGUEIREDO, J. E. ; MARINHO, R. R. ; MONTEIRO, N. S. ; da Silva, Aristeu V. ; BICHARA, C. N. C. ; POVOA, M. . Seroepidemiology of human toxoplasmosis in the urban area of Metropolitan Region of Belém, Pará State, Brazil. In: XLVIII Congress of the Brazilian Society of Tropical Medicine, 2012, Rio de Janeiro. Annals of XLVIII Congress of the Brazilian Society of Tropical Medicine. Uberaba: Sociedade Brasileira de Medicina Tropical, 2012. v. I. p. 540-541.

  • RIBEIRO, C. M. ; PIZON, D. ; CASOL, P. C. ; PIZZI, E. ; MACHADO, T. R. ; NECKEL, C. ; Da SILVA, A. V. ; KATIGIRI, S. . Susceptibilidade à infecção por helmintos gastrintestinais em bovinos. In: XXII Congresso Brasileiro de Parasitologia, 2011, São Paulo. Anais do XXII Congresso Brasileiro de Parasitologia. Uberaba: Sociedade Brasileira de Parasitologia, 2011. v. 1.

  • RIBEIRO, C. M. ; CAGNINI, F. ; Da SILVA, A. V. ; LANGONI, H. ; KATIGIRI, S. . Prevalência de anticorpos anti-Neospora caninum em bovinos leiteiros da mesoregião do sudoeste do Paraná e a associação com problemas reprodutivos. In: XXII Congresso Brasileiro de Parasitologia, 2011, São Paulo. Revista de Patologia Tropical (Impresso). Uberaba: Sociedade Brasileira de Medicina Tropical, 2011. v. 40.

  • CARMO, E. L. ; MARINHO, R. R. ; PERES, J. M. V. ; Da SILVA, A. V. ; POVOA, M. . Soroprevalência e isolamento de Toxoplasma gondii em galinhas de criação artesanal ("caipiras") na região metropolitana de Belém, Pará. In: XV Congresso Médico Amazônico, 2010, Belém. Anais do XV Congresso Médico Amazônico. Belém: Sociedade Médico-Cirúrgica do Pará, 2010. v. 1. p. 1-1.

  • CAMOSSI, L.G. ; GRECCA JÚNIOR, H. ; CORREA, A. P. F. L. ; PEREIRA, V. B. R. ; da SILVA, R. C. ; Da SILVA, A. V. ; LANGONI, H. . Diferenciação entre os estágios agudo e crônico na infecção toxoplásmica pelas técnicas sorológicas, MAD e RIFI, e pesquisa do agente no leite de ovelhas naturalmente infectadas por Toxoplasma gondii. In: XVI Congresso Brasileiro de Parasitologia Veterinária, 2010, Campo Grande. Anais do XVI Congresso Brasileiro de Parasitologia Veterinária. Jaboticabal: Colégio Brasileiro de Parasitologia Veterinária, 2010. v. 1. p. 1-1.

  • MACHADO, J.G. ; HOFFMANN, J.L. ; KRAUSE, V.L.K. ; GAIO, F.C. ; Da SILVA, A. V. ; DIAS-MELICIO, L.A. ; LANGONI, H. . Resposta imune celular frente a inoculação de Leishmania chagasi em camundongos BALB/c imunossuprimidos. In: XV Congresso Brasileiro de Parasitologia Veterinária, 2008, Curitiba. Anais do XV Congresso Brasileiro de Parasitologia Veterinária. Jaboticabal: Colégio Brasileiro de Parasitologia Veterinária, 2008. v. 1.

  • GRECCA JÚNIOR, H. ; Da SILVA, A. V. ; LANGONI, H. . Associação entre a Infecção por Leishmania spp e Neospora caninum em Cães. In: XV Congresso Brasileiro de Parasitologia Veterinária, 2008, Curitiba. Anais do XV Congresso Brasileiro de Parasitologia Veterinária. Jaboticabal: Colégio Brasileiro de Parasitologia Veterinária, 2008. v. 1.

  • CAMOSSI, L.G. ; Da SILVA, A. V. ; LANGONI, H. . Comparação de provas sorológicas na detecção de anticorpos anti-Toxoplasma gondii em equinos naturalmente infectados. In: XV Congresso Brasileiro de Parasitologia Veterinária, 2008, Curitiba. Anais do XV Congresso Brasileiro de Parasitologia Veterinária. Jaboticabal: Colégio Brasileiro de Parasitologia Veterinária, 2008. v. 1.

  • PINHEIRO JUNIOR, J. W. ; MOTA, R. A. ; OLIVEIRA, A. A. F. ; ANDERLINI, G. A. ; Da SILVA, A. V. ; GONDIM, L. F. P. . Prevalence and risk factors associated with Toxoplasma gondii infection in sheep in the state of Alagoas, Brazil. In: Toxoplasma Centennial Congress, 2008, Armação de Búzios. Abstract Book of Toxoplasma Centennial Congress. Campos dos Goytacazes: Universidade Estadual do Norte Fluminense, 2008. v. 1. p. 54-54.

  • Da SILVA, A. V. ; Soares, R.M. ; GALLI, S. ; PENA, H. F. J. . Genotyping of Toxoplasma gondii isolated from chickens frm Mato Grosso do Sul State, Brazil: Preliminary results. In: Toxoplasma Centennial Congress, 2008, Armação de Búzios. Abstract Book of Toxoplasma Centennial Congress. Campos dos Goytacazes: Universidade Estadual do Norte Fluminense, 2008. v. 1. p. 85-85.

  • MARQUES, J. M. ; SILVA, D. V. ; CORRÊA, N.B. ; VELAZQUES, L.G. ; LUCAS, T. M. ; ZAMPROGNA, T. O. ; GUERRA, I.M.G. ; DALMOLIN, A. ; ROSA, R. C. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Study of toxoplasmosis in a rural community of Eldorado, MS, Brazil. In: Toxoplasma Centennial Congress, 2008, Armação de Búzios. Abstract Book of Toxoplasma Centennial Congress. Campos dos Goytacazes: Universidade Estadual do Norte Fluminense, 2008. v. 1. p. 102-102.

  • GALLI, S. ; LUCAS, T. M. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Antibody detection and isolation of Toxplasma gondii from chickens from a rural community from Mato Grosso do Sul, Brazil. In: Toxoplasma Centennial Congress, 2008, Armação de Búzios. Abstract Book of Toxoplasma Centennial Congress. Campos dos Goytacazes: Universidade Estadual do Norte Fluminense, 2008. v. 1. p. 102-103.

  • BONAPAZ, R. S. ; HERMES, C. ; AZEVEDO, J.F. ; Da SILVA, A. V. ; ARAÚJO, E. J. A. ; SANT'ANA, D. M. G. . Atrophy of the intestinal wall og Gallus gallus infeced with tissue cysts of Toxoplasma gondii. In: Toxoplasma Centennial Congress, 2008, Armação de Búzios. Abstract Book of Toxoplasma Centennial Congress. Campos dos Goytacazes: Universidade Estadual do Norte Fluminense, 2008. v. 1. p. 119-119.

  • ARAÚJO, E. J. A. ; SHIRAISHI, C. S. ; HERMES, C. ; AZEVEDO, J.F. ; Da SILVA, A. V. ; GONÇALVES, G.F. ; SANT'ANA, D. M. G. . Morphometric analysis of te swinr intestinal mucosa after a 60-day. In: Toxoplasma Centennial Congress, 2008, Armação de Búzios. Abstract Book of Toxoplasma Centennial Congress. Campos dos Goytacazes: Universidade Estadual do Norte Fluminense, 2008. v. 1. p. 120-120.

  • SHIRAISHI, C. S. ; BRAGA, C. F. ; HERMES, C. ; AZEVEDO, J.F. ; GONÇALVES, G.F. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Analysis of the neutral glycoconjugate secretion in the mucosa of swine jejunum infected with a genotype III Toxoplasma gondii strain. In: Toxoplasma Centennial Congress, 2008, Armação de Búzios. Abstract Book of Toxoplasma Centennial Congress. Campos dos Goytacazes: Universidade Estadual do Norte Fluminense, 2008. v. 1. p. 121-121.

  • BRAGA, C. F. ; SHIRAISHI, C. S. ; AZEVEDO, J.F. ; GONÇALVES, G.F. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. ; ARAÚJO, E. J. A. . Acid glycoconjugates in the mucosa of swine jujunum infected with genotype III Toxoplasma gondii strain. In: Toxoplasma Centennial Congress, 2008, Armação de Búzios. Abstract Book of Toxoplasma Centennial Congress. Campos dos Goytacazes: Universidade Estadual do Norte Fluminense, 2008. v. 1. p. 121-121.

  • PEREIRA, L.S. ; ARAÚJO, E. J. A. ; Da SILVA, A. V. ; SANT'ANA, D. M. G. . Quantitative analysis of NADH-diaphorase positive neurons of the jejunum of rats subjected to acute infection caused by Toxoplasma gondii oocysts. In: Toxoplasma Centennial Congress, 2008, Armação de Búzios. Abstract Book of Toxoplasma Centennial Congress. Campos dos Goytacazes: Universidade Estadual do Norte Fluminense, 2008. v. 1. p. 123-124.

  • LANGONI, H. ; HARTMAN, M. ; MATOS, A. V. R. ; Da SILVA, A. V. ; MAIA, V. ; CAMOSSI, L.G. . Estudo da ocorrência de infecções intramamárias durante a utilização do ECOFID como suplemento à ração de vacas Leiteiras. In: IV Encontro de Pesquisadores em Mastites, 2007, Botucatu. Anais do IV Encontro de Pesquisadores em Mastites. Botucatu: Faculdade de Medicina Veterinária e Zootecnia, 2007. v. 1. p. 100-100.

  • SAKIYAMA, D. T. P. ; LANGONI, H. ; GUIMARAES, F. F. ; CAMOSSI, L.G. ; CARNEIRO, D. M. V. F. ; Da SILVA, A. V. . Avaliação da qualidade do leite cru produzido em sistema orgânico na região de Botucatu - SP pela contagem de células somáticas e unidades formadoras de colônias de microrganismos heterotróficos mesófilos. In: IVEncontro de Pesquisadores em Mastites, 2007, otucatu. Anais do IV Encontro de Pesquisadores em Mastites. Botucatu: Faculdade de Medicina Veterinária e Zootecnia, 2007. v. 1. p. 110-110.

  • FACCIOLI, P. Y. ; CAMOSSI, L.G. ; MENOZZI, B. D. ; Da SILVA, A. V. ; LANGONI, H. . Aspectos produtivos e avaliação da qualidade do leite de animais do rebanho leiteiro da Fazenda Experimental Lageado. In: IV Encontro de Pesquisadores em Mastites, 2007, Botucatu. Anais do IV ncontro de Pesquisadores em Mastites. Botucatu: Faculdade de Medicina Veterinária e Zootecnia, 2007. v. 1. p. 115-115.

  • SHIMABUKURO, F.H. ; COSTA, V. M. ; da SILVA, R. C. ; CARVALHO, L. R. ; Da SILVA, A. V. ; LANGONI, H. ; DOMINGUES, Paulo Francisco . Serological evaluation and molecular detection of Leptospires in tissues of mice experimentally infected with pathogenic strains of Leptospira interrogans. In: III Encontro de Pós-Graduação da Faculdade de Medicina de Botucatu, 2007, Botucatu. Journal of Venomous Animals and Toxins including Tropical Diseases. Botucatu: CEVAP, 2007.

  • da SILVA, R. C. ; Da SILVA, A. V. ; LANGONI, H. . Reacutization of Toxoplasma infection in immunosuppressed rats. In: III Encontro de Pós-Graduação da Faculdade de Medicina de Botucatu, 2007, Botucatu. Journal of Venomous Animals and Toxins includind Tropical Diseases. Botucatu: CEVAP, 2007.

  • Da SILVA, A. V. ; BOTTIN, J.M.P. ; LÍVERO, F.A.R. ; BELINATO, F. C. ; BASTOS JÚNIOR, E.A. ; GUERRA, I.M.G. ; da SILVA, R. C. ; LANGONI, H. . Avaliação de parâmetros hematológicos em cães negativos ou positivos para a presença de anticorpos séricos anti-Toxoplasma gondii. In: 14o Congresso Brasileiro de Parasitologia Veterinária & 2o Simpósio Latino-Americano de Rickettsioses, 2006, Ribeirão Preto. Resumos do 14o Congresso Brasileiro de Parasitologia Veterinária. Jaboticabal: Colégio Brasileiro de Parasitologia Veterinária, 2006. p. 329-329.

  • Da SILVA, A. V. ; MANZANO, M. A. ; BERNART, G. . Educando pela pesquisa: O caso da disciplina de parasitologia veterinária. In: 14o Congresso Brasileiro de Parasitologia Veterinária & 2o Simpósio Latino-Americano de Rickettsioses, 2006, Ribeirão Preto. Resumos do 14o Congresso Brasileiro de Parasitologia Veterinária. Jaboticabal: Colégio Brasileiro de Parasitologia Veterinária, 2006. p. 406-406.

  • SIQUEIRA, A. K. ; RIBEIRO, M.G. ; SALERMO, T. ; Da SILVA, A. V. ; PRESTES, N. C. ; LOPES, M. D. ; TAKAHIRA, R. K. ; LISTONI, F.J.P. . Multi-resistência em estirpes de Escherichia coli isoladas de infecção de trato urinário (ITU), piometra e fezes de cães sem sintomas entéricos. In: 19a RAIB - Reunião Anual do Instituto Biológico, 2006, Santos. O Biológico. São Paulo: Instituto Biológico de São Paulo, 2006. v. 68. p. 285-285.

  • Da SILVA, A. V. ; HENKES, Sheila Do Carmo ; MESSA, V. . Larvas de ancilostomídeos em praças públicas de Umuarama - PR. In: XIX Congresso Brasileiro de Parasitologia, 2005, Porto Alegre. Revista de Patologia Tropical. Porto Alegre: Sociedade Brasileira de Parasitologia, 2005. v. 34.

  • Da SILVA, A. V. ; BOARETO, H. ; NEIVERTH, K. P. ; BOTTIN, J.M.P. ; LÍVERO, F.A.R. ; da SILVA, R. C. ; GONÇALVES, G.F. ; LANGONI, H. . Perfil hematológico de cães sorologicamente positivos ao Toxoplasma gondii. In: XIX Congresso Brasileiro de Parasitologia, 2005, Porto Alegre. Revista Patologia Tropical. Porto Alegre: Sociedade Brasileira de Parasitologia, 2005. v. 34.

  • Da SILVA, A. V. ; MENDONÇA, A.O. ; PEZERICO, S.B. ; DOMINGUES, Paulo Francisco ; LANGONI, H. . Genotipagem de cepas de Toxoplasma gondii detectadas em lingüiça frescal suína. In: XIII Congresso Brasileiro de Parasitologia Veterinária e I Simpósio Panamericano de Ricketsioses, 2004, Ouro Preto. Revista Brasileira de Parasitologia Veterinária. Belo Horizonte: Colégio Brasileiro de Parasitologia Veterinária, 2004. v. 13. p. 210-210.

  • SANCHES, A.W.D. ; HEADLEY, Selwyn Arhligton ; CASTRO, M. ; VASCONCELOS, W. ; Da SILVA, A. V. . Encephalitozoon sp in a goat. In: XIII Congresso Brasileiro de Parasitologia Veterinária e I Simpósio Panamericano de Ricketsioses, 2004, Ouro Preto. Revista Brasileira de Parasitologia Veterinária. Belo Horizonte: Colégio Brasileiro de Parasitologia Veterinária, 2004. v. 13. p. 243-243.

  • LIMA, K. C. ; MEGID, J. ; Da SILVA, A. V. ; CORTEZ, A. . Evaluation of polymerase chain reaction in the study of rabies virus experimentally inoculated in mice (Mus musculus). In: The XIV International Conference Rabies in the Americas, 2003, Philadelphia. Proocedings of The XIV International Conference Rabies in the Americas. Philadelphia: Thomas Jefferson University, 2003. v. 1. p. 62-63.

  • Da SILVA, A. V. ; LIMA, V. Y. ; PEZERICO, S.B. ; TANAKA, E. M. ; PINHEIRO, J. P. ; LANGONI, H. . Estudo retrospectivo (1996-2001) dos exames sorológicos para leptospirose humana, ovina, suína, caprina, canina e bovina, realizados pelo Serviço de Diagnóstico de Zoonoses/FMVZ/UNESP/Botucatu. In: XXXVIII Congresso da Sociedade Brasileira de Medicina Tropical, 2002, Foz do Iguaçu. Revista da Sociedade Brasileira de Medicina Tropical. Uberlândia: Sociedade Brasileira de Medicina Tropical, 2002. v. 35. p. 146-146.

  • SEGISMUNDO, R. ; Da SILVA, A. V. ; PEZERICO, S.B. ; LIMA, V. Y. ; PINHEIRO, J. P. ; TANAKA, E. M. ; LANGONI, H. . Leptospirose Canina: Avaliação de Variáveis Epidemiológicas, Alterações Clínicas, Hematológicas e Urinárias. In: XXXVIII Congresso da Sociedade Brasileira de Medicina Tropical, 2002, Foz do Iguaçu. Revista da Sociedade Brasileira de Medicina Tropical. Uberlândia: Sociedade Brasileira de Medicina Tropical, 2002. v. 35. p. 151-151.

  • CAPORALI, E.H.G. ; Da SILVA, A. V. ; LANGONI, H. . Prevalência de anticorpos anti-Toxoplasma gondii em suínos pelos método de aglutinação direta e reação de imunofluorescência indireta. In: XXXVIII Congresso da Sociedade Brasileira de Medicina Tropical, 2002, Foz do Iguaçu. Revista da Sociedade Brasileira de Medicina Tropical. Uberlândia: Sociedade Brasileira de Medicina Tropical, 2002. v. 35. p. 265-265.

  • Da SILVA, A. V. ; LANGONI, H. . Toxoplasmose experimental em ratos - Resposta sorológica, bioprova e comparação de oligonucleotídeos na reação em cadeia pela polimerase. In: XXXVIII Congresso da Sociedade Brasileira de Medicina Tropical, 2002, Foz do Iguaçu. Revista da Sociedade Brasileira de Medicina Tropical. Uberlândia: Sociedade Brasileira de Medicina Tropical, 2002. v. 35. p. 269-269.

  • LANGONI, H. ; Da SILVA, A. V. ; PEZERICO, S.B. ; LIMA, V. Y. . Anti-leptospire agglutinins in equine sera from São Paulo, Goias and Mato Grosso do Sul State, Brazil, 1996-2001. In: III European Congress on Tropical Medicine and Travel Health, 2002, Lisboa. Proocedings of III European Congress on Tropical Medicine and Travel Health. Lisboa, 2002.

  • VICTÓRIA, C. ; SERRA, M. J. B. ; QUELUZ, J. A. F. ; Da SILVA, A. V. ; ELIAS, A. O. ; DOMINGUES, Paulo Francisco ; RIBEIRO, M.G. ; LANGONI, H. . Atividades de extensão rural para o monitoramento da qualidade do leite e sanidade da glândula mamária. In: II Congresso de Extensão Universitária da UNESP, 2002, Bauru. Anais do II Congresso de Extensão Universitária da UNESP. São Paulo: Universidade Estadual Paulista, 2002. v. 1.

  • Da SILVA, A. V. ; TOZONI-REIS, M.F.C. . Curso de educação a distância Educação ambiental: princípios e práticas. In: II Congresso de Extensão Universitária da UNESP, 2002, Bauru. Anais do II Congresso de Extensão Universitária da UNESP. São Paulo: Universidade Estadual Paulista, 2002. v. 1.

  • Da SILVA, A. V. ; MANZANO, M. A. ; TEIXEIRA, C. R. ; DINIZ, R. E. S. . Utilização da World Wide Web (WWW) como fonte de recursos em Educação Ambiental. In: Encontro - Pesquisa em Educação Ambiental: Tendências e Perspectivas, 2001, Rio Claro. Anais do Encontro - Pesquisa em Educação Ambiental: Tendências e Perspectivas, 2001. p. 58-58.

  • CAPORALI, E.H.G. ; Da SILVA, A. V. ; LANGONI, H. . Prevalência de anticorpos anti-Toxoplasma gondii em suínos pelos métodos de aglutinação direta e reação de imunofluorescência indireta. In: XIII Congresso de Iniciação Científica da UNESP, 2001, Bauru. Anais do XIII Congresso de Iniciação Científica da UNESP. São Paulo: Universidade Estadual Paulista Julio de Mesquita Filho, 2001. p. 333-333.

  • BASTOS, V. S. M. ; Da SILVA, A. V. ; PEZERICO, S.B. ; LIMA, V. Y. ; LANGONI, H. . Ação do Diazepam na infecção experimental de hamsters (Mesocricetus auratus) com Leptospira interrogans sorovar pomona. In: XXVIII Congresso Brasileiro de Medicina Veterinária, 2001, Salvador. Anais do XXVIII Congresso Brasileiro de Medicina Veterinária. Salvador: Sociedade Brasileira de Medicina Veterinária, 2001. p. 5-5.

  • LANGONI, H. ; Da SILVA, A. V. ; PEZERICO, S.B. ; LIMA, V. Y. . Utilização das provas de aglutinação direta e de imunofluorescência indireta na toxoplasmose eqüina. In: XXVIII Congresso Brasileiro de Medicina Veterinária, 2001, Salvador. Anais do XXVIII Congresso Brasileiro de Medicina Veterinária. Salvador: Sociedade Brasileira de Medicina Veterinária, 2001. p. 200-200.

  • Da SILVA, A. V. ; LANGONI, H. ; PEZERICO, S.B. ; LIMA, V. Y. ; TANAKA, E. M. ; PINHEIRO, J. P. . Educação em saúde: Ação do médico veterinário na prevenção das zoonoses. In: VI Congresso Iberoamericano de Extensão, 2001, Embu das Artes. Anais do VI Congresso Iberoamericano de Extensão. São Paulo: Escola Paulista de Medicina, 2001. p. 139-139.

  • LANGONI, H. ; SOUZA, L.C. ; Da SILVA, A. V. ; PEZERICO, S.B. ; LIMA, V. Y. ; TANAKA, E. M. ; PINHEIRO, J. P. . O laboratório de diagnóstico de zoonoses como partida para ações de controle de zoonoses. In: VI Congresso Iberoamericano de Extensão, 2001, Embu das Artes. Anais do VI Congresso Iberoamericano de Extensão. São Paulo: Escola Paulista de Medicina, 2001. p. 154-154.

  • Da SILVA, A. V. ; GIMENES BOSCO, S.M. ; LANGONI, H. ; BAGAGLI, E. . Toxoplasma gondii em animais silvestres: Sorologia e isolamento do parasita. In: XIII Jornada Paulista de Parasitologia, 2000, Botucatu. Anais da XIII Jornada Paulista de Parasitologia. São Paulo: Sociedade Paulista de Parasitologia, 2000. p. 53-53.

  • CADIMA, P. ; LANGONI, H. ; SÁ, M. E. P. ; VICTÓRIA, C. ; Da SILVA, A. V. . Prevalência da mastite bovina e perfil de sensibilidade microbiana na região de Botucatu e Avaré - SP. In: IV Mostra Científica da FMVZ, 2000, Botucatu. Anais da IV Mostra Científica da FMVZ. Botucatu: Faculdade de Medicina Veterinária e Zootecnia, 2000. p. 13-13.

  • LANGONI, H. ; Da SILVA, A. V. ; MENDONÇA, A.O. ; CUNHA, E.L.P. . Toxoplasmose em roedores: Pesquisa de anticorpos e tentativa de isolamento do agente. In: IV Mostra Científica da FMVZ, 2000, Botucatu. Anais da IV Mostra Científica da FMVZ. Botucatu: Faculdade de Medicina Veterinária e Zootecnia, 2000. p. 34-34.

  • SEGISMUNDO, R. ; LANGONI, H. ; Da SILVA, A. V. . Leptospirose canina: Levantamento retrospectivo dos casos sorologicamente suspeitos atendidos no Hospital Veterinário/FMVZ/UNESP. Botucatu. 1996-1999. In: XI Congresso de Iniciação Científica da UNESP, 1999, Botucatu. Anais do XI Congresso de Iniciação Científica da UNESP. São Paulo: Universidade Estadual Paulista, 1999. p. 284-284.

  • CORTEZ, T. L. ; LANGONI, H. ; Da SILVA, A. V. ; CABRAL, K.G. . Detecção de anticorpos anti-Toxoplasma gondii em bovinos. Botucatu, SP. 1999. In: XI Congresso de Iniciação Científica da UNESP, 1999, Botucatu. Anais do XI Congresso de Iniciação Científica da UNESP. São Paulo: Universidade Estadual Paulista, 1999. p. 285-285.

  • Da SILVA, A. V. ; CUTOLO, A. A. ; LANGONI, H. . Comparação da reação de imunofluorescência indireta e da aglutinação direta no diagnóstico da toxoplasmose ovina. Resultados preliminares.. In: XI Seminário Brasileiro de Parasitologia Veterinária, 1999, Salvador. Anais do XI Seminário Brasileiro de Parasitologia Veterinária, 1999. p. 219-219.

  • Da SILVA, A. V. ; LANGONI, H. . Comparação de métodos de diagnóstico direto na toxoplasmose ovina. In: XI Seminário Brasileiro de Parasitologia Veterinária, 1999, Salvador. Anais do XI Seminário Brasileiro de Parasitologia Veterinária, 1999. p. 219-220.

  • PIMENTEL, V. L. ; LUCHEIS, Simone Baldini ; Da SILVA, A. V. ; LANGONI, H. . Avaliação da dinâmica de anticorpos aglutinantes antileptospíricos, pós-vacinais, em cães errantes, pela prova de soroaglutinação microscópica. In: 12a Reunião Anual do Instituto Biológico, 1999, São Paulo. Arquivos do Instituto Biológico. São Paulo: Instituto Biológico de São Paulo, 1999. v. 66. p. 38-38.

  • LANGONI, H. ; ARAÚJO, W. N. ; Da SILVA, A. V. ; SOUZA, L. C. . Ação da enrofloxacina e amoxacilina sós e em associação no tratamento da mastite bovina. In: III Encontro de Pesquisadores em Mastites, 1999, Botucatu. Anais do III Encontro de Pesquisadores em Mastites. Botucatu: Faculdade de Medicina Veterinária e Zootecnia, 1999. p. 133-133.

  • LANGONI, H. ; Da SILVA, A. V. ; CHI, K. D. . Etiologia e sensibilidade de agentes da mastite bovina. In: III Encontro de Pesquisadores em Mastites, 1999, Botucatu. Anais do III Encontro de Pesquisadores em Mastites. Botucatu: Faculdade de Medicina Veterinária e Zootecnia, 1999. p. 154-154.

  • LANGONI, H. ; Da SILVA, A. V. . Perfil de sensibilidade do Staphylococcus isolado de amostras de leite mastíticas provenientes do Estado de São Paulo. In: III Encontro de Pesquisadores em Mastites, 1999, Botucatu. Anais do III Encontro de Pesquisadores em Mastites. Botucatu: Faculdade de Medicina Veterinária e Zootecnia, 1999. p. 164-164.

  • GOTTSCHALK, S. ; MEIRELES, L. R. ; Da SILVA, A. V. ; LANGONI, H. . Serum-epidemiological research inquiry about toxoplasmosis, leptospirosis and brucelosis in goats in the region of Botucatu, State of Sao Paulo. In: II Mostra Científica da FMVZ/UNESP/Botucatu, 1998, Botucatu. Anais da II Mostra Científica da FMVZ/UNESP/Botucatu. Botucatu: Faculdade de Medicina Veterinária e Zootecnia, 1998. p. 36-37.

  • Da SILVA, A. V. ; GOTTSCHALK, S. ; MEIRELLES, L.R. ; CUTOLO, A. A. ; LANGONI, H. . In vitro action of amoxicillin-clavulanic acid association. In: II Mostra Científica da FMVZ/UNESP/Botucatu, 1998, Botucatu. Anais da II Mostra Científica da FMVZ/UNESP/Botucatu. Botucatu: Faculdade de Medicina Veterinária e Zootecnia, 1998. p. 38-39.

  • LANGONI, H. ; MARCONDES-MACHADO, J. ; GOTTSCHALK, S. ; MEIRELLES, L.R. ; GIMENES BOSCO, S.M. ; Da SILVA, A. V. . Pesquisa de aglutininas anti-leptospíricas em soros humanos, de pacientes atendidos no Hospital das Clínicas da Faculdade de Medicina de Botucatu, SP. In: III Simpósio Nacional de Zoonoses e Animais Peçonhentos, 1998, Guarapari. Anais do III Simpósio Nacional de Zoonoses e Animais Peçonhentos. Brasília: Ministério do Saúde, 1998. p. 96-96.

  • Da SILVA, A. V. ; LANGONI, H. . Isolamento de Toxoplasma gondii de ovinos abatidos para consumo humano, Botucatu, 1998. Resultados preliminares.. In: III Simpósio Nacional de Zoonoses e Animais Peçonhentos, 1998, Guarapari. Anais do III Simpósio Nacional de Zoonoses e Animais Peçonhentos. Brasília: Ministério da Saúde, 1998. p. 145-145.

  • LANGONI, H. ; Da SILVA, A. V. ; CABRAL, K.G. ; CUNHA, E.L.P. ; CUTOLO, A. A. . Inquérito sorológico para a toxoplasmose em felinos, Botucatu, 1998. In: III Simpósio Nacional de Zoonoses e Animais Peçonhentos, 1998, Guarapari. Anais do III Simpósio Nacional de Zoonoses e Animais Peçonhentos. Brasília: Ministério da Saúde, 1998. p. 146-146.

  • CUNHA, E.L.P. ; LANGONI, H. ; Da SILVA, A. V. . Avaliação da ação do Baypamun em camundongos inoculados com Toxoplasma gondii. In: III Simpósio Nacional de Zoonoses e Animais Peçonhentos, 1998, Guarapari. Anais do III Simpósio Nacional de Zoonoses e Animais Peçonhentos. Brasília: Ministério da Saúde, 1998. p. 147-147.

  • TONIN, F.B. ; Da SILVA, A. V. ; BRESSLAU, S. ; BORGES, C. H. P. ; LANGONI, H. . Toxoplasmosis y leptospirosis en caprinos de Nova Friburgo, Estado de Rio de Janeiro, Brasil: Relación con la aparición de aborto. In: II Congreso Argentino de Zoonosis, I Congreso Argentino de Enfermedades Emergentes, I Congreso Latinoamericano de Enfermedades Emergentes, 1998, Buenos Aires. Anais del II Congreso Argentino de Zoonosis, I Congreso Argentino de Enfermedades Emergentes, I Congreso Latinoamericano de Enfermedades Emergentes. Buenos Aires: Asociacion Argentina de Zoonosis, 1998. p. 87-87.

  • GOTTSCHALK, S. ; MEIRELLES, L.R. ; Da SILVA, A. V. ; LANGONI, H. . Estudo sureoepidemiológico para toxoplasmosis y leptospirosis caprina en la región de Botucatu, Estado de São Paulo, Brasil. In: II Congreso Argentino de Zoonosis, I Congreso Argentino de Enfermedades Emergentes, I Congreso Latinoamericano de Enfermedades Emergentes, 1998, Buenos Aires. Anais del II Congreso Argentino de Zoonosis, I Congreso Argentino de Enfermedades Emergentes, I Congreso Latinoamericano de Enfermedades Emergentes. Buenos Aires: Asociacion Argentina de Zoonosis, 1998. p. 88-88.

  • CUNHA, E.L.P. ; Da SILVA, A. V. ; MEIRELLES, L.R. ; GOTTSCHALK, S. ; MOTA, R. A. ; LANGONI, H. . Sueroepidemiologia de la toxoplasmosis y leptospirosis ovina en el Estado de Pernambuco, Brasil. In: II Congreso Argentino de Zoonosis, I Congreso Argentino de Enfermedades Emergentes, I Congreso Latinoamericano de Enfermedades Emergentes, 1998, Buenos Aires. Anais del II Congreso Argentino de Zoonosis, I Congreso Argentino de Enfermedades Emergentes, I Congreso Latinoamericano de Enfermedades Emergentes. Buenos Aires: Asociacion Argentina de Zoonosis, 1998. p. 89-89.

  • CUNHA, E.L.P. ; Da SILVA, A. V. ; MEIRELLES, L.R. ; GOTTSCHALK, S. ; MOTA, R. A. ; LANGONI, H. . Sueroepidemiologia de la toxoplasmosis y leptospirosis caprina en el Estado de Pernambuco, Brasil. In: II Congreso Argentino de Zoonosis, I Congreso Argentino de Enfermedades Emergentes, I Congreso Latinoamericano de Enfermedades Emergentes, 1998, Buenos Aires. Anais del II Congreso Argentino de Zoonosis, I Congreso Argentino de Enfermedades Emergentes, I Congreso Latinoamericano de Enfermedades Emergentes. Buenos Aires: Asociacion Argentina de Zoonosis, 1998. p. 90-90.

  • LANGONI, H. ; Da SILVA, A. V. ; CABRAL, K.G. ; LISTONI, F.J.P. ; CAMARGO, M. J. B. . Etiologia de la mastitis bovina. In: Congreso Panamericano de Control de Mastitis y Calidad de la Leche, 1998, Merida. Anales del Congreso Panamericano de Control de Mastitis y Calidad de la Leche. Merida, 1998. p. 227-227.

  • LANGONI, H. ; GOTTSCHALK, S. ; MEIRELLES, L.R. ; Da SILVA, A. V. ; GIMENES BOSCO, S.M. ; TONIN, F.B. . Serological behavior of canine leptospirosis. In: XVI Congreso Panamericano de Ciencias Veterinarias, 1998, Santa Cruz de la Sierra. Anales del XVI Congreso Panamericano de Ciencias Veterinarias. Santa Cruz de la Sierra, 1998. p. 240-240.

  • LANGONI, H. ; MEIRELLES, L.R. ; GOTTSCHALK, S. ; CABRAL, K.G. ; GIMENES BOSCO, S.M. ; Da SILVA, A. V. . Serological profile of bovine leptospirosis. In: XVI Congreso Panamericano de Ciencias Veterinarias, 1998, Santa Cruz de la Sierra. Anales del XVI Congreso Panamericano de Ciencias Veterinarias. Santa Cruz de la Sierra, 1998.

  • LANGONI, H. ; GOTTSCHALK, S. ; MEIRELLES, L.R. ; GIMENES BOSCO, S.M. ; Da SILVA, A. V. ; CABRAL, K.G. . Survey on antileptospiric agglutinins in equine species. In: XVI Congreso Panamericano de Ciencias Veterinarias, 1998, Santa Cruz de la Sierra. Annales del XVI Congreso Panamericano de Ciencias Veterinarias. Santa Cruz de la Sierra, 1998. p. 202-202.

  • LANGONI, H. ; HUSNNE, M. ; Da SILVA, A. V. ; MEIRELLES, L.R. ; ARAÚJO, W. N. ; LISTONI, F.J.P. . Use of cefquinome (Cobactam) in bovine mastitis treatment. In: XVI Congreso Panamericano de Ciencias Veterinarias, 1998, Santa Cruz de la Sierra. Annales del XVI Congreso Panamericano de Ciencias Veterinarias. Santa Cruz de la Sierra, 1998. p. 196-196.

  • MEIRELLES, L.R. ; GOTTSCHALK, S. ; Da SILVA, A. V. ; LANGONI, H. . Mastitis in goats: Monitorship of the occurrence and evaluation of diagnostic proofs. In: XVI Congreso Panamericano de Ciencias Veterinarias, 1998, Santa Cruz de la Sierra. Annales del XVI Congreso Panamericano de Ciencias Veterinarias. Santa Cruz de la Sierra, 1998. p. 195-195.

  • Da SILVA, A. V. ; TONIN, F.B. ; CABRAL, K.G. ; LANGONI, H. ; GIUFFRIDA, R. ; SILVA, L. D. . Comparação de Métodos Diagnósticos Indiretos para a Mastite Bovina. In: I Mostra Científica da FMVZ/UNESP/Botucatu, 1997, Botucatu. Anais da I Mostra Científica da FMVZ/UNESP/Botucatu. Botucatu: Faculdade de Medicina Veterinária e Zootecnia, 1997.

  • MENDONÇA, A.O. ; Da SILVA, A. V. ; LANGONI, H. . Estudo do Comportamento Citológico de Três Cepas de Toxoplasma gondii em gerbis (Meriones unguiculatus) submetidos ou não a tratamento com sulfadiazina + pirimetamina. In: I Mostra Científica da FMVZ/UNESP/Botucatu, 1997, Botucatu. Anais da I Mostra Científica da FMVZ/UNESP/Botucatu. Botucatu: Faculdade de Medicina Veterinária e Zootecnia, 1997.

  • LANGONI, H. ; CABRAL, K.G. ; Da SILVA, A. V. ; TONIN, F.B. ; GIMENES, S. M. . Isolamento de Leptospira interrogans sorogrupo canicola a partir da urina de cão. In: XXV Congresso Brasileiro de Medicina Veterinária, 1997, Gramado. Anais do XXV Congresso Brasileiro de Medicina Veterinária. Gramado, 1997. p. 172-172.

  • TONIN, F.B. ; BRESSLAU, S. ; Da SILVA, A. V. ; LANGONI, H. . Inquérito sorológico em caprinos da região de Nova Friburgo, Rio de Janeiro. In: XXV Congresso Brasileiro de Medicina Veterinária, 1997, Gramado. Anais do XXV Congresso Brasileiro de Medicina Veterinária. Gramado, 1997. p. 178-178.

  • LANGONI, H. ; Da SILVA, A. V. ; ROSA, C. ; MARINHO, M. ; LISTONI, F.J.P. . Prevalência de Anticorpos Anti-Toxoplasma em Soros de Ovinos do Estado de São Paulo. In: XXV Congresso Brasileiro de Medicina Veterinária, 1997, Gramado. Anais do XXV Congresso Brasileiro de Medicina Veterinária. Gramado, 1997. p. 179-179.

  • LANGONI, H. ; DEVELEY, A. ; DOMINGUES, Paulo Francisco ; BALDINI, Simone ; Da SILVA, A. V. ; SAVOLDI, F. ; GEORGETTI, F. ; LISTONI, F.J.P. . Eficácia do Leocillin no tratamento da mastite bovina. In: XXV Congresso Brasileiro de Medicina Veterinária, 1997, Gramado. Anais do XXV Congresso Brasileiro de Medicina Veterinária. Gramado, 1997. p. 285-285.

  • Da SILVA, A. V. ; MOREIRA, L. M. ; LANGONI, H. ; FERREIRA, H. . Papel da Salmonella sp na infecção do trato urinário canino. In: XXIV Congresso Brasileiro de Medicina Veterinária, 1996, Goiânia. Anais do XXIV Congresso Brasileiro de Medicina Veterinária. Goiânia: Sociedade Goiânia de Medicina Veterinária, 1996. p. 48-49.

  • KURIBARA, Y. I. ; LANGONI, H. ; CABRAL, K.G. ; BALDINI, Simone ; Da SILVA, A. V. ; S NETO, P. B. . Pesquisa de aglutininas anti-leptospíricas em capivaras (Hydrochoerus hydrochaeris). In: XXIV Congresso Brasileiro de Medicina Veterinária, 1996, Goiânia. Anais do XXIV Congresso Brasileiro de Medicina Veterinária. Goiânia: Sociedade Goiana de Medicina Veterinária, 1996. p. 233-234.

  • LANGONI, H. ; PRESTES, N. C. ; Da SILVA, A. V. ; CORDEIRO, L. A. V. ; MACHADO, G. J. . Etiologia e sensibilidade microbiana na mastite equina. In: XXIV Congresso Brasileiro de Medicina Veterinária, 1996, Goiânia. Anais do XXIV Congresso Brasileiro de Medicina Veterinária. Goiânia: Sociedade Goiana de Medicina Veterinária, 1996. p. 108-108.

  • LANGONI, H. ; DOMINGUES, Paulo Francisco ; PARDO, R. B. ; CHI, K. D. ; Da SILVA, A. V. ; CABRAL, K.G. ; ROSA, C. . Identificação de fungos, leveduras e algas provocando mastite clínica e subclínica em bovinos leiteiros. In: XXIV Congresso Brasileiro de Medicina Veterinária, 1996, Goiânia. Anais do XXIV Congresso Brasileiro de Medicina Veterinária. Goiânia: Sociedade Goiana de Medicina Veterinária, 1996. p. 109-109.

  • Da SILVA, A. V. ; MOREIRA, L. M. ; LANGONI, H. ; FERREIRA, H. . Infecção do trato urinário inferior canino por Salmonela. In: XVIII Congresso Brasileiro de Clínicos Veterinários de Pequenos Animais, 1996, Recife. Anais do XVIII Congresso Brasileiro de Clínicos Veterinários de Pequenos Animais. Recife: Associação Brasileira de Clínicos Veterinários de Pequenos Animais, 1996.

  • LANGONI, H. ; PARDO, R. B. ; CHI, K. D. ; Da SILVA, A. V. ; DOMINGUES, Paulo Francisco ; LISTONI, F.J.P. . Aerobic bacterial flora in bovine mastitis. In: XV Congreso Panamericano de Ciencias Veterinarias, 1996, Campo Grande. Anais do XV Congreso Panamericano de Ciencias Veterinarias. Campo Grande, 1996. p. 229-229.

  • LANGONI, H. ; FAVA, C. ; CABRAL, K.G. ; Da SILVA, A. V. ; CHAGAS, S. A. P. . Epidemiological survey on anti-leptospire agglutinins in buffaloes from Vale do Ribeira. In: XV Congreso Panamericano de Ciencias Veterinarias, 1996, Campo Grande. Anais do XV Congreso Panamericano de Ciencias Veterinarias. Campo Grande, 1996. p. 255-255.

  • CHI, K. D. ; LANGONI, H. ; CARREIRA, W. C. ; Da SILVA, A. V. . Etiology and sensibility of bovine mastitis agents. In: XV Congreso Panamericano de Ciencias Veterinarias, 1996, Campo Grande. Anais do XV Congreso Panamericano de Ciencias Veterinarias. Campo Grande, 1996. p. 259-259.

  • LANGONI, H. ; JULIANO, R. B. ; Da SILVA, A. V. ; CABRAL, K.G. . Investigation of antibody against Leptospira in dogs from Campo Grande, Mato Grosso do Sul State. In: XV Congreso Panamericano de Ciencias Veterinarias, 1996, Campo Grande. Anais do XV Congreso Panamericano de Ciencias Veterinarias. Campo Grande, 1996. p. 267-267.

  • Da SILVA, A. V. ; LANGONI, H. ; DEVELEY, A. ; DOMINGUES, Paulo Francisco ; LUCHEIS, Simone Baldini ; SAVOLDI, F. ; GEORGETTI, F. ; LISTONI, F.J.P. . Mamisin efficacy on bovine mastitis treatment. In: XV Congreso Panamericano de Ciencias Veterinarias, 1996, Campo Grande. Anais do XV Congreso Panamericano de Ciencias Veterinarias. Campo Grande, 1996. p. 271-271.

  • LANGONI, H. ; DOMINGUES, Paulo Francisco ; CHI, K. D. ; PARDO, R. B. ; Da SILVA, A. V. ; CABRAL, K.G. ; ROSA, C. . Participation of yeasts, algae and fungi on bovine mastitis. In: XV Congreso Panamericano de Ciencias Veterinarias, 1996, Campo Grande. Anais do XV Congreso Panamericano de Ciencias Veterinarias. Campo Grande, 1996. p. 275-275.

  • TONIN, F.B. ; LANGONI, H. ; PAES, A. C. ; Da SILVA, A. V. . Prevalence of IBR and BVD/MD in bovine by ELISA test. In: XV Congreso Panamericano de Ciencias Veterinarias, 1996, Campo Grande. Anais do XV Congreso Panamericano de Ciencias Veterinarias. Campo Grande, 1996. p. 277-277.

  • ROSA, C. ; LANGONI, H. ; Da SILVA, A. V. ; MARINHO, M. ; LISTONI, F.J.P. . Prevalence of Toxoplasma antibodies in sheep sera from Sao Paulo State. In: XV Congresso Panamericano de Ciências Veterinárias, 1996, Campo Grande. Anais do XV Congresso Panamericano de Ciências Veterinárias. Campo Grande, 1996. p. 277-277.

  • LANGONI, H. ; Da SILVA, A. V. ; CABRAL, K.G. ; GIMENES, S. M. ; TONIN, F.B. ; LUCHEIS, Simone Baldini . Profile of canine leptospirosis in Botucatu, Sao Paulo State, 1994-1995. In: XV Congresso Panamericano de Ciências Veterinárias, 1996, Campo Grande. Anais do XV Congresso Panamericano de Ciências Veterinárias. Campo Grande, 1996. p. 281-281.

  • LANGONI, H. ; CABRAL, K.G. ; Da SILVA, A. V. ; GIMENES, S. M. ; TONIN, F.B. . Seroepidemiologic survey on anti-leptospira agglutinins in equine sera between 1992-1996. In: XV Congresso Panamericano de Ciências Veterinárias, 1996, Campo Grande. Anais do XV Congresso Panamericano de Ciências Veterinárias. Campo Grande, 1996. p. 286-286.

  • KURIBARA, I. Y. ; LANGONI, H. ; CABRAL, K.G. ; Da SILVA, A. V. ; LUCHEIS, Simone Baldini ; ROSA, C. ; S NETO, P. B. . Serological survey for Leptospira and Toxoplasma antibodies in capybaras (Hydrochoerus hydrochaeris). In: XV Congresso Panamericano de Ciências Veterinárias, 1996, Campo Grande. Anais do XV Congresso Panamericano de Ciências Veterinárias. Campo Grande, 1996. p. 287-287.

  • PAES, A. C. ; LANGONI, H. ; Da SILVA, A. V. ; GIUFFRIDA, R. ; ROSA, C. ; MORAES, C. ; GOULART, C. . Toxoplasmose em cães de caça alimentados com vísceras cruas de animais silvestres - Descrição de um caso. In: XV Congresso Panamericano de Ciências Veterinárias, 1996, Campo Grande. Anais do XV Congresso Panamericano de Ciências Veterinárias. Campo Grande, 1996. p. 291-291.

  • LANGONI, H. ; SOUZA, L.C. ; LUVIZOTTO, M. C. R. ; PAES, A. C. ; BALDINI, Simone ; Da SILVA, A. V. . Comportamiento serologico pareado frente a diferentes sorovares de leptospira em femeas bovinas, no aborto e apos este e sua correlacao com o exame microbiologico e histopatologico. In: IV Congreso Nacional de Higiene y Epidemiologia y I Congreso Nacional de Infectologia, 1996, Havana. Anales del IV Congreso Nacional de Higiene y Epidemiologia y I Congreso Nacional de Infectologia. Havana, 1996. p. 142-142.

  • LANGONI, H. ; PULGA, M. E. ; DOMINGUES, Paulo Francisco ; Da SILVA, A. V. . Eficácia da enrofloxacina (Baytril) no tratamento da mastite aguda de origem ambiental. In: XVIII Congresso Brasileiro de Microbiologia, 1995, Santos. Anais do XVII Congresso Brasileiro de Microbiologia, 1995.

  • LANGONI, H. ; Da SILVA, A. V. ; CABRAL, K.G. . Etiologia e sensibilidade antimicrobiana nas pneumonias caninas. In: XIX Jornada Científica da Associação dos Docentes da UNESP Campus de Botucatu, 1995, Botucatu. Anais da XIX Jornada Científica da Associação dos Docentes da UNESP Campus de Botucatu. Botucatu: Associação dos Docentes da UNESP Campus de Botucatu, 1995. p. 56-56.

  • LANGONI, H. ; MARINHO, M. ; BALDINI, Simone ; Da SILVA, A. V. ; CABRAL, K.G. ; SILVA, E. D. . Pesquisa de aglutininas antileptospíricas em soros de ovinos no Estado de São Paulo, 1994, utilizando as provas de macroaglutinação em placa e soroaglutinação microscópica. In: XIX Jornada Científica da Associação dos Docentes, 1995, Botucatu. Anais da XIX Jornada Científica da Associação dos Docentes. Botucatu: Associação dos Docentes, 1995. p. 15-15.

  • LANGONI, H. ; PAES, A. C. ; TONIN, F.B. ; Da SILVA, A. V. ; DENARDI, M. B. . Prevalência da BVD/MD, IBR e PI3 pelo teste de ELISA em bovinos. In: V Virológica - Encontro de Virologia, 1995, Ribeirão Preto. Anais do V Virológica. Ribeirão Preto: Sociedade Brasileira de Virologia, 1995.

  • LANGONI, H. ; Da SILVA, A. V. . Comportamento sorológico de aglutininas anti-brucela em soro de equídeos. In: I Congresso de Medicina Equina, 1994, São Paulo. Anais do I Congresso de Medicina Equina. São Paulo, 1994.

  • LANGONI, H. ; Da SILVA, A. V. ; RASMUSSEN, R. ; BALDINI, Simone ; UTIDA, A. L. Y. . Contribuição ao estudo da etiologia da pneumonia na espécie equina. In: I Congresso de Medicina Equina, 1994, São Paulo. Anais do I Congresso de Medicina Equina. São Paulo, 1994. p. 212-212.

  • LANGONI, H. ; PIMENTEL, V. L. ; BALDINI, Simone ; PAES, A. C. ; Da SILVA, A. V. ; SAKAMOTO, C. ; LIMA, A. P. ; LISTONI, F.J.P. ; SPAGO, N. ; CAMARGO, M. J. B. . Animais de laboratório como reservatórios de Salmonella sp. In: IV Congresso Brasileiro de Animais de Laboratório, 1994, Guarujá. Anais do IV Congresso Brasileiro de Animais de Laboratório. Guarujá: Sociedade Brasileira de Experimentação Animal, 1994. p. 82-82.

  • LANGONI, H. ; BALDINI, Simone ; DOMINGUES, Paulo Francisco ; Da SILVA, A. V. ; CAMARGO, M. J. B. . Dinâmica da flora microbiana na mastite bovina subclínica. In: XXIII Congresso Brasileiro de Medicina Veterinária, 1994, Olinda. Anais do XXIII Congresso Brasileiro de Medicina Veterinária, 1994. p. 139-139.

  • BALDINI, Simone ; LANGONI, H. ; PULGA, M. E. ; Da SILVA, A. V. ; CURY, P. R. . Ação in vitro do Klorvet/Aquatabs. In: XXIII Congresso Brasileiro de Medicina Veterinária, 1994, Olinda. Anais do XXIII Congresso Brasileiro de Medicina Veterinária, 1994. p. 184-184.

  • PADOVANNI, C. F. ; Da SILVA, A. V. ; RANZANI, J. J. T. . Úlcera de córnea: Estudo retrospectivo (1982-1992) em cães e gatos atendidos no Hospital Veterinário da FMVZ - UNESP - Botucatu. In: VI Congresso de Iniciação Científica da UNESP, 1994, Guaratinguetá. Anais do VI Congresso de Iniciação Científica da UNESP. São Paulo: Universidade Estadual Paulista, 1994. p. 278-278.

  • ROSA, C. ; Da SILVA, A. V. ; CHANDE, C. G. ; ALBERTO, E. L. ; NEVES, I. R. ; VASCONCELOS, J. L. M. . Levantamento dos principais microrganismos isolados de material uterino de vacas no período do puerpério e sua sensibilidade aos antibióticos. In: VI Congresso de Iniciação Científica da UNESP, 1994, Guaratinguetá. Anais do VI Congresso de Iniciação Científica da UNESP. São Paulo: Universidade Estadual Paulista, 1994. p. 277-277.

  • LANGONI, H. ; Da SILVA, A. V. . Comportamento sorológico de aglutininas anti-brucela em soro de equídeos. In: XIV Congreso Panamericano de Ciencias Veterinarias, 1994, Acapulco. Anais del XIV Congreso Panamericano de Ciencias Veterinarias. Acapulco, 1994. p. 94-94.

  • Da SILVA, A. V. ; LANGONI, H. ; SAKAMOTO, C. ; BALDINI, Simone ; HOMEM, V. S. F. ; LISTONI, F.J.P. ; CAMARGO, M. J. B. . Etiologia e sensibilidade antimicrobiana em casos de infecção urinária em cães. In: V Congresso de Iniciação Científica da UNESP, 1993, Bauru. Anais dos V Congresso de Iniciação Científica da UNESP. São Paulo: Universidade Estadual Paulista, 1993. p. 241-241.

  • FERREIRA, H. ; BALDINI, Simone ; Da SILVA, A. V. ; LISTONI, F.J.P. ; LANGONI, H. . Ação in vitro do EDTA-Tris a microrganismos Gram-negativos. In: V Congresso de Iniciação Científica da UNESP, 1993, Bauru. Anais do V Congresso de Iniciação Científica da UNESP. São Paulo: Universidade Estadual Paulista, 1993. p. 241-241.

  • LANGONI, H. ; SAKAMOTO, C. ; Da SILVA, A. V. ; BALDINI, Simone ; HOMEM, V. S. F. ; LISTONI, F.J.P. ; CAMARGO, M. J. B. . Contribuição ao estudo da etiologia da infecção urinária em cães. In: XVIII Jornada Científica da Associação dos Docentes do Campus de Botucatu, 1993, Botucatu. Anais da XVIII Jornada Científica da Associação dos Docentes do Campus de Botucatu. Botucatu: Associação dos Docentes do Campus de Botucatu, 1993. p. 164-164.

  • LANGONI, H. ; Da SILVA, A. V. ; MOMI, T. ; FREITAS, M. J. S. . O médico veterinário como agente de saúde pública. In: XVIII Jornada Científica da Associação dos Docentes do Campus de Botucatu, 1993, Botucatu. Anais da XVIII Jornada Científica da Associação dos Docentes do Campus de Botucatu. Botucatu: Associação dos Docentes do Campus de Botucatu, 1993. p. 328-328.

  • Da SILVA, A. V. ; SABINO, E. C. ; VICENTINI, F. ; BESSA JUNIOR, J. ; SILVA, M. F. . Produção do conhecimento em tempos pandêmicos. 2021. (Apresentação de Trabalho/Simpósio).

  • Silva, Aristeu Vieira da ; CORDEIRO, M. . Papel do Médico Veterinário numa Perspectiva de Saúde ùnica - Experiências de um Centro de Controle de Zoonoses. 2020. (Apresentação de Trabalho/Conferência ou palestra).

  • Silva, Aristeu Vieira da . Toxoplasmose em Felinos. 2020. (Apresentação de Trabalho/Conferência ou palestra).

  • DA SILVA, A.V. . Zoonoses 2045. 2018. (Apresentação de Trabalho/Outra).

  • DA SILVA, A.V. . Conversas Intestinais: você conhece o seu microbioma?. 2018. (Apresentação de Trabalho/Outra).

  • DA SILVA, A.V. . Portal do Sertão: as veredas da pós-graduação na UEFS. 2017. (Apresentação de Trabalho/Conferência ou palestra).

  • DA SILVA, A.V. . A esquistossomose e seus ciclos. 2017. (Apresentação de Trabalho/Conferência ou palestra).

  • DA SILVA, A.V. . Desafios da Pós-Graduação na UEFS: Conjunturas e Perspectivas. 2016. (Apresentação de Trabalho/Conferência ou palestra).

  • DA SILVA, A.V. . Avaliação dos Curso de Pós-Graduação. 2016. (Apresentação de Trabalho/Conferência ou palestra).

  • DA SILVA, A.V. . Agentes zoonóticos em animais slvestres e vetores associados no Estado da Bahia. 2016. (Apresentação de Trabalho/Conferência ou palestra).

  • DA SILVA, A.V. . Redes de contato e transmissão de doenças por via hídrica. 2016. (Apresentação de Trabalho/Conferência ou palestra).

  • DA SILVA, A.V. . De paixões, saberes e outros causos: da formação à carreira, um estudo de caso. 2015. (Apresentação de Trabalho/Conferência ou palestra).

  • DA SILVA, A.V. . O Sistema Nacional de Pós-Graduação e a Pós-Graduação na UEFS. 2015. (Apresentação de Trabalho/Conferência ou palestra).

  • DA SILVA, A.V. . Onde estamos? Para onde podemos ir? Conhecer e Inovar com o Conceito de One Health. 2015. (Apresentação de Trabalho/Conferência ou palestra).

  • DA SILVA, A.V. . A Pós-Graduação na UEFS e o Sistema Nacional de Pòs-Graduação: onde estamos e para onde vamos?. 2015. (Apresentação de Trabalho/Conferência ou palestra).

  • Da SILVA, A. V. . A Pesquisa Científica no Brasil e a Pós-Graduação na UEFS. 2014. (Apresentação de Trabalho/Conferência ou palestra).

  • DA SILVA, A.V. . Dicas para a elaboração de textos acadêmicos. 2013. (Apresentação de Trabalho/Conferência ou palestra).

  • ROSA, R. C. ; MATTEI, R. J. ; PIASSA, F.R. ; ARAÚJO, J. B. ; da SILVA, R. C. ; PEREIRA, V. B. R. ; LANGONI, H. ; Su, Chunlei ; DA SILVA, A.V. . Genotyping of Toxoplasma gondii isolates in free-range chickens from brazilian certified pig farms. 2013. (Apresentação de Trabalho/Simpósio).

  • DA SILVA, A.V. . Zoonoses transmitidas por Água e Alimentos. 2013. (Apresentação de Trabalho/Conferência ou palestra).

  • Da SILVA, A. V. ; Soares, R.M. ; GALLI, S. ; PENA, H. F. J. . Genotyping of Toxoplasma gondii isolated from chickens from Mato Grosso do Sul State, Brazil: Preliminary results. 2008. (Apresentação de Trabalho/Congresso).

  • MARQUES, J. M. ; SILVA, D. V. ; CORRÊA, N.B. ; VELAZQUES, L.G. ; LUCAS, T. M. ; ZAMPROGNA, T. O. ; GUERRA, I.M.G. ; DALMOLIN, A. ; ROSA, R. C. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Study of toxoplasmosis in a rural community of Eldorado, MS, Brazil. 2008. (Apresentação de Trabalho/Congresso).

  • GALLI, S. ; LUCAS, T. M. ; da SILVA, R. C. ; LANGONI, H. ; Da SILVA, A. V. . Antibody detection and iolation of Toxoplasma gondii from chickens from a rural community from Mat Grosso do Sul, Brazil. 2008. (Apresentação de Trabalho/Congresso).

  • Da SILVA, A. V. ; AIGNER, C.P. ; SANDRINI, F. . Quantificação de Toxoplasma gondii pela PCR em tempo real em tecidos de galinhas soropositivas criadas extensivamente no Paraná. 2008. (Apresentação de Trabalho/Congresso).

  • MACHADO, J.G. ; HOFFMANN, J.L. ; KRAUSE, V.L.K. ; GAIO, F.C. ; Da SILVA, A. V. ; DIAS-MELICIO, L.A. ; LANGONI, H. . Resposta imune celular frente à inoculação de L. chagasi em camundongos BALB/c imunossuprimidos. 2008. (Apresentação de Trabalho/Congresso).

  • Da SILVA, A. V. ; MANZANO, M. A. ; BERNART, G. . Educando pela pesquisa: O caso da disciplina de Parasitologia Veterinária. 2006. (Apresentação de Trabalho/Congresso).

  • Da SILVA, A. V. ; BOTTIN, J.M.P. ; LÍVERO, F.A.R. ; BELINATO, F. C. ; BASTOS JÚNIOR, E.A. ; GUERRA, I.M.G. ; da SILVA, R. C. ; LANGONI, H. . Avaliação de parâmetros hematológicos em cães negativos ou positivos para a presença de anticorpos séricos anti-Toxoplasma gondii. 2006. (Apresentação de Trabalho/Congresso).

  • DREER, M. K. P. ; RIVA, E. ; MARTINS, E.V. ; ISBRESCHT, F.B. ; Da SILVA, A. V. . Detecção de anticorpos anti-Toxoplasma gondii em soros de suínos abatidos em Umuarama, PR. 2005. (Apresentação de Trabalho/Congresso).

  • Da SILVA, A. V. ; HENKES, Sheila Do Carmo ; MESSA, V. . Larvas de ancilostomídeos em praças públicas de Umuarama - PR. 2005. (Apresentação de Trabalho/Congresso).

  • Da SILVA, A. V. ; BOARETO, H. ; NEIVERTH, K. P. ; BOTTIN, J.M.P. ; LÍVERO, F.A.R. ; da SILVA, R. C. ; GONÇALVES, G.F. ; LANGONI, H. . Perfil hematológico de cães sorologicamente positivos ao Toxoplasma gondii. 2005. (Apresentação de Trabalho/Congresso).

  • Da SILVA, A. V. ; MENDONÇA, A.O. ; PEZERICO, S.B. ; DOMINGUES, Paulo Francisco ; LANGONI, H. . Genotipagem de cepas de Toxoplasma gondii isoladas de lingüiças frescas preparadas com carne suína. 2004. (Apresentação de Trabalho/Congresso).

  • SANCHES, A.W.D. ; HEADLEY, Selwyn Arhligton ; CASTRO, M. ; VASCONCELOS, W. ; Da SILVA, A. V. . Encephalitozoon in a goat. 2004. (Apresentação de Trabalho/Congresso).

  • Da SILVA, A. V. ; MENDONÇA, A.O. ; PEZERICO, S.B. ; DOMINGUES, Paulo Francisco ; LANGONI, H. . Genotipagem de cepas de Toxoplasma gondii detectadas emlingüiça frescal suína. 2004. (Apresentação de Trabalho/Congresso).

  • Da SILVA, A. V. . Curso de Educação Ambiental à Distância "Educação Ambiental: Princípios e Práticas". 2002. (Apresentação de Trabalho/Congresso).

  • Da SILVA, A. V. ; MANZANO, M. A. ; TEIXEIRA, C. R. ; DINIZ, R. E. S. . Utilização da World Wide Web (WWW) como fonte de recursos em educação ambiental. 2001. (Apresentação de Trabalho/Congresso).

  • Da SILVA, A. V. ; GIMENES BOSCO, S.M. ; BAGAGLI, E. ; LANGONI, H. . Toxoplasma gondii em animais silvestres: sorologia e isolamento do parasita. 2000. (Apresentação de Trabalho/Congresso).

  • LANGONI, H. ; ARAÚJO, W. N. ; Da SILVA, A. V. ; SOUZA, L.C. . Ação da enrofloxacina e amoxacilina sós e em associação no tratamento da mastite bovina. 1999. (Apresentação de Trabalho/Congresso).

  • MENDONÇA, A.O. ; Da SILVA, A. V. ; LANGONI, H. . Estudo do comportamento citológico de três cepas de Toxoplasma gondii em gerbis (Meriones unguiculatus) submetidos ou não a tratamento com sulfadiazina + pirimetamina. 1997. (Apresentação de Trabalho/Congresso).

  • Da SILVA, A. V. ; TONIN, F.B. ; CABRAL, K.G. ; LANGONI, H. ; GIUFFRIDA, R. ; SILVA, L. D. . Comparação de métodos diagnósticos indiretos para a mastite bovina. 1997. (Apresentação de Trabalho/Congresso).

  • Da SILVA, A. V. . Etiologia e perfil da sensibilidade microbiana na mastite eqüina. 1996. (Apresentação de Trabalho/Congresso).

  • Da SILVA, A. V. . Etiologia e sensibilidade antimicrobiana nas pneumonias caninas. 1995. (Apresentação de Trabalho/Congresso).

  • Da SILVA, A. V. . Papel das infecções bacterianas nas pneumonias de leitões: Estudo retrospectivo de 6 anos. 1995. (Apresentação de Trabalho/Congresso).

  • Da SILVA, A. V. . Eficácia da enrofloxacina (Baytril) no tratamento da mastite bovina aguda de origem ambiental. 1995. (Apresentação de Trabalho/Congresso).

  • LANGONI, H. ; PULGA, M. E. ; DOMINGUES, Paulo Francisco ; Da SILVA, A. V. . Eficácia da enrofloxacina (Baytril) no tratamento da mastite bovina aguda de origem ambiental. 1995. (Apresentação de Trabalho/Congresso).

  • Da SILVA, A. V. . Contribuição ao estudo da etiologia da pneumonia na espécie equina. 1994. (Apresentação de Trabalho/Congresso).

  • Da SILVA, A. V. . Comportamento sorológico de aglutininas anti-Brucella em soros de eqüideos. 1994. (Apresentação de Trabalho/Congresso).

  • ALMEIDA, N. L. F. ; da Silva, Aristeu V. . Anais de Resumos [do] XVI Seminário de Iniciação Científica da UEFS: Sustentabilidade, economia verde e erradicação da pobreza. Feira de Santana: Universidade Estadual de Feira de Santana, 2012 (Organização de Anais de Eventos).

  • RIBEIRO, M.G. ; BELONI, Suely Nunes ; LANGONI, H. ; Da SILVA, A. V. ; MENZ, I. . Leptospirose. Campinas: Fort Dodge Animal Health, 2003 (Boletim Técnico).

Outras produções

da Silva, Aristeu V. . Avaliação de Relatórios de Pesquisa da UEFS ano base 2019. 2021.

DA SILVA, A.V. . Emissão de parecer ao processo CNPq xxxxxx/2020-x (PDJ2020). 2021.

Da SILVA, A. V. . Emissão de parecer ao processo CNPq xxxxxx/2020-x (PDJ2019). 2020.

DA SILVA, A.V. . Emissão de parecer ao processo CNPq xxxxxx/2020-x (PQ2020). 2020.

Da SILVA, A. V. . Parecer de artigo enviado para publicação no periódico Brazilian Journal of Veterinary Parasitology. 2019.

DA SILVA, A.V. . Parecer de resumos enviados ao II Encontro Brasileiro de Protozoologia Veterinária. 2017.

DA SILVA, A.V. . Assessor Ad hoc do Programa de Iniciação Científica da UEFS. 2017.

DA SILVA, A.V. . Emissão de parecer ao processo CNPq XXXXXX/2017-9. 2017.

DA SILVA, A.V. . Parecer de processo CEUA xxx/2017. 2017.

DA SILVA, A.V. . Parecer de artigo enviado para publicação no períodico Parasitology International. 2017.

DA SILVA, A.V. . Emissão de parecer ao processo CNPq XXXXXX/2017-5. 2017.

DA SILVA, A.V. . Emissão de parecer ao processo CNPq XXXXXX/2017-4. 2017.

DA SILVA, A.V. . Emissão de parecer ao processo CNPq XXXXXX/2017-6. 2017.

DA SILVA, A.V. . Parecer ao Processo CNPq no. xxxxxx/2015-1. 2016.

DA SILVA, A.V. . Parecer ao Processo PCDR/FAPEAL/CNPq. 2016.

DA SILVA, A.V. . Emissão de pareceres ao Edital Universal CNPq 2016. 2016.

DA SILVA, A.V. . Parecer de artigo enviado ao periodico Revista da Sociedade Brasileira de Medicina Tropical. 2016.

Da SILVA, A. V. . Parecer de artigo enviado para o período Acta Parasitologica. 2015.

Da SILVA, A. V. . Parecer de artigo enviado para a revista Experimental Parasitology. 2015.

Da SILVA, A. V. . Parecer de processo de solicitação de recursos. 2015.

DA SILVA, A.V. . Parecer ao processo CNPq xxxxxx/2015-3. 2015.

DA SILVA, A.V. . Parecer ao processo CNPq xxxxxx/2015-3. 2015.

DA SILVA, A.V. . Parecer ao processo CNPq xxxxxx/2015-3. 2015.

DA SILVA, A.V. . Avaliação de evento de iniciação científica (UESC). 2015.

DA SILVA, A.V. . Emissão de Pareceres do Programa Institucional de Iniciação Científica - PROBIC. 2013.

DA SILVA, A.V. . Assessor ad-hoc do Edital 04/2013 - Programa Pesquisa para o Sistema Único de Saúde: Gestão Compartilhada em Saúde - 2012. 2013.

da Silva, Aristeu V. . Assessor Ad hoc do Programa de Iniciação Científica FAPESB/UEFS. 2012.

ALMEIDA, N. L. F. ; BOMFIM, T. ; ASSIS, M. M. A. ; da Silva, Aristeu V. . Membro da Comissão Científica do XVI SEMIC - Seminário de Iniciação Científica da UEFS. 2012.

da Silva, Aristeu V. . Avaliador de trabalhos (modalidade pôster) da sessão de Saúde no XVI SEMIC-UEFS. 2012.

da Silva, Aristeu V. . Avaliador de trabalhos (modalidade pôster) da sessão de Biologia no XVI SEMIC-UEFS. 2012.

da Silva, Aristeu V. . Avaliador de trabalhos (modalidade oral) da sessão de Biologia no XVI SEMIC-UEFS. 2012.

DA SILVA, A.V. . Parecer de processo CEUA 007/2012. 2012.

Da SILVA, A. V. . Parecer de artigo enviado para a Revista Brasileira de Saúde e Produção Animal. 2011.

Da SILVA, A. V. . Parecerista dos projetos de monografia do componente curricular BIO611 - Trabalho de Conclusão de Curso I. 2011.

Da SILVA, A. V. . Consultoria Ad hoc do Processo Seletivo 2011/2012 do Programa Institucional de Iniciação Científica e Tecnológica da UFG. 2011.

DA SILVA, A.V. . Parecer de processo CEUA 006/2011. 2011.

Da SILVA, A. V. . Consultor ad hoc da Fundação Araucária para análise de projetos da Chamada 08/2010 - Programa de Pesquisa para o SUS. 2010.

Da SILVA, A. V. . Membro da Comissão Científica do XV Congresso Brasileiro de Parasitologia Veterinária. 2008.

Da SILVA, A. V. . Consultor ad hoc durante o VII Encontro de Iniciação Científica e VII Fórum de Pesquisa da UNIPAR. 2008.

Da SILVA, A. V. . Consultor ad hoc para Avaliação de Projetos de Pesquisa na Chamada Pública 25/2006 - Programa de Pesquisa para o SUS: Gestão Compartilhada em Saúde 2006/2007. 2007.

Da SILVA, A. V. . Análise estatística da tese de doutorado ?Detecção molecular de Streptococcus agalactiae em amostras de leite bovino obtidas de tanques de expansão?. 2007.

Da SILVA, A. V. ; SHIMABUKURO, F.H. . Análise estatística da tese de doutorado "Avaliação sorológica e detecção molecular de leptospiras em tecidos de camundongos experimentalmente infectados com estirpes patogênicas de Leptospira interrogans sorovar Pomona e Canicola". 2007.

Da SILVA, A. V. . Análise estatística do trabalho de Iniciação Científica "Utilização de composto homeopático no tratamento e controle da mastite bovina". 2007.

Da SILVA, A. V. . Recomendação do tratamento estatístico para o projeto de dissertação ?Acompanhamento da evolução da infecção por Leptospira spp e Neospora caninum, em rebanho bovino leiteiro: avaliação dos aspectos produtivos e reprodutivos?. 2007.

Da SILVA, A. V. . Análise estatístca para o trabalho de pesquisa ?Associação entre a infecção por Leishmania spp e Neospora caninum em cães?. 2007.

Da SILVA, A. V. . Análise estatística da dissertação de Mestrado ?Contribuição para elucidação diagnóstica na leishmaniose visceral canina como ferramenta para a vigilância epidemiológica e controle desta zoonose?. 2007.

Da SILVA, A. V. . Análise estatística da tese de Doutorado ?Infecção experimental para a avaliação da resposta imune celular frente à inoculação de Leishmania chagasi em camundongos BALB/c imunossuprimidos?. 2007.

Da SILVA, A. V. . Recomendação de tratamento estatístico para o projeto de dissertação. 2007.

Da SILVA, A. V. . Análise estatística do projeto de pesquisa ?Toxoplasmose em eqüinos na região de Botucatu, SP?. 2007.

Da SILVA, A. V. . Consultor ad hoc para avaliação de resumos do VI Encontro de Iniciação Científica e VI Fórum de Pesquisa da Universidade Paranaense. 2007.

Da SILVA, A. V. . Consultor ad hoc para Avaliação de Resumos enviados para apresentação durante o IV Encontro de Iniciação Científica, IV Fórum de Pesquisa da UNIPAR e II Encontro Paranaense de Ética. 2005.

Da SILVA, A. V. . Membro da Comissão Científica da XIV Jornada Farmacêutica de Umuarama. 2005.

Da SILVA, A. V. . Análise de dados de experimentos & Determinação de número de amostras. 2004.

Da SILVA, A. V. . Consultor ad hoc para Avaliação de Resumos enviados para apresentação durante a VII Jornada de Enfermagem. 2004.

TOSTES, Raimundo Alberto ; Da SILVA, A. V. . Análise estatística do projeto "Avaliação histológica da fibrose na doença hepática crônica canina: análise semiquantitativa por escores, análise digital morfométrica e detecção imunoistoquímica de adenovírus canino tipo 1 (CAV-1)". 2003.

Da SILVA, A. V. . Análise estatística do projeto "Achados epidemiológicos, clínicos e hematológicos e compração de técnicas para diagnóstico de Ehrlichia canis". 2003.

DA SILVA, A.V. . Pareceres de Planos de Trabalho de Iniciação Científica ou em Desenvolvimento Tecnológico e Inovação. 2016.

DA SILVA, A.V. . Parecer de artigo enviado para o periódico Transboundary and Emerging Diseases. 2016.

DA SILVA, A.V. . Parecer de artigo enviado para publicação na Revista Brasileira de Ornitologia. 2013.

DA SILVA, A.V. . Parecer de artigo enviado para publicação no periódico BMC Infectious Diseases. 2013.

DA SILVA, A.V. . Avaliador de trabalhos (modalidade oral) da sessão de Biologia durante o XVII SEMIC/UEFS. 2013.

DA SILVA, A.V. . Avaliador de trabalhos (modalidade oral) da sessão de Biologia durante o XVII SEMIC/UEFS. 2013.

DA SILVA, A.V. . Avaliador de trabalhos (modalidade oral) da sessão de Biologia durante o XVII SEMIC/UEFS. 2013.

DA SILVA, A.V. ; BARRETO, A. C. C. . Monitor na I Etapa (Prova Escrita) da Seleção 2013 do Mestrado Profissional em Saúde Coletiva. 2013.

SILVA, A. C. G. ; ALMEIDA, A. M. ; da Silva, Aristeu V. ; OLIVEIRA, C. E. C. ; JULIANO, I. A. ; CRUZ, R. C. ; PEREIRA, R. E. A. ; SILVA, O. A. ; FREITAS, V. S. . Relatório do Recredenciamento da Universidade Estadual de Feira de Santana. 2012.

da Silva, Aristeu V. . Parecer de artigo submetido ao periódico Pesquisa Veterinária Brasileira. 2011.

Da SILVA, A. V. . Parecer de artigo enviado para o periódico Arquivos do MUDI (ISSN 1414-7149). 2011.

Da SILVA, A. V. . Parecer de artigo submetido ao periódico The Journal of Parasitology. 2011.

Da SILVA, A. V. . Parecer de artigo enviado para o Brazilian Journal of Microbiology. 2011.

Da SILVA, A. V. . Parecer de artigo enviado para a revista Ciência Rural. 2011.

Da SILVA, A. V. . Parecer de artigos enviados para apresentação no XV SEMIC-UEFS. 2011.

Da SILVA, A. V. . Parecer de projetos de pesquisa de Iniciação Científica (PIBIC UEFS 2011-2012). 2011.

Da SILVA, A. V. . Parecer para artigo enviado para o periódico Annals of Brazilian Academies of Science. 2010.

Da SILVA, A. V. . Parecer para artigo enviado para o periódico Brazilian Journal of Microbiology. 2010.

Da SILVA, A. V. . Avaliador de trabalhos das sessões orais no XIV Seminário de Iniciação Científica da UEFS. 2010.

Da SILVA, A. V. . Avaliador de trabalhos das sessões de pôsteres no XIV Seminário de Iniciação Científica da UEFS. 2010.

Da SILVA, A. V. . Avaliação de Relatório Final do Programa Institucional de Bolsa de Iniciação Científica FAPESB/UESF. 2010.

Da SILVA, A. V. . Parecer de artigo submetido ao periódico The Journal of Parasitology. 2010.

Da SILVA, A. V. . Parecer de artigo submetido ao periódico The Journal of Parasitology. 2010.

Da SILVA, A. V. . Parecerista dos projetos de monografia do componente curricular Trabalho de Conclusão de Curso I. 2010.

Da SILVA, A. V. . Coordenador da Sessão 2 de temas livres na área de Ciências Agrárias durante o 8o Encontro de Iniciação Científica. 2009.

Da SILVA, A. V. . Consultor ad hoc para Emissão de Parecer de relatório final de projeto de pesquisa - FUNTEC/SEDECT/PA. 2008.

Da SILVA, A. V. . Coordenador da Sessão 02 de Temas Livres da Área de Ciências Agrárias durante o VII Encontro de Iniciação Científica e VII Fórum de Pesquisa da UNIPAR. 2008.

Da SILVA, A. V. . Coordenador da Sessão 02 de Temas Livres na Área de Ciências Agrárias durante o VI Encontro de Iniciação Científica e VII Fórum de Pesquisa da UNIPAR e. 2007.

Da SILVA, A. V. ; TAVARES, C.R.G. ; SHIKIDA, Sonia Aparecida Reis Lopes ; FIGO, B. P. D. ; CORTEZ, D.A.G. ; MOYSÉS, Samuel Jorge . Consultor ad hoc no Comitê Técnico de Avaliação e Julgamento dos projetos relativos à Chamada Pública Vigilância em Saúde. 2004.

Da SILVA, A. V. . Projeto Parceria. 1994.

Da SILVA, A. V. . Campanha de Vacinação Anti-Rábica Urbana. 1993.

Da SILVA, A. V. . Campanha de Vacinação Anti-Rábica. 1993.

CARVALHO, F. M. ; MAZO, E. M. ; NETTO, D. L. ; OLIVEIRA NETO, A. ; OLIVEIRA, G. L. ; CUNHA, L. R. P. ; Da SILVA, A. V. . Seminário Estratégia Bahia de Ciência, Tecnologia e Inovação. 2018. (Programa de rádio ou TV/Mesa redonda).

Da SILVA, A. V. ; CORDEIRO, M. C. S. ; CORREIA, J. E. ; COSTA, M. F. ; SANTOS, E. M. R. ; NASCIMENTO, P. M. V. O. ; NILSSON, M. G. ; MELO, M. O. . Canal Zoonoses e Saúde Pública. 2020; Tema: Zoonoses e Saúde Pública. (Rede social).

Da SILVA, A. V. ; NILSSON, M. G. ; COSTA, M. F. ; CORREIA, J. E. ; SANTOS, E. M. R. ; NASCIMENTO, P. M. V. O. ; MELO, M. O. ; CORDEIRO, M. C. S. . Grupo de Pesquisa em Zoonoses e Saúde Pública. 2018; Tema: Zoonoses e Saúde Pública. (Rede social).

Da SILVA, A. V. ; von SOHSTEN, A. L. ; CORREIA, J. E. . Grupo de Pesquisa em Zoonoses e Saúde Pública. 2015; Tema: Zoonoses. (Rede social).

Da SILVA, A. V. ; GRANJEIRO, E. M. ; CORREIA, J. E. ; NOVAIS, M. T. C. ; LIMA, E. V. R. . Descobrindo a Ciência pela Parasitologia. 2012; Tema: Alfabetização científica. (Rede social).

da Silva, Aristeu V. ; CORREIA, J. E. ; SILVA, P. C. ; NOVAIS, M. T. C. ; ARAÚJO, L.P. . Descobrindo a Ciência pela Parasitologia. 2011; Tema: Educação Científica. (Blog).

ASSIS, M. M. A. ; da Silva, Aristeu V. . Seminário Avançado: Produção Textual e Redação Científica. 2012. (Curso de curta duração ministrado/Outra).

DA SILVA, A.V. . EndNote Web na Formatação de Referências Bibliográficas. 2012. (Curso de curta duração ministrado/Outra).

MANZANO, M. A. ; Da SILVA, A. V. ; CÂMARA, P. . Apostila: Vamos tocar flauta doce - Caderno I. 2010. (Desenvolvimento de material didático ou instrucional - Apostila).

Da SILVA, A. V. . Elaboração do Currículo Lattes. 2009. (Curso de curta duração ministrado/Outra).

Da SILVA, A. V. . Mini-Curso: Interação Parasito-Hospedeiro na Toxoplasmose. 2006. (Curso de curta duração ministrado/Outra).

LINDE, G. A. ; Da SILVA, A. V. ; DRAGUNSKY, D. . Interdisciplinaridade e Pesquisa. 2006. (Curso de curta duração ministrado/Outra).

Da SILVA, A. V. . Diapositivos: Parasitologia Geral - Introdução à Parasitologia Médica. 2005. (Desenvolvimento de material didático ou instrucional - Diapositivos).

Da SILVA, A. V. . Diapositivos: Parasitologia Geral - Amebíase. 2005. (Desenvolvimento de material didático ou instrucional - Diapositivos).

Da SILVA, A. V. . Pareceres sobre projetos de pesquisa - CNPq. 2005. (Consultoria Ad Hoc).

Da SILVA, A. V. . Pareceres sobre projetos de pesquisa para a Fundação Araucária de Apoio ao Desenvolvimento Científico e Tecnológico do Paraná. 2004. (Consultoria Ad Hoc).

LANGONI, H. ; Da SILVA, A. V. ; PEZERICO, S.B. ; da SILVA, R. C. ; CASTRO, A. P. B. C. . Curso de Extensão à Distância - Zoonoses e Saúde Pública. 2003. (Curso de curta duração ministrado/Extensão).

TOZONI-REIS, M.F.C. ; Da SILVA, A. V. . Curso de Extensão a Distância - Educação Ambiental: Princípios e Práticas. 2002. (Curso de curta duração ministrado/Extensão).

Da SILVA, A. V. . Diapositivos: Imunodiagnóstico das Zoonoses. 1999. (Desenvolvimento de material didático ou instrucional - Diapositivos).

Da SILVA, A. V. . Diapositivos: Técnicas de Biologia Molecular Aplicadas ao Estudo das Zoonoses. 1999. (Desenvolvimento de material didático ou instrucional - Diapositivos).

Da SILVA, A. V. . Apostila: Aspectos Zoonóticos das Salmoneloses. 1997. (Desenvolvimento de material didático ou instrucional - Apostila).

Da SILVA, A. V. ; CABRAL, K.G. . Apostila: Aplicações da Biologia Molecular no Diagnóstico das Zoonoses. 1997. (Desenvolvimento de material didático ou instrucional - Apostila).

Da SILVA, A. V. ; MONREAL, A. C. D. . Apostila: Aspectos Imunológicos na Mastite Bovina. 1997. (Desenvolvimento de material didático ou instrucional - Apostila).

Da SILVA, A. V. . Apostila: Diagnóstico Histopatológico da Toxoplasmose Ovina. 1997. (Desenvolvimento de material didático ou instrucional - Apostila).

LANGONI, H. ; Da SILVA, A. V. . Folheto: Zoonoses - Que bicho é esse?. 1997. (Desenvolvimento de material didático ou instrucional - Folheto).

TAKAOKA, N. Y. ; LANGONI, H. ; AGUIAR, E. A. ; Da SILVA, A. V. ; KOTAIT, I. . Folheto: Raiva - Colheira e envio de material para diagnóstico de raiva. 1997. (Desenvolvimento de material didático ou instrucional - Folheto).

DOMINGUES, Paulo Francisco ; Da SILVA, A. V. . Folheto: Orientação Técnica no 1 - Manejo Sanitário de Bovinos. 1995. (Desenvolvimento de material didático ou instrucional - Folheto).

Da SILVA, A. V. . Folheto: Programa de apoio aos produtores de leite da região do Vale do Paraíba. 1994. (Desenvolvimento de material didático ou instrucional - Folheto).

Da SILVA, A. V. . Folheto: Leishmaniose. 1994. (Desenvolvimento de material didático ou instrucional - Folheto).

LANGONI, H. ; Da SILVA, A. V. . Folheto: Algumas coisas que você deve saber sobre a raiva urbana. 1993. (Desenvolvimento de material didático ou instrucional - Folheto).

LANGONI, H. ; Da SILVA, A. V. . Folheto: Veja os cuidados que você deve ter com a leptospirose. 1993. (Desenvolvimento de material didático ou instrucional - Folheto).

LANGONI, H. ; Da SILVA, A. V. . Folheto: Brucelose - Que bicho será esse?. 1993. (Desenvolvimento de material didático ou instrucional - Folheto).

LANGONI, H. ; Da SILVA, A. V. . Folheto: Tuberculose ainda é doença séria. 1993. (Desenvolvimento de material didático ou instrucional - Folheto).

Da SILVA, A. V. . Tigre, Gorila e Águia. 2008. Fotografia.

Da SILVA, A. V. . XIII Encontro de Corais da UNESP. 1992 (Coral).

Da SILVA, A. V. . Aula curso de pós-graduação: Cursos, Programas, Orientados e Orientadores: como nos encaixamos no Sistema Nacional de Pós-Graduação?. 2012 (Aula curso de pós-graduação) .

Da SILVA, A. V. . Palestra: Sobre Porcos, Ratos e Gatos - Os Animais e a Toxoplasmose Humana. 2012 (Palestra) .

Da SILVA, A. V. . Emporium Orgânico. 2011 (Design e manutenção de website) .

Da SILVA, A. V. . Toxoplasmose em Animais Domésticos. 2008 (Aula curso de pós-graduação) .

Da SILVA, A. V. . Palestra: Zoonose e Saúde Pública "O Presente Letal dos Animais". 2007 (Palestra) .

Da SILVA, A. V. . Aula em curso de pós-graduação: Interação parasita-hospedeiro-meio ambiente na infecção toxoplasmática. 2006 (Aula curso de pós-graduação) .

Da SILVA, A. V. . Palestra: Toxoplasmose e Clamidiose como Doenças da Esfera Reprodutiva em Ovinos e Caprinos. 2005 (Palestra) .

Da SILVA, A. V. . Palestra: Toxoplasmose Canina e Felina. 2005 (Palestra) .

Da SILVA, A. V. . Palestra: Leishmaniose Canina. 2005 (Palestra) .

Da SILVA, A. V. . Palestra: Leptospirose em Animais de Produção, Serviço e Estimação. 2004 (Palestra) .

Da SILVA, A. V. . Palestra: Teníase e Cisticercose. 2004 (Palestra) .

Da SILVA, A. V. . Palestra: Toxoplasmose Canina e Felina. 2003 (Palestra) .

Da SILVA, A. V. . Palestra: Toxoplasmose. 2003 (Palestra) .

Da SILVA, A. V. . Aula teórica: Toxoplasmose. 2002 (Aula teórica) .

Da SILVA, A. V. . Palestra: Biologia Molecular Aplicada ao Diagnóstico de Zoonoses. 2001 (Palestra) .

Da SILVA, A. V. . Palestra: Biologia Molecular em Medicina Veterinária. 2001 (Palestra) .

Da SILVA, A. V. . Aula teórica: Diagnóstico molecular em zoonoses. 2001 (Aula teórica) .

Da SILVA, A. V. . Palestra: Importância e Controle da Toxoplasmose no Rebanho Ovino. 2000 (Palestra) .

Da SILVA, A. V. . Aula teórico-prática: Diagnóstico Laboratorial da Raiva, Leptospirose, Toxoplasmose e Leishmaniose. 2000 (Aula teórico-prática) .

Da SILVA, A. V. . Aula teórica: Febre maculose - uma zoonose reemergente. 1999 (Aula teórica) .

Da SILVA, A. V. . Aula prática: Diagnóstico laboratorial de toxoplasmose. 1999 (Aula prática) .

Da SILVA, A. V. . Aula teórica: Técnicas de Biologia Molecular Aplicadas ao Diagnóstico de Zoonoses. 1999 (Aula teórica) .

Da SILVA, A. V. . Palestra: Biologia Molecular como Recurso Diagnóstico em Enfermidades dos Animais. 1999 (Palestra) .

Da SILVA, A. V. . Palestra: Imunodiagnóstico aplicado às zoonoses. 1999 (Palestra) .

Da SILVA, A. V. . Palestra: Biologia molecular aplicada ao diagnóstico das zoonoses. 1999 (Palestra) .

Da SILVA, A. V. . Aula teórica: Aspectos zoonóticos das salmoneloses. 1997 (Aula teórica) .

Da SILVA, A. V. ; LANGONI, H. ; TONIN, F.B. ; MEIRELLES, L.R. . Palestra: Zoonoses e Saúde Pública. 1997 (Palestra) .

Da SILVA, A. V. . Aula teórica: Teníase e cisticercose. 1996 (Aula teórica) .

Da SILVA, A. V. . Aula prática: Raiva. 1996 (Aula prática) .

Da SILVA, A. V. . Aula prática: Toxoplasmose. 1996 (Aula prática) .

Projetos de pesquisa

  • 2021 - Atual

    VIGILÂNCIA MOLECULAR DE CORONAVÍRUS E ADENOVÍRUS EM ANIMAIS SELVAGENS NO ESTADO DA BAHIA, Descrição: Ações de vigilância fazem parte da Integralidade do SUS e a epidemiologia molecular representa a fronteira do conhecimento na vigilância das zoonoses emergentes e reemergentes. O surgimento da pandemia de COVID-19, além de representar a maior crise sanitária das últimas décadas, nos apresenta o desafio de encontrar os reservatórios naturais do SARS-CoV-2 ou ao menos em quais espécies hospedeiras esse vírus circulou nos últimos anos realizando os saltos entre espécies e chegando ao ser humano, em tese a partir de um coronavírus ancestral de morcegos. Os poucos investimentos nesta área do conhecimento colocaram os países em condições de vulnerabilidade e o Brasil não é diferente. A evolução viral está relacionada às mutações e recombinações que conferem novas características de histotropismo e espécie especificidade, podendo aumentar sua virulência, transmissibilidade, hospedeiros e ganhar potenciais zoonóticos e até pandêmicos. Estudo tentam recuperar o tempo perdido e realizar retrospectivamente análises de evolução do SARS-CoV-2. Propomos neste projeto a vigilância molecular de membros da família Coronaviridae em concordância com os argumentos acima, mas incluímos a família Adenoviridae por avaliarmos como um candidato natural a novas zoonoses, epidemias e pandemias em função de sua alta diversidade de hospedeiros, assim como de células e tecidos alvo, adaptação a diferentes moléculas receptoras, infecção em múltiplos sistemas e diferentes virulências, além de também ser transmitido prioritariamente pelo ar. Assim, será realizada a vigilância molecular e análises filogenéticas de cepas das duas famílias virais citadas em animais selvagens do interior do estado da Bahia, em função das estratégias de coleta de material biológico, espera-se estudar amostras de mamíferos, aves e répteis, o que amplia sobremaneira as chances de detecção viral e de acompanhamento da evolução natural dessas duas famílias. Espera-se encontrar cepas de coronavírus com proximidade filogenética ao SARS-CoV-2, havendo possibilidade de detecção de novos hospedeiros ao próprio SARS-CoV-2. Cepas de adenovírus além de permitirem a análise da evolução e possível descrição de novos hospedeiros e espécies virais, ainda são vírus de alto valor tecnológico em saúde, uma vez que tem potencial uso na geneterapia e como plataforma de vacinas, incluindo algumas propostas atuais para a COVID- 19. Esta articulação entre UEFS e UFRB fazem parte da estratégia de estruturação da Rede de Vigilância Molecular de Zoonoses Virais Emergentes e Reemergentes no Estado da Bahia, que através de banco de dados e de material biológico regionais dará suporte à gestão estadual em Saúde e ao SUS.. , Situação: Em andamento; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (2) / Especialização: (0) / Mestrado acadêmico: (1) / Mestrado profissional: (0) / Doutorado: (1) . , Integrantes: Aristeu Vieira da Silva - Coordenador / George Rêgo Albuquerque - Integrante / Patrícia Hercília Arcanjo de Almeida - Integrante / Martín Roberto del Valle Alvarez - Integrante / Alany Santos Oliveira Rocha - Integrante / Flavia Regina Miranda - Integrante / Mariana Guimarães Nilsson - Integrante / Matheus Oliveira de Melo - Integrante / Mirza de Carvalho Santana Cordeiro - Integrante / Ilka Biondi - Integrante / Rogério Mercês Ferreira Santos - Integrante / Dulcineia Ferreira de Andrade - Integrante / Marcos Lázaro da Silva Guerreiro - Integrante / Lorena Moura de Assis Sampaio - Integrante / Matheus Ferreira Porto - Integrante / Fernando Vicentini - Integrante / Luciana dos Santos Freitas - Integrante / Kaján Gyözö Lásló - Integrante / Cássia Matos Ribeiro - Integrante / Camila Albano dos Santos - Integrante., Financiador(es): Fundação de Amparo à Pesquisa do Estado da Bahia - Auxílio financeiro.Número de orientações: 1

  • 2021 - Atual

    Estudo do perfil sorológico de indivíduos infectados por SARS-CoV-2, Descrição: O objetivo geral do projeto é avaliar o perfil sorológico de indivíduos infectados por SARS-CoV-2 no município de Feira de Santana-Bahia, Brasil. Para isso,pretende-se: Caracterizar as amostras clínicas coletadas através de testes sorológicos e moleculares; - Estimar a incidência da COVID-19 na população estudada; Descrever o perfil da resposta de anticorpos IgM e IgG; Avaliar protótipos de testes sorológicos para pesquisa de anticorpos IgM e IgG; Caracterizar os principais aspectos clínicos e epidemiológicos dos casos sintomáticos e que apresentem confirmação sorológica; Constituir um biorrepositório de amostras, caracterizadas clinicamente, que possam ser compartilhadas para a avaliação de insumos para testes diagnósticos e biomarcadores que avancem no entendimento e melhor manejo clínico-terapêutico de pacientes com infecção por SARS-CoV-2; Confeccionar painéis sorológicos e moleculares para serem utilizados exclusivamente em ações de saúde pública, a partir das amostras do biorrepositório.. , Situação: Em andamento; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (1) / Mestrado acadêmico: (3) / Mestrado profissional: (1) / Doutorado: (3) . , Integrantes: Aristeu Vieira da Silva - Coordenador / Patrícia Hercília Arcanjo de Almeida - Integrante / Patrícia Carneiro Silva Santana - Integrante / cinthia dorea sena prates - Integrante / Mirza de Carvalho Santana Cordeiro - Integrante / Rogério Mercês Ferreira Santos - Integrante / Karen Trinta - Integrante / Antônio Ferreira - Integrante / Edimilson Domingos da Silva - Integrante / Carlos Augusto Moreira de Sousa - Integrante / Maricelia Maia de Lima - Integrante / Rivaldo Venâncio da Cunha - Integrante / Priscylla Marcelly Vilanova Oliveira do Nascimento - Integrante / Aline Moraes Bergossi Gomes - Integrante / Iago Barbosa Ribeiro - Integrante / Helineide Ramos do Amaral - Integrante / Eddy José Francisco Oliveira - Integrante / Erenilde Marques Cerqueira - Integrante.

  • 2021 - Atual

    Vigilância Molecular do SARS-CoV-2 em Animais de Companhia: coorte prospectiva de carnívoros e roedores domiciliados para uma abordagem de Saúde Única (Covid-Pets-FSA), Descrição: O SARS-CoV-2 (Severe Acute Respiratory Syndrome Corona Virus 2), responsável pela síndrome CoVID-19 (Coronavirus Infectious Disease 2019), foi identificado e descrito em dezembro de 2019, quando um grupo de pacientes com uma pneumonia de origem viral desconhecida começaram a ser admitidos em hospitais em Wuhan, província de Hubei na China. Ainda não existe consenso quanto a origem do vírus, porém diversos artigos científicos implicam que o SARS-CoV-2 originou-se de quirópteros e pangolins. A detecção desse patógeno em inúmeras espécies animais, como furões, tigres, leões, macacos, coelhos, hamsters e em especial, cães e gatos, aumentam a preocupação de pesquisadores de serem possíveis fontes zoonóticas do vírus. Animais de estimação como cães e gatos tem tido um papel cada vez maior nos núcleos familiares, já que a globalização, a emancipação da mulher e outros movimentos socioeconômicos, trouxeram mudanças na organização familiar. Ao analisar o cenário da relação entre o homem e animais domesticados, a aflição devido ao SARS-CoV-2 é de que este agente etiológico possua características genômicas que permitam a transmissão interespécies e a adaptação às condições em um novo hospedeiro. É importante ressaltar que mesmo surtos limitados requerem recursos financeiros para sua contenção e podem sobrecarregar os sistemas de saúde locais. A vigilância molecular é necessária, portanto, para avaliar o potencial zoonótico em relação ao SARS-CoV-2 em animais de estimação dentro do Estado da Bahia, e, revelar novos hospedeiros do vírus, levando à antecipação dos riscos de novas pandemias, à realização de planos de monitoramento e enfrentamento às crises sanitárias. Assim, esse trabalho tem como objetivo detectar a presença de SARS-CoV-2 e de anticorpos anti-SARS-CoV-2 em animais de estimação de tutores confirmados ou em suspeita de CoVID-19. Serão coletadas amostras de sangue e zaragatoas de diferentes regiões do corpo de cães, gatos e roedores de tutores confirmados ou em suspeita de COVID-19, para análise de anticorpos anti-SARS-CoV-2 através do ELISA e detecção da presença de SARS-CoV-2 pela RT-PCR em tempo real. Serão aplicados, também, questionários de cunho epidemiológico para os tutores ou responsáveis pelo animal no momento da coleta das amostras biológicas. A partir desse estudo espera-se determinar se esses animais podem atuar como reservatórios do SARS-CoV-2 e se possuem a capacidade de desenvolver variantes antigenicamente relevantes do vírus. Além disso, outro resultado desejado é o de transferir o conhecimento adquirido para os profissionais de saúde, de forma a auxiliar em suas atividades com uma abordagem de Saúde Única.. , Situação: Em andamento; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (1) / Mestrado acadêmico: (1) / Doutorado: (1) . , Integrantes: Aristeu Vieira da Silva - Coordenador / Alexander Welker Biondo - Integrante / Eddy José Francisco de Oliveira - Integrante / Mariana Guimarães Nilsson - Integrante / Matheus Oliveira de Melo - Integrante / Mirza de Carvalho Santana Cordeiro - Integrante / Rogério Mercês Ferreira Santos - Integrante / Fernando Vicentini - Integrante / Mahysa Ferreira Costa - Integrante / Louise Bach Kmetiuk - Integrante., Número de orientações: 2

  • 2016 - Atual

    Pesquisa de fatores associados à incidência de toxocaríase e toxoplasmose humana em comunidade rural (Resolução CONSEPE 078/2016), Descrição: A toxocaríase humana é um complexo de manifestações patológicas, que pode variar de uma forma assintomática a quadros oculares e neurológicos, frequentemente subdiagnosticada, constituindo-se de uma enfermidade parasitária negligenciada. Os cães e gatos, hospedeiros dos parasitos do gênero Toxocara, eliminam ovos para o ambiente, os quais podem ficar viáveis por longos períodos, contaminando o solo, água e vegetais. A ingestão destes ovos pelo homem e outros animais pode levar a infecção e eventuais formas clínicas de variada gravidade. A epidemiologia da infecção humana e animal está melhor estabelecida em ambientes urbanos, mas o ambiente rural reúne uma série de características que permite acreditar em elevadas taxas de infecção nas diferentes populações. Em trabalho anterior, nossa equipe detectou a presença de anticorpos anti-Toxocara em cerca de 90% de frangos criados extensivamente em propriedades rurais, demonstrando uma provável contaminação elevada do solo, e consequentemente, um risco elevado de infecção para outros animais e para o ser humano. Outra enfermidade de natureza parasitária, a toxoplasmose, também pode causar casos graves de doença ocular ou neurológica no ser humano, bem como abortamentos e sérias manifestações neonatais. Apesar de ter no gato seu hospedeiro definitivo, cães e aves criadas extensivamente também podem ser afetados, participando do ciclo de transmissão do agente, podendo ser indicadores da contaminação ambiental pelo parasito e do risco de infecção do ser humano. Desta forma, este trabalho pretende investigar a presença de anticorpos anti-Toxocara e anti-Toxoplasma em humanos, cães e frangos em propriedades rurais, bem como a presença de ovos de Toxocara em fezes de cães e no solo, realizando coletas quadrimestrais durante um período de pelo menos 24 meses. Os humanos serão triados pelo ELISA para detecção de anticorpos anti-Toxocara e anti-Toxoplasma, e formados dois grupos, sendo um inicialmente soropositivo e outro de soronegativos. Estes individuos terão soro sanguineo coletado a cada quatro meses durante o projeto. Da mesma forma serão coletados os soros de todos os cães e de pelo menos 10% dos frangos da propriedade. Amostras de solo serão coletadas para recuperação de ovos de Toxocara, e também para determinação de suas propriedades físicoquímicas. Dos cães serão recuperadas as fezes para detecção de ovos de Toxocara spp. Dados epidemiológicos de humanos, cães e aves serão recuperados em questionários estruturados específicos, a cada quatro meses, de forma a estabelecer associações entre estes dados e as taxas de prevalência para cães, frangos e humanos, bem como para a taxa de incidência em humanos. A influência das características do solo e da cobertura vegetal sobre a recuperação de ovos de Toxocara também será investigada. Os ovos de Toxocara spp recuperados do solo e das fezes de cães terão seu DNA extraído e avaliado pela técnica de high resolution melting - realtime PCR para discriminação da espécie de Toxocara. Ainda em humanos e cães serão realizados o hemograma para verificar-se a contagem diferencial de leucócitos, avaliando-se a eosinofilia como um marcador acessório das infecções parasitárias. Esperamos determinar neste trabalho quais são as características biológicas, ambientais e epidemiológicas relacionadas a incidência da toxocaríase humana e a prevalência da toxocaríase canina e aviária nas propriedades rurais avaliadas.. , Situação: Em andamento; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (1) / Especialização: (0) / Mestrado acadêmico: (0) / Mestrado profissional: (0) / Doutorado: (1) . , Integrantes: Aristeu Vieira da Silva - Coordenador / Anaiá da Paixão Sevá - Integrante / Ediclei Lima do Carmo - Integrante / Vamilton Alvares Santarem - Integrante / Selma Santa Barbara da Silva Gomes - Integrante / Luciara Alves da Cruz - Integrante / Simone Souza de Oliveira - Integrante / Joelande Esquivel Correia - Integrante / Adriana Lebram von Söhsten - Integrante / Taise Bomfim de Jesus - Integrante / Kathleen de Almeida Ferreira - Integrante / Eddy José Francisco de Oliveira - Integrante / Rafaela dos Anjos Pinheiro Bogoevich Morais - Integrante / Taise CristiNA Santa Barbara Silva Queiroz - Integrante / Alany Santos Oliveira Rocha - Integrante / aline moraes bergossi - Integrante / cinthia dorea sena prates - Integrante / daniela carneiro lopes carlos - Integrante / guita rubinsky-elephant - Integrante / lia fernandes - Integrante / Washington de Jesus Santanna da Franca Rocha - Integrante., Financiador(es): Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Bolsa., Número de produções C, T & A: 5 / Número de orientações: 1

  • 2014 - Atual

    Agentes zoonóticos em animais silvestres e vetores associados no Estado da Bahia (Resolução CONSEPE 0003/2015), Descrição: No mundo todo, no Brasil, e no Estado da Bahia de um modo especial, o estudo de zoonoses parasitárias em animais selvagens ainda é restrito. Desta forma, a pesquisa de agentes zoonóticos, principalmente os parasitários, entre animais selvagens em diferentes biomas no Estado da Bahia, por métodos moleculares, é importante e urgente. Objetiva-se com a realização deste projeto detectar e caracterizar, em nível molecular, os seguintes parasitos: Toxoplasma gondii, Leishmania, Trypanosoma cruzi, Giardia, Cryptosporidium e Toxocara em animais silvestres no estado da Bahia e, identificar os carrapatos que estão associados com esses animais e as espécies de Ricketisia que estejam nesses ectoparasitos. A pesquisa se concentrará na mesorregião Sul Baiano e na mesorregião do Recôncavo Baiano (Serra da Jibóia), onde num período de 18 meses serão coletados animais e carrapatos associados. Os animais serão coletados em armadilhas, sofrerão eutanásia e amostras de sangue e tecidos serão coletadas. No caso dos quirópteros, os mesmos serão capturados, terão eventuais carrapatos coletados, terão os dados biométricos registrados e serão então liberados. Após a taxidermia dos animais coletados, os mesmos serão depositados nas coleções da Universidade Estadual de Feira de Santana e da Universidade Estadual de Santa Cruz. Os carrapatos coletados serão identificados até o táxon espécie e no DNA extraído destes animais será realizada a pesquisa de riquétsias. Dos animais vertebrados serão coletados encefálo e coração, fígado e baço, e o contéudo gastro-intestinal. Todas as amostras serão adequadamente conservadas até a realização dos exames para detecção de enteroparasitos ou parasitos teciduais. As amostras de conteúdo intestinal serão submetidas aos métodos de Willis e Faust para detecção de enteroparasitos. Das amostras de sangue será obtido o soro, do qual se realizará a detecção de anticorpos anti-Toxoplasma pelo método de aglutinação direta. Dos tecidos e do contéudo intestinal será extraído o DNA total, utilizando-se kits comerciais apropriados para cada tipo de amostra. DNA de Toxoplasma gondii será pesquisado pela técnica de Nested-PCR para o gene B1, seguido de PCR quantitativo em tempo real para determinação da carga parasitária na amostra. No caso de Toxoplasma gondii, as amostras de tecido serão também processadas para bioprova em camundongos, e as cepas isoladas serão genotipadas utilizando-se a nested-PCR seguida de RFLP para 12 marcadores genéticos. A pesquisa de DNA de Leishmania, Trypanosoma e Toxocara serão realizadas no DNA das amostras de tecido, utilizando-se a PCR em tempo real para os genes descritos na literatura para cada um dos agentes, enquanto que nas amostras de DNA extraídas do contéudo intestinal, Cryptosporidium e Giardia serão pesquisados também pela PCR em tempo real para os genes descritos na literatura para cada um dos agentes. As amostras positivas serão purificadas com Exo-SAP-IT ou similares e submetidas ao sequenciamento através do Big Dye Terminator Cycle Sequencing Kit em sequenciador automático de DNA. As sequências obtidas serão editadas no programa BIOEDIT, sendo os trechos de baixa qualidade excluídos da análise ou refeitos com primers adicionais de correção. Posteriormente, será realizado o alinhamento das sequências utilizando o algoritmo de alinhamento múltiplo no programa MUSCLE. As sequências obtidas serão depositadas no GenBank. O número de sítios variáveis, conservados e parcimoniosamente informativos, assim como a composição de nucleotídeo para cada matriz de dados alinhada das diferentes regiões utilizadas no estudo foi obtido através do programa MEGA6. As relações filogenéticas reconstruídas sob o critério ótimo de Máxima Parcimônia (MP); Neighbor-Joining (NJ); e Máxima Verossimilhança (MV) análises sob o critério Bayesian-likelihood.. , Situação: Em andamento; Natureza: Pesquisa. , Integrantes: Aristeu Vieira da Silva - Coordenador / Anaiá da Paixão Sevá - Integrante / Ediclei Lima do Carmo - Integrante / George Rêgo Albuquerque - Integrante / Alexandre Dias Munhoz - Integrante / Joelande Esquivel Correia - Integrante / Banca Mendes Maciel - Integrante / Eddy José Francisco de Oliveira - Integrante / Hermes Ribeiro Luz - Integrante / João Luiz Horácio Faccini - Integrante / Martín Roberto del Valle Alvarez - Integrante / Rafaela dos Anjos Pinheiro Bogoevich Morais - Integrante / Téo Veiga de Oliveira - Integrante., Financiador(es): Fundação de Amparo à Pesquisa do Estado da Bahia - Auxílio financeiro.

  • 2012 - 2016

    Detecção de Toxoplasma gondii, Sarcocystis hominisuis e Toxocara canis em produtos cárneos comercializados em feiras livres de Feira de Santana, BA, e genotipagem das cepas de T. gondii isoladas (CONSEPE 173/2012), Descrição: Toxoplasma gondii, Sarcocystis hominisuis e Toxocara canis são parasitos que podem afetar o ser humano e animais, podendo estes últimos constituir-se reservatórios da infecção. No homem a toxoplasmose normalmente cursa de forma assintomática, mas pode representar sério risco a saúde e à vida de indivíduos infectados pela via congênita ou nos imunocomprometidos, com manifestações clínicas que vão do abortamento ao comprometimento ocular e neurológico, em graus variados. O parasito pode ser encontrado em sua forma encistada, em vísceras e musculatura de aves, suínos e ovinos. S. hominisuis pode ser encontrado nas vísceras e musculatura de suínos, e no homem promove doença entérica. T. canis é um parasito do cão e gato, mas a ingestão de ovos embrionados em solo contaminado ou de vísceras de hospedeiros paratênicos pode ser responsável por quadros graves de doenças hepática, ocular e neurológica no homem. Dada a prevalência elevada e impacto clínico da infecção pelo Toxoplasma, bem como pela ausência de estudos nacionais com relação ao papel dos produtos cárneos na veiculação de S. suihominis e Toxocara, este estudo visa verificar a ocorrência destes parasitos em amostras de tecidos de frangos, suínos e ovinos comercializados em feiras livres no município de Feira de Santana, BA. Para tanto, frangos vivos terão seu sangue colhido para ser submetido à detecção de anticorpos anti-T. gondii, e dos positivos e 10% dos negativos, amostras de tecidos (fígado, coração, baço, cérebro e musculatura esquelética) serão submetidos à bioprova em camundongos para isolamento do parasito. Anticorpos anti-T. gondii serão pesquisados também em amostras de sobrenadante dos tecidos das aves, suínos e ovinos. As amostras de tecidos de aves, suínos e ovinos serão submetidas a digestão em solução de ácido clorídrico a 0,5% para pesquisa de larvas de Toxocara canis, e as amostras de tecidos suíno preparadas e submetidas à pesquisa de Sarcocystis. Todas as amostras de tecidos serão submetidas. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (4) / Doutorado: (2) . , Integrantes: Aristeu Vieira da Silva - Coordenador / Rodrigo Costa da Silva - Integrante / Vamilton Alvares Santarem - Integrante / Luis Fernando Pita Gondim - Integrante / Silvane Maria Braga dos Santos - Integrante / Helio Langoni - Integrante / George Rêgo Albuquerque - Integrante / Maria Vilmária Fontes Carvalho - Integrante / Patrícia Hercília Arcanjo de Almeida - Integrante / Adriana Lebram von Söhsten - Integrante / Guita Rubinsky Elefant - Integrante / Kathleen de Almeida Ferreira - Integrante / Caroline Araújo da Silva - Integrante., Financiador(es): Conselho Nacional de Desenvolvimento Científico e Tecnológico - Auxílio financeiro.

  • 2012 - 2014

    Avaliação da presença de Achatina fulica Bowdich, 1822 (Gastropoda: Pulmonata) e estudo dos helmintos e protozoários associados, em Feira de Santana, Bahia, Descrição: O gastrópode Achatina fulica (BOWDICH, 1822), também conhecido como caramujo africano, é um molusco terrestre que está envolvido na transmissão dos nematóides Angiostrongylus cantonensis e Angiostrongylos costaricensis, causadoras da meningoencefalite eosinofílica e da angiostrongilíase abdominal ambas no ser humano. Além disso, essa espécie pode atuar na qualidade de vetor biológico ou paratênico de protozoários de caráter zoonótico com Giardia intestinalis e Cryptosporidium parvum, que têm sido encontrados infectando animais de diferentes espécies e humanos. Com o objetivo de avaliar a ocorrência e os aspectos parasitários de A. fulica, será realizada uma pesquisa no município de Feira de Santana, Bahia- Brasil, durante o período de 2012-2013. Os moluscos serão coletados no perímetro urbano do município, e durante a coleta também serão realizadas observações dos locais onde os moluscos estiverem presentes, especialmente sobre condições antrópicas. Os animais encontrados serão transportados para o laboratório da UEFS, onde serão mensurados e mantidos para o processamento de amostras de fezes para a detecção de Giardia e Cryptosporidium, e partes dessas amostras serão congeladas para posterior avaliação molecular através da técnica de PCR para a identificação de Giardia intestinalis e Cryptosporidium parvum, após esse procedimento os animais serão submetidos à eutanásia para pesquisar as lavras de nematódeos de interesse médico e veterinário. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (2) / Especialização: (0) / Mestrado acadêmico: (2) / Mestrado profissional: (0) / Doutorado: (0) . , Integrantes: Aristeu Vieira da Silva - Coordenador / Patrícia Hercília Arcanjo de Almeida - Integrante / Sofia Aline Amaral Santos - Integrante / Pryscylla Marcelly Vilanova Oliveira - Integrante / Luana Maria Silva de Macêdo Marques Guerra - Integrante / Kathleen de Almeida Ferreira - Integrante., Financiador(es): Fundação de Amparo à Pesquisa do Estado da Bahia - Bolsa., Número de produções C, T & A: 1

  • 2011 - 2016

    Prevalência e fatores de risco para as infecções por Toxoplasma gondii e enteroparasitos em cães e humanos de uma comunidade rural no estado da Bahia, Descrição: As enfermidades parasitárias são um dos principais agravos à saúde das populações, sejam animais, sejam humanas. Apesar de muitos trabalhos serem realizados nesta área, em sua grande maioria, em relação aos enteroparasitos, referem-se a populações urbanas. Esta pesquisa pretende levantar a prevalência de enteroparasitos, principalmente os de caráter zoonótico, tais como Giardia e Cryptosporidium em humanos e cães, e de Toxocara em cães, em uma comunidade rural do município baiano de Feira de Santana. A comunidade a ser estudada possui aproximadamente 5000 domicílios, e desta população serão sorteados domicílios suficientes para constituir-se amostra significativa, seja da população humana, seja da canina, para a investigação da prevalência de enteroparasitos. Paralelamente, a presença de anticorpos anti-Toxoplasma gondii será investigada na população humana, canina e em uma fração dos domicílios, em galinhas criadas de forma extensiva. Estas galinhas serão examinadas também para isolamento deste parasito em camundongos, bem como para a presença de larvas de Toxocara canis nos tecidos, de forma a estabelecer se esta espécie pode servir como sentinela da contaminação ambiental por este nematelminto zoonótico.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (0) / Especialização: (0) / Mestrado acadêmico: (0) / Mestrado profissional: (0) / Doutorado: (0) . , Integrantes: Aristeu Vieira da Silva - Coordenador / Rodrigo Costa da Silva - Integrante / Vamilton Alvares Santarem - Integrante / Helio Langoni - Integrante / Selma Santa Barbara da Silva Gomes - Integrante / Luciara Alves da Cruz - Integrante., Financiador(es): Universidade Estadual de Feira de Santana - Auxílio financeiro / Fundação de Amparo à Pesquisa do Estado da Bahia - Auxílio financeiro., Número de produções C, T & A: 17

  • 2011 - 2015

    Detecção e caracterização molecular de Toxoplasma gondii em animais terrestres e marinhos, e sua interface com o homem, Descrição: Existe uma demanda sobre a caracterização molecular de Toxoplasma gondii em animais terrestres e marinhos, e sua interface com o homem. Objetiva-se com a realização deste trabalho detectar e caracterizar, em nível molecular, cepas de T. gondii de animais marinhos (cetáceos, pinipedes, sirênios e moluscos filtradores), animais terrestres (ovinos, suínos, cães e galinhas) e do homem, assim como determinar a virulência de cepas do parasito por meio do bioensaio. Objetiva-se também ampliar a interação entre trôs pólos de pesquisa no Estado da Bahia (Universidade Estadual de Santa Cruz, Universidade Estadual de Feira de Santana e Universidade Federal da Bahia), com vistas ao crescimento homogêno das instituições envolvidas na área do projeto e ao incremento das tecnologias em biologia molecular, que possibilitem a caracterização genética de diferentes fragmentos dos genomas de parasitos protozoários.. , Situação: Concluído; Natureza: Pesquisa. , Integrantes: Aristeu Vieira da Silva - Integrante / Luis Fernando Pita Gondim - Coordenador / George Rêgo Albuquerque - Integrante / Alexandre Dias Munhoz - Integrante / Amauri Arias Wenceslau - Integrante., Financiador(es): Fundação de Amparo à Pesquisa do Estado da Bahia - Auxílio financeiro.

  • 2011 - 2014

    Descobrindo a Ciência pela Parasitologia, Descrição: A pesquisa científica pelo processo continuado de busca, tratamento e transformação de informações, pode ter impacto benéfico no Ensino Formal, contribuindo para a formação de um aluno inquisito, crítico e participativo. Este projeto, tendo como tema central a captura e identificação de moscas sinantrópicas, bem como seu papel na vetoriação de parasitos de interesse em saúde pública, pretende contemplar todos os passos de um projeto de pesquisa convencional, ou seja, o planejamento (projeto) das atividades, a determinação e a execução da metodologia mais adequada para que sejam atingidos os objetivos, a construção de ferramentas de análise dos dados, e, finalmente, a divulgação dos resultados obtidos à comunidade. Para tanto a equipe executora do projeto, representada por docentes, técnicos e acadêmicos de pós-graduação e graduação da Universidade Estadual de Feira de Santana - UEFS, numa série de reuniões com o Comitê Escolar, formado por professores da escola de primeiro grau parceira na execução do projeto, irá transferir conhecimentos e habilidades relacionados, não só com o tema de investigação do projeto, mas como a própria praxis científica. Este Comitê, no ambiente escolar, com o auxílio e supervisão de acadêmicos de graduação (bolsista de Iniciação Científica) e de pós-graduação da UEFS, farão a transferência de conhecimentos e habilidades aos alunos que voluntariamente aderirem ao projeto. Finalmente, estes alunos, ainda sob a supervisão do bolsista Professor Investigador, auxiliado pelos acadêmicos de graduação e pós-graduação da UEFS, executarão as atividades inerentes ao projeto de pesquisa proposto. Em todas as etapas do processo serão privilegiadas atividades que permitam a efetiva participação, tanto do Comitê Escolar, quanto dos alunos da escola, na tomada de decisões sobre a execução de todos os passos do projeto. As atividades do projeto serão integradas às atividades curriculares, principalmente das disciplinas de Ciências, Matemática, Língua Por. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (2) / Especialização: (0) / Mestrado acadêmico: (0) / Mestrado profissional: (0) / Doutorado: (1) . , Integrantes: Aristeu Vieira da Silva - Coordenador / Freddy Ruben Bravo Quijano - Integrante / Thayana Teles Dalencar Monteiro - Integrante / Joelande Esquicel Correia - Integrante / Lyokelly Pinho Araújo - Integrante / Mariana Silva Marques - Integrante / Patrícia Carneiro da Silva - Integrante / Sofia Marinho da Natividade - Integrante / Édlla Virginia Rios Lima - Integrante., Financiador(es): Fundação de Amparo à Pesquisa do Estado da Bahia - Auxílio financeiro / Fundação de Amparo à Pesquisa do Estado da Bahia - Bolsa / Universidade Estadual de Feira de Santana - Bolsa., Número de produções C, T & A: 9

  • 2009 - 2010

    Roedores sinantrópicos como reservatórios de agentes de zoonoses: 1. Toxoplasma gondii, Descrição: Os roedores sinantrópicos comensais, ou seja, aqueles que se associam ao ser humano em virtude de terem seus ambientes prejudicados pela ação do próprio homem, principalmente os ratos e camundongos, podem participar do ciclo epidemiológico de diversas enfermidades, entre elas a toxoplasmose e a leptospirose. Estas enfermidades têm, ou elevada prevalência ou causam impacto na saúde humana e animal pela letalidade dos casos. Desta maneira este estudo propõe capturar roedores na área urbana do município de Umuarama, com o objetivo de detectar anticorpos séricos anti-Toxoplasma nestes animais, bem como isolar o parasito de amostras de cérebro e coração coletadas destes animais.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (2) / Mestrado acadêmico: (2) . , Integrantes: Aristeu Vieira da Silva - Coordenador / Rodrigo José Mattei - Integrante / Patrícia Ribeiro dos Santos - Integrante / Jacqueline Batista de Araújo - Integrante / Eliane Michalczuk Barzon - Integrante., Financiador(es): Universidade Paranaense - Auxílio financeiro / Universidade Paranaense - Bolsa., Número de produções C, T & A: 2

  • 2009 - 2010

    Roedores sinantrópicos como reservatórios de agentes de zoonoses: 2. Leptospira, Descrição: Os roedores sinantrópicos comensais, ou seja, aqueles que se associam ao ser humano em virtude de terem seus ambientes prejudicados pela ação do próprio homem, principalmente os ratos e camundongos, podem participar do ciclo epidemiológico de diversas enfermidades, entre elas a toxoplasmose e a leptospirose. Estas enfermidades têm, ou elevada prevalência ou causam impacto na saúde humana e animal pela letalidade dos casos. Desta maneira este estudo propõe capturar roedores na área urbana do município de Umuarama, com o objetivo de detectar anticorpos séricos anti-Leptospira nestes animais, bem como detectar o parasito de amostras de rim coletadas destes animais.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (2) / Mestrado acadêmico: (1) . , Integrantes: Aristeu Vieira da Silva - Coordenador / Ronaldo César da Rosa - Integrante / Jacqueline Batista de Araújo - Integrante / Noemila Débora Kozerski - Integrante., Financiador(es): Universidade Paranaense - Bolsa / Universidade Paranaense - Auxílio financeiro., Número de produções C, T & A: 2

  • 2009 - 2010

    Centro de monitoramento e vigilância da resistência antimicrobiana em bactérias patogênicas para o gado de leite, Descrição: Essa proposta trata da consolidação de um Centro Colaborador em Defesa Agropecuária (CDA) para monitoramento e avaliação do risco da resistência aos antimicrobianos (RAM) de bactérias patogênicas do gado de leite (CDA-RAM). O CDA-RAM será estruturado inicialmente para o monitoramento da resistência antimicrobiana dos patógenos da mastite bovina e será sediado na Embrapa Gado de Leite, Juiz de Fora, MG. Propõe-se que o CDA-RAM atue em escala nacional e para isso, foram estabelecidas parcerias estratégicas com sete unidades laboratoriais localizadas em seis estados das regiões Sul, Sudeste e Nordeste. No futuro essa representação poderá ser ampliada para outras regiões. Para o monitoramento da resistência bacteriana serão utilizados microrganismos provenientes de rebanhos distribuídos nessas regiões, permitindo sinergia e estreita colaboração com o setor produtivo. Um componente importante do projeto será a padronização dos métodos de isolamento e identificação dos microrganismos. Os laboratórios parceiros, já estruturados para realizar essas atividades, serão responsáveis pela análise de amostras de leite para isolamento, identificação e realização dos testes de susceptibilidade aos antimicrobianos. Dessa forma, se ampliará o universo amostral, permitindo além do monitoramento espacial, a investigação dos genes de resistência ao longo do tempo. Igualmente importante será a padronização e uniformização dos testes de susceptibilidade aos antimicrobianos, o que permitirá a comparação de resultados. Para isso, o CDA-RAM organizará cursos e testes interlaboratoriais, e atuará colaborativamente tanto na confirmação dos isolamentos e na identificação dos microrganismos isolados, quanto nos estudos de caracterização dos genes de resistência e na análise estatística dos dados. Espera-se com o projeto prover a Defesa Agropecuária com dados sobre avaliação do risco da resistência antimicrobiana dos agentes da mastite bovina representativos de diversas bacias leiteiras brasilei. , Situação: Em andamento; Natureza: Pesquisa. , Integrantes: Aristeu Vieira da Silva - Integrante / Rinaldo Aparecido Mota - Integrante / Lisiane de Almeida Martins - Integrante / Kelli Cristina Martini - Integrante / Adil Knackfuss Vaz - Integrante / Bruno Garcia Botaro - Integrante / Carla C. Lange - Integrante / Elaine Gil Moreschi - Integrante / Eliana Knackfuss Vaz - Integrante / Elizabeth Sampaio - Integrante / Geraldo Márcio Costa - Integrante / Guilherme Nunes de Souza - Integrante / Héber Brenner Araújo Costa - Integrante / Henrique César Pereira Figueiredo - Integrante / José Renaldi Feitosa de Brito - Integrante / Leandro Diamantino Feijó - Integrante / Luis Gustavo Corbellini - Integrante / Marcia Giambiagi-de Marvalllini - Integrante / Marcos Veiga dos Santos - Integrante / Maria Aparecida V. P. Brito - Coordenador / Maria do Carmo de Freire Bastos - Integrante / Marisa Cardoso - Integrante / Roberta Hilsdorf Piccoli - Integrante / Rodrigo Moreira Dantas - Integrante / Sandra Maria Ferraz - Integrante., Financiador(es): Conselho Nacional de Desenvolvimento Científico e Tecnológico - Auxílio financeiro.

  • 2009 - 2009

    Leptospirose em suínos de granjas da região de Toledo, PR, Descrição: Entre as enfermidades da esfera reprodutiva que afetam a produção de suínos, destaca-se a leptospirose, seja pela sua prevalência, seja por determinarem grandes prejuízos devido a queda da produtividade e perda de conceptos. Na região de Toledo a atividade de produção de suínos não registro de trabalhos anteriores sobre esta enfermidade. Assim, este trabalho pretende verificar a prevalência de anticorpos anti-Leptospira em suínos em 20 propriedades do município de Toledo, e determinar os fatores de risco para a presença deste agente no rebanho.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (2) / Especialização: (0) / Mestrado acadêmico: (2) / Mestrado profissional: (0) / Doutorado: (0) . , Integrantes: Aristeu Vieira da Silva - Coordenador / Danilo Ratti da Silva - Integrante / Priscila Luiza Mello - Integrante., Financiador(es): Universidade Paranaense - Auxílio financeiro / Universidade Paranaense - Bolsa., Número de produções C, T & A: 5

  • 2008 - 2009

    Prevalência da leptospirose e da neosporose em bovinos e cães de propriedades de Umuarama - PR, Descrição: Entre as enfermidades da esfera reprodutiva que afetam a produção de bovinos leiteiros, destacam-se a leptospirose e a neosporose, seja pela sua prevalência, seja por determinarem grandes prejuízos devido a queda da produtividade e perda de conceptos. Na região de Umuarama a atividade de produção leiteira concentra-se em pequenas propriedades, sem registro de trabalhos anteriores sobre estas enfermidades. Assim, este trabalho pretende verificar a prevalência de anticorpos anti-Leptospira e anti-Neospora em bovinos e cães de propriedades de exploração leiteira do município de Umuarama, e determinar os fatores de risco para a presença destes agentes no rebanho.. , Situação: Em andamento; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (2) / Mestrado acadêmico: (1) . , Integrantes: Aristeu Vieira da Silva - Coordenador / Thays Mizuki Lucas - Integrante / Thiago de Oliveira Zamprogna - Integrante / Adriano Augusto Martins - Integrante / João Luis Garcia - Integrante., Financiador(es): Universidade Paranaense - Auxílio financeiro / Universidade Paranaense - Bolsa., Número de produções C, T & A: 5

  • 2008 - 2009

    Ovos embrionados como modelo experimental da toxoplasmose congênita, Descrição: A toxoplasmose é uma zoonose de distribuição mundial, que tem nos felídeos o hospedeiro definitivo do parasito, e nos demais animais homeotérmicos, incluindo o ser humano os hospedeiros intermediários. Tanto no homem quanto nos animais, a infecção pelo Toxoplasma gondii pode levar a importantes quadros patológicos, notadamente a doença ocular, a enfermidade congênita, mas também quadros agudos de infecção em pacientes imunodeprimidos. O estudo de novas drogas é importante para a instituição de novos protocolos terapêuticos, principalmente para a toxoplasmose congênita, entretanto, os modelos experimentais normalmente utilizados são ou dispendiosos ou de resposta lenta. Este projeto de pesquisa propõe a padronização de um modelo experimental baseado em ovos embrionados para a pesquisa relacionada à toxoplasmose congênita.. , Situação: Em andamento; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (1) . , Integrantes: Aristeu Vieira da Silva - Coordenador / Thays Mizuki Lucas - Integrante., Financiador(es): Universidade Paranaense - Auxílio financeiro / Universidade Paranaense - Bolsa., Número de produções C, T & A: 1

  • 2008 - 2009

    Estudo morfológico da parede intestinal e do plexo mientérico de gatos infectados pelo Toxoplasma gondii, Descrição: O Toxoplasma gondii é um parasito intracelular obrigatório, cujo ciclo de vida é facultativamente heteroxeno. Os felídeos são os hospedeios definitivos e no seu intestino ocorre o ciclo sexuado. Na maioria dos estudos experimentais há a análise das repercussões da toxoplasmose sobre o sistema nervoso central ou retina de mamíferos. Também existem estudos de microscopia de luz e eletônica que avaliam as alterações especificamente na mucosa intestinal do gato, demonstrando uma lacuna na literatura quanto ao estudo dos efeitos do toxoplasma gondii nos demais estratos que compõe a parede intestinal dos felinos assim como de seus efeitos sobre o sistema nervoso entérico destes animais.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Mestrado acadêmico: (1) . , Integrantes: Aristeu Vieira da Silva - Integrante / Débora de Mello Gonçales Sant'Ana - Coordenador., Financiador(es): Universidade Paranaense - Auxílio financeiro., Número de produções C, T & A: 1

  • 2008 - 2009

    Estudo da parede intestinal de galinhas (Gallus gallus) infectadas pelo Toxoplasma gondii, Descrição: O Toxoplasma gondii é um parasita intracelular obrigatório, cujo ciclo de vida é facultativamente heteroxeno: os felídeos são os hospedeiros definitivos, enquanto provavelmente todos os animais homeotérmicos são hospedeiros intermediários. Na maioria dos estudos experimentais que avaliam a ação do parasita sobre os sistemas do organismo animal, ratos e camundongos são os modelos biológicos mais utilizados, no entanto, poucos são os estudos que avaliam as repercussões da doença na fase crônica para a parede intestinal, a mais frequênte via de entrada do parasita, e nesse sentido, as galinhas necessitam ser estudadas por representar animais que apresentam alta incidência desta infecção. Deste modo, o objetivo deste trabalho será o de realizar uma análise morfométrica da parede intestinal de galinhas infectadas por Toxoplasmose gondii. Para tanto, será utilizado o duodeno e jejuno de dezesseis galinhas , as quais serão divididas em três grupos. O grupo experimental (n=12) será inoculado com cistos teciduais (n=6) de T. gondii da cepa ME49 e com oocistos (n=6) da cepa ME7741 pela via oral com o auxílio de gavage.. Os quatro remanescentes (grupo controle) não serão infectados pelo parasita. Serão submetidos a eutanásia após 60 dias. Os segmentos intestinais coletados serão submetidos a rotina histológica, com a realização de cortes histológicos de 3-4 m e a coloração por HE, PAS e Alcian Blue. Através de sistema computadorizado de análise de imagens será realizada a captura e mensurações na espessura dos estratos da parede intestinal.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Mestrado acadêmico: (1) . , Integrantes: Aristeu Vieira da Silva - Integrante / Débora de Mello Gonçales Sant'Ana - Coordenador., Financiador(es): Universidade Paranaense - Auxílio financeiro., Número de produções C, T & A: 3

  • 2007 - 2011

    Aspectos soroepidemiológicos e moleculares da infecção pelo Toxoplasma gondii em humanos, suínos e galináceos no estado do Pará, Descrição: Este projeto de pesquisa tem por objetivo caracterizar a infecção pelo T. gondii em humanos, suínos e galináceos em cinco municípios paraenses, através de metodologias sorológicas e moleculares. Para tanto, deverá: a) Determinar a taxa de soroprevalência de toxoplasmose em humanos, suínos e galináceos nos municípios selecionados; b) Confirmar o diagnóstico da toxoplasmose aguda em humanos pela PCR; c) Isolar cepas de T. gondii em amostras de tecidos de suínos e galináceos com sorologia compatível com toxoplasmose crônica; d) Fazer a genotipagem direta das cepas, sem isolamento prévio em amostras humanas; e) Determinar o genótipo das cepas isoladas nas amostras de tecidos de suínos e galináceos; f) Determinar fatores de risco para contaminação dos animais investigados, com o Toxoplasma nas áreas de criação e/ou abate dos mesmos.. , Situação: Concluído; Natureza: Pesquisa. , Integrantes: Aristeu Vieira da Silva - Integrante / Marinete Marins Póvoa - Coordenador / Ediclei Lima do Carmo - Integrante., Financiador(es): Conselho Nacional de Desenvolvimento Científico e Tecnológico - Auxílio financeiro., Número de produções C, T & A: 5

  • 2007 - 2009

    Genotipagem das amostras de Toxoplasma gondii isoladas de ovinos de abatedouro, Descrição: O Toxoplasma gondii é um parasita de grande importância no contexto de produção animal e saúde pública, envolvendo alterações fetais e abortos na espécie humana e em animais. É ainda um patógeno oportunista importante em pacientes imunocomprometidos. Possui uma estrutura populacional predominante de linhagens designadas I, II e III. A sua transmissão por alimentos tem sido caracterizada como de alto risco à saúde humana. Na espécie ovina é considerado como importante agente causador de abortamentos, além de se apresentar como um risco potencial de infecção pelos alimentos derivados de ovinos. Serão colhidas amostras de sangue, cérebro, pulmão, língua, diafragma e coração de ovinos destinados ao abate, em abatedouro municipal de São Manuel-SP. Após a dessora, as amostras de soro serão submetidas às provas sorológicas de aglutinação direta modificada, com antígeno inativado pelo metanol (MAT-AM) ou formalina (MAT-AF), permitindo a diferenciação entre os estágios da infecção toxoplásmica, e à reação de imunofluorescência indireta (RIFI). As amostras teciduais dos animais soropositivos serão maceradas e parte delas será submetida à digestão pela pepsina, inoculando os materiais, digeridos ou não, em camundongos para o isolamento do parasita. Será realizada a genotipagem das amostras isoladas, pela análise de multiplex-PCR, em cinco loci (SAG1, SAG2, SAG3, BTUB e GRA6). Pretende-se isolar e caracterizar genotipicamente amostras de T.gondii isoladas de tecidos de ovinos abatidos para o consumo humano; detectar a fase da infecção em que o animal foi abatido, pela comparação de provas sorológicas; e analisar os perfis de genotipagem obtidos na multiplex-PCR.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Doutorado: (1) . , Integrantes: Aristeu Vieira da Silva - Integrante / Rodrigo Costa da Silva - Integrante / Benedito Donizete Menozzi - Integrante / Helio Langoni - Coordenador., Financiador(es): Fundação de Amparo à Pesquisa do Estado de São Paulo - Auxílio financeiro.

  • 2007 - 2009

    Estudo quantitativo e morfométrico de neurônios mientéricos corados com azul cuprolínico de suínos infectados por Toxoplasma gondii, Descrição: O objetivo deste estudo é realizar um estudo quantitativo e morfométrico de neurônios mientéricos corados com azul cuprolínico de suínos infectados por Toxoplasma gondii. Propomos este estudo baseado nos registros de intensa produção de carne suína brasileira, com destaque ao Estado do Paraná, e também cientes do fato de que a toxoplasmose pode causar diarréia nesses animais, o que pode comprometer sua produção. Como a diarréia se deve a modificações morfofisiológicas do plexo mioentérico (complexo grupo de neurônios que controlam os movimentos intestinais), avaliaremos as alterações morfológicas desse plexo para a principal região de absorção de nutrientes: jejuno-íleo. Para isso, coletaremos jejuno e íleo de suínos de 10 animais hígidos e de 10 animais infectados por T. gondii experimentalmente. Esses segmentos intestinais serão microdissecados para confecção de preparados de membrana (túnica muscular + serosa), os quais serão submetidos à técnica de coloração de neurônios mientéricos por azul cuprolínico. Para 120 campos microscópicos (ampliados 400X), 40 da região mesentérica, 40 da intermediária e 40 da antimesentérica, serão contados o número total de neurônios mientérico. Além disso, será mensurada a área do pericário e do núcleo de 300 neurônios (considerando as diferentes regiões da circunferência intestinal).. , Situação: Concluído; Natureza: Pesquisa. , Integrantes: Aristeu Vieira da Silva - Integrante / Débora de Mello Gonçales Sant'Ana - Integrante / Eduardo José de Almeida Araújo - Coordenador., Financiador(es): Diretoria Executiva de Gestão da Pesquisa e da Pós Graduação - Auxílio financeiro.

  • 2007 - 2009

    Análise imunohistoquímica de neurônios mientéricos de suínos infectados por Toxoplasma gondii, Descrição: O objetivo deste estudo é realizar um estudo quantitativo e morfométrico de neurônios mientéricos miosina Va positivos de suínos infectados por Toxoplasma gondii. Propomos este estudo baseado nos registros de intensa produção de carne suína brasileira, com destaque ao Estado do Paraná, e também devido ao fato de que a toxoplasmose pode causar diarréia nesses animais, podendo comprometer sua produção. Como a diarréia se deve a modificações morfofisiológicas do plexo mientérico (complexo grupo de neurônios que controlam os movimentos intestinais), avaliaremos as alterações morfológicas desse plexo para a principal região de absorção de nutrientes: jejuno-íleo. Para isso, coletaremos jejuno e íleo de suínos de 10 animais sadios e de 10 animais infectados por T. gondii experimentalmente. Esses segmentos intestinais serão microdissecados para confecção de preparados de membrana (túnica muscular + serosa), os quais serão submetidos à técnica de imunohistoquímica para marcação da miosina Va em neurônios mientéricos. Para 120 campos microscópicos (ampliados 400X), 40 da região mesentérica, 40 da intermediária e 40 da antimesentérica, serão contados o número total de neurônios mientérico. Além disso, será mensurada a área do pericário e do núcleo de 300 neurônios (considerando as diferentes regiões da circunferência intestinal).. , Situação: Concluído; Natureza: Pesquisa. , Integrantes: Aristeu Vieira da Silva - Integrante / Débora de Mello Gonçales Sant'Ana - Integrante / Eduardo José de Almeida Araújo - Coordenador., Financiador(es): Diretoria Executiva de Gestão da Pesquisa e da Pós Graduação - Auxílio financeiro.

  • 2007 - 2009

    Localização do Toxoplasma gondii na parede intestinal de ratos através de análises imunohistoquímicas e PCR, Descrição: O objetivo deste estudo é investigar a localização do Toxoplasma gondii (protozoário causador da toxoplasmose) na parede intestinal de ratos utilizando técnicas de imunolocalização e PCR (Reação em Cadeia da Polimerase).Propomos este estudo considerando o fato de que não há descrição de infecção da parede intestinal, sobretudo o Sistema Nervoso Entérico, pelo T. gondii. Para tanto, serão formados dois grupos: controle (n = 48) e experimental (n = 48). Serão utilizados ratos (Ratus novergicus) Wistar, machos, com 60 dias de idade. Os animais do grupo experimental serão infectados com 10 à quinta bradizoítos da cepa ME-49 de T. gondii por via oral com auxílio de gavagem. Os animais serão sacrificados após 12, 24,48, 72 horas (fase aguda) e 30 e 60 dias (fase crônica). Serão coletados sangue (para teste sorológico para confirmação da infecção dos animais do grupo experimental e de não infecção dos animais do grupo controle) e a porção média do jejuno. Parte desses segmentos intestinais serão dissecados para dividir a parede intestinal em duas partes: uma formada pela túnica mucosa + tela submucosa e outra formada pela túnica muscular + serosa. De cada uma dessas partes será extraído o DNA, e procedida a reação em cadeia pela polimerase (PCR) utilizando os oligonucleotídeos TOX4 (5CGCTGCAGGGAGGAAGACGAAAGTTG) e TOX5 (5CGCTGCAGACACAGTGCATCTGGATT) como inicializadores da reação. Em seguida será realizada uma eletroforese em gel de agarose para identificação dos produtos amplificados. O restante do jejuno e íleo será utilizado para confecção de preparados de membrana (formados pelo estrato circular da túnica muscular + serosa), os quais serão submetidos à técnica imunohistoqúimica para localização do T. gondii. Para 120 campos microscópicos (ampliados 400X), serão contados o número total de neurônios mientérico, de parasitos, número de parasitos por neurônio mientérico. Além disso, será mensurada a área do pericário e do núcleo de 300 neurônios (considerando as diferentes. , Situação: Concluído; Natureza: Pesquisa. , Integrantes: Aristeu Vieira da Silva - Integrante / Débora de Mello Gonçales Sant'Ana - Integrante / Eduardo José de Almeida Araújo - Coordenador., Financiador(es): Diretoria Executiva de Gestão da Pesquisa e da Pós Graduação - Auxílio financeiro / Diretoria Executiva de Gestão da Pesquisa e da Pós Graduação - Auxílio financeiro.

  • 2007 - 2009

    Avaliação enzimohistoquímica de neurônios mientéricos de suínos infectados por Toxoplasma gondii, Descrição: O objetivo deste estudo é realizar um estudo quantitativo e morfométrico de neurônios mientéricos NADH-diaforase e NADPH-diaforase positivos de suínos infectados por Toxoplasma gondii. Propomos este estudo baseado nos registros de intensa produção de carne suína brasileira, com destaque ao Estado do Paraná, e também devido ao fato de que a toxoplasmose pode causar diarréia nesses animais, podendo comprometer sua produção. Como a diarréia se deve a modificações morfofisiológicas do plexo mientérico (complexo grupo de neurônios que controlam os movimentos intestinais), avaliaremos as alterações morfológicas desse plexo para a principal região de absorção de nutrientes: jejuno-íleo. Para isso, coletaremos jejuno e íleo de suínos de 10 animais hígidos e de 10 animais infectados por T. gondii experimentalmente. Esses segmentos intestinais serão microdissecados para confecção de preparados de membrana (túnica muscular + serosa), os quais serão submetidos à técnica de enzimohistoquímica para marcação de neurônios mientéricos NADH-diaforase e NADPH-diaforase positivos. Para 120 campos microscópicos (ampliados 400X), 40 da região mesentérica, 40 da intermediária e 40 da antimesentérica, serão contados o número total de neurônios mientéricos evidenciados por esta técnica. Além disso, será mensurada a área do pericário e do núcleo de 300 neurônios (considerando as diferentes regiões da circunferência intestinal).. , Situação: Concluído; Natureza: Pesquisa. , Integrantes: Aristeu Vieira da Silva - Integrante / Débora de Mello Gonçales Sant'Ana - Integrante / Eduardo José de Almeida Araújo - Coordenador., Financiador(es): Diretoria Executiva de Gestão da Pesquisa e da Pós Graduação - Auxílio financeiro.

  • 2007 - 2009

    Isolamento e Avaliação Molecular de Cepas de Toxoplasma gondii isoladas de suínos no Noroeste do Paraná, Descrição: Com os objetivos de isolar amostras de Toxoplasma gondii de cérebro de suínos abatidos para consumo humano, comparar a freqüência de isolamentos em amostras tratadas ou não em solução ácida de pepsina, verificar o perfil de virulência das amostras de T.gondii isoladas em camundongos e genotipar as amostras isoladas pela análise de fragmentos de restrição do gene SAG2 e pela multiplex-PCR para cinco diferentes seqüências gênicas, comparando-se então perfis de geno e fenotipagem das cepas isoladas, este trabalho será conduzido como um estudo transversal, onde amostras de sangue e cérebro de suínos serão colhidas em frigorífico da região Noroeste do Paraná, e dos animais positivos ao método de aglutinação direta para detecção de anticorpos anti-T.gondii, os cérebros, submetidos ou não à digestão ácida com pepsina, serão inoculados em camundongos para isolamento do parasita, que posteriormente serão fenotipados em camundongos. As amostras de parasita isoladas serão submetidas à análise do polimorfismo do gene SAG2 e à reação em cadeia pela polimerase para cinco marcadores microsatélites em protocolo multiplex, para determinação do perfil genotípico de cada amostra. Pretende-se estabelecer a prevalência da infecção toxoplásmica em suínos abatidos na região, avaliando sua feno e genotipagem, e estabelecer um método mais rápido e de maior resolução na determinação dos genótipos parasitários.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (4) / Mestrado acadêmico: (2) . , Integrantes: Aristeu Vieira da Silva - Coordenador., Financiador(es): Fundação Araucária de Apoio ao Desenvolvimento Científico e Tecnológico - Auxílio financeiro / Universidade Paranaense - Bolsa / Universidade Paranaense - Auxílio financeiro., Número de produções C, T & A: 17

  • 2007 - 2008

    Análise morfométrica da parede intestinal do jejuno de ratos infectados por cistos teciduais de Toxoplasma gondii, Descrição: O Toxoplasma gondii é um parasito intracelular obrigatório, cujo ciclo de vida é facultativamente heteroxeno: os felídeos são os hospedeiros definitivos, enquanto provavelmente todos os animais homeotérmicos são hospedeiros intermediários. Na maioria dos estudos experimentais que avaliam a ação do parasita sobre os sistemas do organismo animal, ratos e camundongos são os modelos biológicos mais utilizados, no entanto, poucos são os estudos que avaliam as repercussões da doença na fase aguda e crônica para a parede intestinal, a mais freqüente via de entrada do parasito. Os ratos são os animais de laboratório mais indicados para esta avaliação, por serem mais resistentes. Deste modo, o objetivo deste trabalho será o de realizar uma análise morfométrica da parede intestinal do jejuno de ratos Wistar infectados por Toxoplasmose gondii através de infecções agudas e crônicas. Para tanto, utilizaremos o jejuno e de vinte ratos Wistar machos de 60dias de idade, os quais serão divididos em dois grupos. O grupo experimental (n=10) será inoculado pela via oral com o auxílio de gavage com bradizoítos de T gondii. Os dez animais remanescentes (grupo controle) não serão infectados pelo parasito e serão sacrificados nos mesmos intervalos de tempo. Cada grupo será subdividido em agudo, sacrificado 24horas após a inoculação e crônico, sacrificado 30 dias após a inoculação. Os segmentos intestinais coletados serão submetidos a rotina histológica, com a realização de cortes histológicos de 6 um e a coloração por HE. Através de sistema computadorizado de análise de imagens realizaremos a captura e mensurações na espessura da parede total do intestino e dos quatro diferentes estratos da parede intestinal.. , Situação: Concluído; Natureza: Pesquisa. , Integrantes: Aristeu Vieira da Silva - Integrante / Débora de Mello Gonçales Sant'Ana - Coordenador / Eduardo José de Almeida Araújo - Integrante., Financiador(es): Diretoria Executiva de Gestão da Pesquisa e da Pós Graduação - Auxílio financeiro.

  • 2007 - 2008

    Estudo da toxoplasmose em uma comunidade rural, Descrição: A toxoplasmose é uma zoonose de distribuição mundial, que tem nos felídeos o hospedeiro definitivo do parasito, e nos demais animais homeotérmicos, incluindo o ser humano os hospedeiros intermediários. Tanto no homem quanto nos animais, a infecção pelo Toxoplasma gondii pode levar a importantes quadros patológicos, notadamente a doença ocular, a enfermidade congênita, mas também quadros agudos de infecção em pacientes imunodeprimidos. Entre as formas de infecção do ser humano, ganha importância a ingestão de produtos de origem animal, notadamente de origem suína e aviária, mas os animais de estimação podem ganhar importância como marcadores do nível de infecção de uma dada população, por muitas vezes compartilharem as mesmas fontes de infecção que o ser humano. No ambiente rural, são diversificadas as formas como o homem e os animais podem se infectar, seja pela ingestão de carne de animais infectados, seja pelo contato com o solo ou mesmo com a água contaminada por oocistos do parasito. Neste projeto propõe-se colher amostras de sangue de pessoas de uma comunidade rural, para detecção de anticorpos séricos anti-Toxoplasma pelo método de aglutinação direta, bem como levantar, pela aplicação de um questionário, dados para caracterização dos fatores de risco para a infecção toxoplásmica nesta população, de forma a identificar as principais fontes de infecção, subsidiando propostas posteriores de prevenção desta parasitose.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (3) / Mestrado acadêmico: (2) . , Integrantes: Aristeu Vieira da Silva - Coordenador / Fernando César Belinato - Integrante / Nelton Bespalez Corrêa - Integrante / Leonardo Garcia Velazques - Integrante / Susiana Galli - Integrante / Joil Moreira Marques - Integrante / Isabela Maria Polido Guerra - Integrante / Cleiton Paulo Aigner - Integrante / Thays Mizuki Lucas - Integrante., Financiador(es): Universidade Paranaense - Auxílio financeiro / Universidade Paranaense - Bolsa., Número de produções C, T & A: 16

  • 2007 - 2007

    Toxoplasmose experimental e natural em Gallus gallus, Descrição: Amostras de sangue, cérebro e coração de galinhas serão colhidas em propriedades de uma comunidade rural do Estado do Mato Grosso do Sul. O soro obtido das amostras de sangue será submetido ao método de aglutinação direta para detecção de anticorpos anti-Toxoplasma gondii, e os cérebros e corações, submetidos à digestão ácida com pepsina, e inoculados em camundongos para isolamento do parasita. O perfil de virulência para camundongos das amostras de Toxoplasma gondii isoladas será determinando. Adicionalmente, será conduzido um estudo experimental em aves higidas, para determinar os padrões clínicos, sorológicos e a recuperação do parasito dos órgãos dos animais parasitados.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (4) / Mestrado acadêmico: (2) . , Integrantes: Aristeu Vieira da Silva - Coordenador / Fernando César Belinato - Integrante / Susiana Galli - Integrante / Cleiton Paulo Aigner - Integrante., Financiador(es): Universidade Paranaense - Auxílio financeiro / Não informado / Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa / Universidade Paranaense - Bolsa., Número de produções C, T & A: 4

  • 2007 - 2007

    Toxoplasmose experimental em roedores, Descrição: A toxoplasmose é uma importante zoonose, que causa enfermidades da esfera reprodutiva em diferentes espécies animais e no ser humano, além de doença ocular, principalmente no homem, e encefalites em individuos imunocomprometidos. Os roedores, notadamente o camundongo Mus musculus, são extremamente susceptíveis a infecção pelo Toxoplasma gondii, sendo então utilizados como modelos experimentais desta parasitose. Esta pesquisa pretende estabelecer a via de inoculação e o estágio infectante ideais para a produção de cistos teciduais de diferentes cepas de T. gondii em camundongos, bem como investigar quais os melhores meios de criopreservação para manutenção do parasito por longos períodos.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (4) / Mestrado acadêmico: (1) . , Integrantes: Aristeu Vieira da Silva - Coordenador / João Marco Pansera Bottin - Integrante / Heric Boareto - Integrante / Susiana Galli - Integrante., Financiador(es): Diretoria Executiva de Gestão da Pesquisa e da Pós Graduação - Auxílio financeiro / Diretoria Executiva de Gestão da Pesquisa e da Pós Graduação - Bolsa., Número de produções C, T & A: 2

  • 2006 - 2009

    Comparação da multiplex-PCR e da nested-PCR na genotipagem de amostras de Toxoplasma gondii isoladas de suínos, Descrição: Com os objetivos de isolar amostras de Toxoplasma gondii de cérebro de suínos abatidos para consumo humano, comparar a freqüência de isolamentos em amostras tratadas ou não em solução ácida de pepsina, verificar o perfil de virulência das amostras de T.gondii isoladas em camundongos e genotipar as amostras isoladas pela análise de fragmentos de restrição do gene SAG2 e pela multiplex-PCR para cinco diferentes seqüências gênicas, comparando-se então perfis de geno e fenotipagem das cepas isoladas, este trabalho será conduzido como um estudo transversal, onde amostras de sangue e cérebro de suínos serão colhidas em frigorífico da região Noroeste do Paraná, e dos animais positivos ao método de aglutinação direta para detecção de anticorpos anti-T.gondii, os cérebros, submetidos ou não à digestão ácida com pepsina, serão inoculados em camundongos para isolamento do parasita, que posteriormente serão fenotipados em camundongos. As amostras de parasita isoladas serão submetidas à análise do polimorfismo do gene SAG2 e à reação em cadeia pela polimerase para cinco marcadores microsatélites em protocolo multiplex, para determinação do perfil genotípico de cada amostra. Pretende-se estabelecer a prevalência da infecção toxoplásmica em suínos abatidos na região, avaliando sua feno e genotipagem, e estabelecer um método mais rápido e de maior resolução na determinação dos genótipos parasitários.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (4) / Especialização: (0) / Mestrado acadêmico: (1) / Mestrado profissional: (0) / Doutorado: (0) . , Integrantes: Aristeu Vieira da Silva - Coordenador / Luiz Sérgio Merlini - Integrante / Rodrigo José Mattei - Integrante / Ronaldo César da Rosa - Integrante / Franciele Rossandra Piassa - Integrante., Financiador(es): Fundação Araucária de Apoio Ao Desenvolvimento Científico e Tecnológico do - Auxílio financeiro / Universidade Paranaense - Auxílio financeiro / Universidade Paranaense - Bolsa., Número de produções C, T & A: 25

  • 2006 - 2008

    Análise do plexo mioentérico do intestino delgado de ratos infectados por Toxoplasma gondii, Descrição: O Toxoplasma gondii é um parasita intracelular obrigatório, cujo ciclo de vida é facultativamente heteroxeno: os felídeos são os hospedeiros definitivos, enquanto provavelmente todos os animais homeotérmicos são hospedeiros intermediários. Na maioria dos estudos experimentais que avaliam a ação do parasita sobre os sistemas do organismo animal, ratos e camundongos são os modelos biológicos mais utilizados, no entanto, poucos são os estudos que avaliam as repercussões da doença na fase crônica para a parede intestinal, a mais frequênte via de entrada do parasita, e nesse sentido, os ratos são mais indicados em relação aos camundongos, por serem mais resistentes. Além disso, como a toxoplasmose frequentemente apresenta complicações neurológicas, estudos experimentais que utilizem neurônios entéricos representam uma forma acessível de compreender a ação do parasita sobre o tecido nervoso. O sistema nervoso entérico apresenta-se como um modelo adequado para a compreensão da biologia do neurônio e de doenças que envolvem esta célula, pois está organizado em plexos na parede do tubo gastrointestinal, favorecendo que sejam visualizados por meio de dissecção, sem a necessidade de cortes histológicos. Dessa forma, propusemos este projeto no intuitode compreender o fenótipo de virulência do T gondii, durante a fase aguda e crônica da infecção, para a parede do intestino delgado de ratos jovens. Para tanto, utilizaremos o jejuno e o íleo de vinte ratos Wistar machos de 60dias de idade, os quais serão divididos em dois grupos. O grupo experimental (n=24) será inoculado pela via oral com o auxílio de gavage com 105 bradizoítos de T gondii cepa ME- 49. Os vinte e quatro animais remanescentes (grupo controle) não serão infectados pelo parasita e serão sacrificados nos mesmos intervalos de tempo. Os neurônios serão submetidos a coloração para evidenciação de toda a população neuronal.. , Situação: Em andamento; Natureza: Pesquisa. , Integrantes: Aristeu Vieira da Silva - Integrante / Débora de Mello Gonçales Sant'Ana - Coordenador / Eduardo José de Almeida Araújo - Integrante., Financiador(es): Universidade Paranaense - Auxílio financeiro., Número de produções C, T & A: 10

  • 2006 - 2006

    Uso do extrato etílico de Bouchea fluminensis no pós-operatório em cães submetidos a artrotomia do joelho - Estudo experimental, Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (4) / Especialização: (0) / Mestrado acadêmico: (1) / Mestrado profissional: (0) / Doutorado: (0) . , Integrantes: Aristeu Vieira da Silva - Coordenador / Gentil Ferreira Gonçalves - Integrante / Rosemeres Horwat Delaporte - Integrante / Marcelo Guimarães Fuentes - Integrante / Vinicius de Oliveira Cruz - Integrante / Priscila Beraldi Cervinhani - Integrante / Simone Cabral Pupo - Integrante., Financiador(es): Universidade Paranaense - Auxílio financeiro., Número de produções C, T & A: 5

  • 2005 - 2005

    Efeitos de coxibs sobre o crescimento tumoral e o metabolismo hepático de ratos com tumor de Walker-256, Descrição: O projeto objetiva avaliar os efeitos de drogas antiinflamatórias não esteroidais de nova geração, os coxibs, especialmente o parecoxib e o celecoxib, em ratos com neoplasia experimental obtida pela inoculação de células do carcinossarcoma Walker-256. O projeto investigará as vias metabólicas hepáticas em animais portadores de câncer tratados com drogas que parecem ser promissoras para o tratamento de neoplasias. O estabelecimento dos efeitos metabólicos induzidos por inibidores da COX2 embasará os dados disponíveis em literatura sobre seu uso em pacientes com neoplasias, pois tais dados ainda estão incipientes. Este projeto é parte integrante de outro denominado ALTERAÇÕES METABÓLICAS NA CAQUEXIA ASSOCIADA AO CÂNCER E À ARTRITE , financiado pela Fundação Araucária/ CNPq, no Programa de Apoio a Núcleos de Excelência (PRONEX), no âmbito da chamada 04/2003, sob a coordenação do Prof. Dr. Adelar Bracht, da Universidade Estadual de Maringá (UEM), local em que o projeto será integralmente desenvolvido.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (0) / Especialização: (0) / Mestrado acadêmico: (0) / Mestrado profissional: (0) / Doutorado: (0) . , Integrantes: Aristeu Vieira da Silva - Integrante / Alexandra Acco - Coordenador., Financiador(es): Universidade Paranaense - Auxílio financeiro / Universidade Paranaense - Bolsa.

  • 2004 - 2006

    Perfil epidemiológico da toxoplasmose canina: análise fenotípica de cepas de Toxoplasma gondii isoladas de cães - Protocolo 0291/2004, Descrição: No período de abril de 2004 a novembro de 2005, foram avaliados 352 cães para a presença de anticorpos anti-Toxoplasma gondii no soro e/ou plasma sangüíneo. Dos animais avaliados, 62 (17,61%) apresentaram anticorpos anti-Toxoplasma em títulos maiores ou iguais a 64. A avaliação de variáveis hematológicas não revelou associação com a positividade ao teste para detecção de anticorpos anti-Toxoplasma. Material cerebral de dois cães foi inoculado em camundongos, para tentativa de isolamento do parasito, que se logrou negativo.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (4) / Especialização: (0) / Mestrado acadêmico: (0) / Mestrado profissional: (0) / Doutorado: (0) . , Integrantes: Aristeu Vieira da Silva - Coordenador / João Marco Pansera Bottin - Integrante / Fernando César Belinato - Integrante / Francislaine Aparecida dos Reis Lívero - Integrante / Edson Assis Bastos Júnior - Integrante / Isabela Maria Polido Guerra - Integrante., Financiador(es): Universidade Paranaense - Auxílio financeiro., Número de produções C, T & A: 18

  • 2004 - 2005

    Desenvolvimento de células de sarcoma TG-180 em camundongos. Uso na avaliação da atividade anti-tumoral de Agaricus blazei em cogumelo em fases fechada e aberta, Descrição: O sarcoma murino TG180 é uma linhagem celular neoplásica não-aderente, utilizada freqüentemente na avaliação da atividade tumoral de princípios ativos naturais e sintéticos, bem como na avaliação de interações célula-hospedeira e parasita. Este projeto visa avaliar a atividade anti-tumoral de extratos de Agaricus blazei obtidos de cogumelos colhidos em fase fechada e em fase aberta. Para tanto, três grupos de camundongos serão inoculados pela via subcutânea com células de sarcoma e após sete dias receberão diariamente pela via oral solução salina (Controle), extrato de cogumelo colhido em fase fechada (Grupo F) e extrato de cogumelo colhido em fase aberta (Grupo A), por até 30 dias, quando sofrerão eutanásia. Diariamente será avaliado o diâmetro da massa tumoral, para avaliação do índice de inibição tumoral e calculado o índice esplênico a partir da medida da massa do baço em relação a massa corporal.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (3) / Especialização: (0) / Mestrado acadêmico: (0) / Mestrado profissional: (0) / Doutorado: (0) . , Integrantes: Aristeu Vieira da Silva - Coordenador / Lisiane de Almeida Martins - Integrante / Nelson Barros Colauto - Integrante / Valdeci Messa - Integrante / Giani Andrea Linde - Integrante., Financiador(es): Universidade Paranaense - Bolsa / Universidade Paranaense - Auxílio financeiro., Número de produções C, T & A: 6

  • 2003 - 2004

    Virulência de cepas de Toxoplasma gondii isoladas de cães com sintomatologia neurológica, Descrição: A virulência de várias cepas de Toxoplasma gondii isoladas de cães com sintomatologia neurológica será avaliada em modelo in vivo, estabelecendo-se parâmetros de virulência aguda (tempo para o óbito e perda de peso), bem como parâmetros de virulência crônica (tempo para o óbito, perda de peso, título de anticorpos anti-Toxoplasma e formação de cistos cerebrais), em camundongos Swiss tratados ou não com sulfadiazina.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (1) / Especialização: (2) / Mestrado acadêmico: (1) / Mestrado profissional: (0) / Doutorado: (0) . , Integrantes: Aristeu Vieira da Silva - Integrante / Sandia Bergamaschi Pezerico - Integrante / Helio Langoni - Coordenador., Financiador(es): Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa., Número de produções C, T & A: 1

  • 2003 - 2004

    Utilização da reação em cadeia pela polimerase na detecção de DNA de Toxoplasma gondii em amostras de soro de camundongos experimentalmente infectados, Descrição: A detecção de DNA de Toxoplasma gondii em amostras de sangue tem grande potencial no auxílio diagnóstico desta infecção durante a fase aguda, tanto no homem como em animais. Problemas inerentes a qualidade da amostra obtida, principalmente a contaminação com hemoglobina podem inibir a atividade da polimerase, inviabilizando a detecção de DNA na amostra. A utilização de amostra de soro em detrimento do sangue total pode contornar este problema. Este trabalho visa comparar a detecção de DNA de T.gondii, em soro de camundongos experimentalmente infectados com três cepas do parasita, em diferentes momentos após a infecção dos animais, bem como comparar este resultado com o do exame sorológico.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (1) / Especialização: (2) / Mestrado acadêmico: (0) / Mestrado profissional: (0) / Doutorado: (0) . , Integrantes: Aristeu Vieira da Silva - Integrante / Sandia Bergamaschi Pezerico - Integrante / Camila Bianco das Dores - Integrante / Helio Langoni - Coordenador., Financiador(es): Fundação de Amparo à Pesquisa do Estado de São Paulo - Bolsa., Número de produções C, T & A: 1

  • 2002 - 2004

    Avaliação da transmissão transplacentária de cepas de Toxoplasma gondii genotipicamente distintas, em camundongas BALB/c, Descrição: A toxoplasmose é uma zoonose de relevância como causa de abortos ou enfermidade congênita consequentes à infecção materna durante a gravidez, cujo agente etiológico é o parasita intracelular obrigatório Toxoplasma gondii. Este agente possui uma estrutura populacional que consiste predominantemente de três linhagens, designadas I, II e III, com características fortemente clonais, podendo ocorrer reinfecção do hospedeiro por uma cepa de genótipo distinta daquela que causou a infecção primária. A toxoplasmose congênita tem sido estudada em camundongos da linhagem BALB/c, por não ocorrer a transmissão do parasita por sucessivas gerações nestes animais. Desta forma, pretende-se verificar se a infecção crônica em camundongas BALB/c por uma cepa de genótipo I (RH) previne a transmissão transplacentária de uma cepa de genótipo II (ME-49), e vice-versa; avaliar a presença do parasita no útero, placenta e fetos, utilizando-se da bioprova e reação em cadeia pela polimerase, bem como, associar os resultados obtidos com as alterações patológicas macroscópicas, materna e fetal.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (0) / Especialização: (0) / Mestrado acadêmico: (1) / Mestrado profissional: (0) / Doutorado: (0) . , Integrantes: Aristeu Vieira da Silva - Integrante / Sandia Bergamaschi Pezerico - Integrante / Helio Langoni - Coordenador., Financiador(es): Fundação de Amparo à Pesquisa do Estado de São Paulo - Bolsa., Número de produções C, T & A: 2

  • 2002 - 2004

    Caracterização micobacteriana, bioquímica e molecular de isolados de pacientes atendidos no Hospital das Clínicas da Faculdade de Medicina de Botucatu - SP, Descrição: A tuberculose bovina é uma zoonose de distribuição mundial. Sua prevalência é maior nos países em desenvolvimento e menor nos países desenvolvidos. No Brasil começa agora a implantação do Programa Nacional de Controle da Tuberculose Bovina, com nova legislação, que prevê o abate sanitário dos animais positivos. A tuberculose bovina causa grandes prejuízos à economia do país, diminuindo o rendimento da carne e leite dos rebanhos. Além disso, representa uma ameaça para a saúde humana que dependerá do contato direto com o animal ou dos hábitos alimentares da população, principalmente pela ingestão de leite cru. A pesquisa apresentada, justifica-se pela importância da tuberculose enquanto zoonose e pelo seu impacto negativo na área de saúde pública, principalmente na população de menor poder aquisitivo, contribuindo também para elucidar o papel do Mycobacterium bovis na etiologia da tuberculose humana.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (0) / Especialização: (0) / Mestrado acadêmico: (0) / Mestrado profissional: (0) / Doutorado: (1) . , Integrantes: Aristeu Vieira da Silva - Integrante / Helio Langoni - Coordenador., Financiador(es): Fundação de Amparo à Pesquisa do Estado de São Paulo - Bolsa., Número de produções C, T & A: 1

  • 2001 - 2003

    Qualidade do leite: aspectos físico-químicos, microbiológicos e citológicos nas infecções intramamárias, Descrição: Os resultados do presente estudo trarão informações substanciais quanto à qualidade do leite, ao se comparar para os vários itens a serem pesquisados os resultados de tetas sadias com suas homólogas positivas para os microrganismos citados. Em fase posterior pretende-se trabalhar no sentido de se verificar a qualidade e os aspectos de produção dos derivados lácteos como iogurtes, queijos e mussarelas. Esta idéia fará parte de um futuro projeto de pesquisa que contribuirá para análise profunda do estudo da cadeia produtiva do leite, fazendo com que nos adequemos do ponto de vista tecnológico para a produção leiteira e de seus subprodutos com melhor qualidade, acatando as novas tendências do mercado lácteo brasileiro.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (3) / Especialização: (0) / Mestrado acadêmico: (2) / Mestrado profissional: (0) / Doutorado: (1) . , Integrantes: Aristeu Vieira da Silva - Integrante / Cassiano Victória - Integrante / Acácia Orieth Elias - Integrante / Helio Langoni - Coordenador., Financiador(es): Fundação de Amparo à Pesquisa do Estado de São Paulo - Auxílio financeiro., Número de produções C, T & A: 1

  • 2001 - 2002

    Correlação dos resultados das análises microbiológicas, físico-químicas e celulares do leite, na mastite por Corynebacterium bovis, Descrição: O presente trabalho visa estudar a infecção da glândula mamária por este agente, e verificar as alterações encontradas tanto em nível de glândula mamária, pela contagem de células somáticas e da citologia aspirativa por agulha fina (CAAF), como também no leite, pelas análises fisico-químicas, comparando-se os resultados, com os obtidos nos tetos homólogos negativos para o referido microrganismo, bem como o exame microbiológico negativo cultivado em condições aeróbicas. Serão coletadas amostras de leite de diferentes propriedades, com a realização das seguintes análises: CMT; contagem de células somáticas em aparelho (Somacount 300- Bentley); cultivo do leite em ágar sangue bovino a 10% para isolamento do Corynebacterium bovis, incluindo-se a contagem de unidades formadoras de colônias em placas; provas bioquímicas para sua classificação taxonômica e análises fisico-químicas para verificar as alterações nas propriedades organolépticas e de composição do leite, além do exame citológico por punção aspirativa do parênquima mamário, para se avaliar o grau de resposta inflamatória à infecção.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (0) / Especialização: (0) / Mestrado acadêmico: (2) / Mestrado profissional: (0) / Doutorado: (0) . , Integrantes: Aristeu Vieira da Silva - Integrante / Cassiano Victória - Integrante / Acácia Orieth Elias - Integrante / Helio Langoni - Coordenador., Financiador(es): Fundação de Amparo à Pesquisa do Estado de São Paulo - Bolsa., Número de produções C, T & A: 1

  • 2001 - 2002

    Contribuição ao estudo das mastites estreptocócicas bovinas: Aspectos citológicos, microbiológicos e físico-químicas, Descrição: Levando-se em consideração a alta prevalência da mastite subclínica nos rebanhos, e das alterações na composição dos elementos físico-químicos do leite, assim como alterações no California Mastitis Test, contagem de células somáticas, citologia das glândulas afetadas, pretende-se estudar a relação de todos os fatores supracitados com a mastite subclínica causada por microrganismos do gênero Streptococcus ssp, correlacionando-se os resultados obtidos com as variáveis a serem estudadas, segundo o projeto ora apresentado.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (0) / Especialização: (0) / Mestrado acadêmico: (1) / Mestrado profissional: (0) / Doutorado: (0) . , Integrantes: Aristeu Vieira da Silva - Integrante / Helio Langoni - Coordenador., Financiador(es): Fundação de Amparo à Pesquisa do Estado de São Paulo - Bolsa., Número de produções C, T & A: 1

  • 2000 - 2001

    Ação do Diazepam na infecção experimental de hamsters (Mesocricetus auratus) com Leptospira interrogans sorovar pomona, Descrição: Os benzodiazepínicos, entre eles o diazepam, estão entre as drogas mais prescritas dentro da classe de psicotrópicos em todo o mundo, e há evidências de seus efeitos imunossupressores. Este trabalho teve como objetivo estudar a sua ação imunodepressora na infecção leptospírica em hamsters. Foram utilizados 4 grupos de 10 animais, a saber: G1 , tratado somente com 1 ml de meio de Fletcher e sacrificado após 86 horas; G2, inoculado com 1 ml de suspensão de L.pomona em meio de Fletcher, contendo 106 microrganismos; G3, inoculado como o G2, e tratado com 1,5 mg de diazepam/kg no momento da inoculação, e G4, inoculado como G2, e tratado antes da inoculação com a mesma dose de diazepam durante 5 dias. Para o isolamento e quantificação de leptospiras a partir dos rins, as culturas foram realizadas em meio de Fletcher, nas diluições 10-1, 10-2, 10-3 e l:4, 1:16 e 1:64, respectivamente, em solução salina adicionada de antibióticos. Os animais dos grupos 2, 3 e 4 adoeceram e morreram em até 86 horas após a inoculação. Para a quantificação de leptospiras, nos animais do grupo 2 obteve-se o seu isolamento até o 26° dia, sendo que 9 animais (90%) foram positivos na diluição 1:64 e o restante na diluição 1:16. Nos grupos 3 e 4 obteve-se o isolamento de leptospiras a partir do 18° dia após a inoculação dos tubos, sendo que estes resultados mantiveram-se por até 24 e 23 dias nos grupos 3 e 4, respectivamente. Quanto à recuperação das leptospiras, no grupo 2 o seu isolamento foi possível em 80% dos animais somente a partir do 26° dia após a inoculação, enquanto que nos grupos 3 e 4 obteve-se em 40% e 20% deles, 24 e 23 dias, respectivamente, após a inoculação dos tubos. Estes resultados, embora parciais, mostram uma menor concentração de leptospiras nos grupos tratados com Diazepam, bem como maior período de incubação in vitro. Não notou-se diferença quanto ao período de incubação, entre os animais inoculados dos grupos 3 e 4.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (1) / Especialização: (2) / Mestrado acadêmico: (0) / Mestrado profissional: (0) / Doutorado: (1) . , Integrantes: Aristeu Vieira da Silva - Integrante / Victor S M Bastos - Integrante / Vanessa Yuri de Lima - Integrante / Helio Langoni - Coordenador., Financiador(es): Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa., Número de produções C, T & A: 1

  • 1999 - 2000

    Prevalência de anticorpos anti-Toxoplasma gondii em suínos pelos métodos de aglutinação direta e reação de imunofluorescência indireta, Descrição: Este trabalho teve por objetivo pesquisar anticorpos anti-Toxoplasma gondii em soros de suínos, pelas técnicas de reação de imunofluorescência indireta (RIFI) e método de aglutinação direta (MAD). Foram examinadas 759 amostras de soros de suínos, oriundas de 25 propriedades, sendo 17 do Estado de São Paulo e 8 do Estado de Pernambuco, sendo que destas, 17 responderam a questionário de levantamento de dados epidemiológicos e zoosanitários. Das amostras de soro colhidas, 759 foram examinadas pelo MAD e 757 pela RIFI. O número de amostras positivas ao MAD foi 10 (1,32%) e pela RIFI, 16 (2,11%). Os testes diferiram significativamente, mas apresentaram substancial concordância entre os resultados, com coeficiente kappa k=0,6619, concordância de resultados positivos de 66,67% e concordância de resultados negativos de 99,46%. Não foram encontradas associações importantes entre as variáveis epidemiológicas, zoosanitárias e o resultado do exame sorológico.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (1) / Especialização: (0) / Mestrado acadêmico: (0) / Mestrado profissional: (0) / Doutorado: (0) . , Integrantes: Aristeu Vieira da Silva - Integrante / Helio Langoni - Coordenador., Financiador(es): Fundação de Amparo à Pesquisa do Estado de São Paulo - Bolsa.

  • 1998 - 2000

    Estudo da flora microbiana aeróbica, perfis de sensibilidade e contagem de células somáticas para monitoramento e controle das mastites bovinas na bacia leiteira da região de Avaré, SP, Descrição: Os resultados obtidos com esta pesquisa nos fornecerão subsídios quanto à prevalência das mastites nas propriedades estudadas, bem como de sua evolução durante o período proposto, permitindo ainda o estudo dos patógenos envolvidos, e do primeiro perfil de sensibilidade frente a vários antimicrobianos; para orientação terapêutica no final da lactação, no momento da secagem. O desenvolvimento desta pesquisa em diferentes propriedades possibilitará o assessoramento de todos os pesquisadores, e técnicos envolvidos no projeto, quanto a possíveis interferências no manejo para controlar a sua prevalência. Além do exposto, com este trabalho de monitoramento, provavelmente obter-se-á uma redução na sua ocorrência, o que seguramente redundará em aumento na produção leiteira, com a obtenção de leite de melhor qualidade, o que é desejável, levando-se em consideração os aspectos de Saúde Pública.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (3) / Especialização: (1) / Mestrado acadêmico: (0) / Mestrado profissional: (0) / Doutorado: (0) . , Integrantes: Aristeu Vieira da Silva - Integrante / Paulo Francisco Domingues - Integrante / Eva Laurice Pereira Cunha - Integrante / Luiz Carlos de Souza - Integrante / Luciana R Meirelles - Integrante / Fabio Carreira Ribeiro - Integrante / Ana Carolina Mortari - Integrante / Helio Langoni - Coordenador., Financiador(es): Fundação de Amparo à Pesquisa do Estado de São Paulo - Auxílio financeiro., Número de produções C, T & A: 11

  • 1998 - 1999

    Avaliação da ação da proteína purificada de Parapoxvirus ovis cepa D17001 (BaypamunHK), em camundongos albinos, experimentalmente infectados com Toxoplasma gondii AS28, submetidos ou não ao tratamento com sulfadiazina-pirimetamina, Descrição: A estimulação imunitária não-específica é denominada paraimunização, e corresponde a um estado imunitário independente do contato do sistema imune com patógenos específicos. A ativação dos sistemas envolvidos na paraimunidade pode ocorrer naturalmente, pelo contato de agentes infecciosos, ou gerada artificialmente pela administração de indutores de paraimunidade. O Parapoxvirus ovis (cepa D1701), agente isolado de pústulas epiteliais de ovelhas, é reconhecidamente um ativador da paraimunidade, sendo o componente ativo do Baypamun, produto que vem sendo amplamente utilizado na profilaxia e como coadjuvante do tratamento específico de várias enfermidades infecciosas, e condições imunodepressoras, tais como estresse e neoplasias. O presente trabalho teve como objetivo verificar a ação do BaypamunHK sobre a sobrevida de camundongos albinos, experimentalmente infectados com Toxoplasma gondii amostra RH, submetidos ou não a tratamento com sulfadiazina-pirimetamina (S-P), bem como sobre a formação e número de cistos cerebrais de Toxoplasma gondii. Quatro grupos de 20 camundongos Swiss, albinos, de 40 dias de idade, foram inoculados com 105 taquizoítos de Toxoplasma gondii, amostra RH, via subcutânea, sendo o Grupo 1 (G1) não tratado nem com S-P nem com Baypamun, o Grupo 2 (G2) tratado apenas com Baypamun (duas aplicações, IM, no segundo e quarto dias após a infecção), o Grupo 3 (G3) tratado apenas com S-P (200 mg/L de água de bebida, VO, do primeiro ao décimo-quinto dia após a infecção, e o Grupo 4 (G4) tratado com Baypamun e S-P segundo o esquema anterior. Amostras de sangue foram colhidas semanalmente para obtenção de soro e sorologia pela reação de imunofluorescência indireta (RIFI) para anticorpos IgG. Foi observada a sobrevida dos animais, em dias, e dos animais que vieram a óbito foram colhidas amostras de cérebro, pulmão e fígado, para contagem de parasitas nos órgãos, cistos cerebrais e macrófagos pulmonares infectados.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (0) / Especialização: (1) / Mestrado acadêmico: (1) / Mestrado profissional: (0) / Doutorado: (0) . , Integrantes: Aristeu Vieira da Silva - Integrante / Helio Langoni - Coordenador., Financiador(es): Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa., Número de produções C, T & A: 1

  • 1998 - 1999

    Padronização do método de aglutinação direta com antígeno formalizado para detecção de anticorpo anti-Toxoplasma gondii. Comparação com a reação de imunofluorescência indireta, Descrição: Foram examinados 591 soros, sendo 100 amostras de ovinos, 100 de caprinos, 100 de caninos, 191 de felinos e 100 de murinos, pela reação de imunofluorescência indireta (RIFI), e 100 soros de cada uma das cinco espécies pelo método de aglutinação direta (MAD), com antígeno obtido de camundongos inoculados com taquizoítos de Toxoplasma gondii e células de sarcoma TG180. Para a RIFI, foram reagentes 23,0%, 18,0%, 8,0%, 19,4% e 35,0% dos ovinos, caninos, caprinos, felinos e murinos, respectivamente. No MAD, 27,0%, 19,0%, 11,0%, 11,0% e 37,0% dos ovinos, caninos, caprinos, felinos e murinos, respectivamente, foram reagentes. Não foi constatada diferença significativa entre as provas, sendo que o MAD para as diferentes espécies, em relação à RIFI, apresentou sensibilidade entre 75,00 a 95,65%, especificidade de 90,77 a 95,12%, e eficácia igual ou superior a 90%.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (1) / Especialização: (0) / Mestrado acadêmico: (0) / Mestrado profissional: (0) / Doutorado: (0) . , Integrantes: Aristeu Vieira da Silva - Integrante / André Antônio Cutolo - Integrante / Helio Langoni - Coordenador., Financiador(es): Fundação de Amparo à Pesquisa do Estado de São Paulo - Bolsa., Número de produções C, T & A: 2

  • 1997 - 1999

    Participação do Toxoplasma gondii e de outros microrganismos nos abortos em ovinos, Descrição: O projeto objetivou estudar a etiologia dos abortos na espécie ovina, pesquisando-se a flora bacteriana aeróbica em órgãos fetais e placentas, e a participação do Toxoplasma gondii nestes abortamentos por meio de diferentes métodos: imunofluorescência indireta, ELISA, histopatologia, peroxidase anti-peroxidase, bem como pela reação em cadeia pela polimerase e prova biológica com tentativa de isolamento deste agente em camundongos, a partir de amostras de fígado, baço, pulmões, musculatura fetais e de placenta. Foram realizados ainda exames citológicos destes mesmos órgãos corando-se fragmentos pelos métodos de Giemsa e Macchiavello, para se estudar a participação da Chlamydia spp na etiologia dos abortos infecciosos nesta espécie. A participação de Leptospira spp foi pesquisada em amostras de fígado e rins fetais, pelo cultivo em meio específico, bem como a presença de anticorpos anti-leptospirícos frente a diferentes sorovares de leptospiras, em amostras de soros pareadas, obtidas das mães logo após o aborto e duas semanas após. Os resultados quanto a participação do Toxoplasma gondii na etiologia dos abortos, de acordo com os diferentes métodos utilizados, foram correlacionados. Os resultados sorológicos das amostras de soro no momento do aborto e após este, foram relacionados com os demais resultados obtidos, tanto para Toxoplasma como para Leptospira spp.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (0) / Especialização: (0) / Mestrado acadêmico: (0) / Mestrado profissional: (0) / Doutorado: (0) . , Integrantes: Aristeu Vieira da Silva - Integrante / Helio Langoni - Coordenador., Financiador(es): Fundação de Amparo à Pesquisa do Estado de São Paulo - Auxílio financeiro., Número de produções C, T & A: 17

Prêmios

2015

Terceiro lugar na modalidade poster Probic Ciências da Vida pelo trabalho Infecção por Toxocara e Toxoplasma em frangos, Universidade Estadual de Feira de Santana.

2015

Segundo lugar na modalidade Oral PIBIC/FAPESB Ciências da Vida pelo trabalho "Pesquisa de cistos de Sarcocytis e anticrpos anti-Toxoplasma gondii em amostras de embutidos comercializados em feiras, Universidade Estadual de Feira de Santana.

2015

Segundo lugar na categoria Bolsista do PIBIC/CNPq - Ciências da Vida pela aluna Taise C.S.B. Queiroz, Universidade Estadual de Feira de Santana / CNPq.

2010

Melhor Trabalho Científico Apresentado na Forma de Pôster - XV Congresso Médico Amazônico, Sociedade Médico-Cirúrgica do Pará.

2007

Professor homenageado pelos formandos do Curso de Medicina Veterinária, Universidade Paranaense.

2001

Menção Honrosa - Trabalho de Iniciação Científica, Universidade Estadual Paulista Julio de Mesquita Filho.

1999

Over Sea Grant, Martin Tielen Fund Fundation.

1994

Melhor aluno de Iniciação Científica, Faculdade de Medicina Veterinária e Zootecnia.

Histórico profissional

Endereço profissional

  • Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas - DCBIO. , Avenida Transnordestina, s/n, Novo Horizonte, 44036900 - Feira de Santana, BA - Brasil, Telefone: (75) 31618325, Fax: (75) 31618027, URL da Homepage:

Experiência profissional

2020 - Atual

Universidade Estadual de Feira de Santana

Vínculo: Servidor Público, Enquadramento Funcional: Professor Pleno, Carga horária: 40, Regime: Dedicação exclusiva.

Outras informações:
Em março de 2020 submeteu-se ao processo de progressão para a classe de Professor Pleno, sendo aprovado e efetivado na classe em julho de 2020.

2016 - 2020

Universidade Estadual de Feira de Santana

Vínculo: Servidor Público, Enquadramento Funcional: Professor Titular Nível B, Carga horária: 40, Regime: Dedicação exclusiva.

Outras informações:
Professor Titular B

2014 - 2016

Universidade Estadual de Feira de Santana

Vínculo: Servidor Público, Enquadramento Funcional: Professor Titular Nível A, Carga horária: 40, Regime: Dedicação exclusiva.

Outras informações:
Professor da disciplina de Parasitologia Humana junto ao Departamento de Ciências Biológicas. Portaria UEFS 1532/2014 de 13 de outubro de 2014.

2012 - 2014

Universidade Estadual de Feira de Santana

Vínculo: , Enquadramento Funcional: Professor Adjunto B, Carga horária: 40, Regime: Dedicação exclusiva.

Outras informações:
Professor da disciplina de Parasitologia Humana junto ao Departamento de Ciências Biológicas

2010 - 2012

Universidade Estadual de Feira de Santana

Vínculo: Servidor Público, Enquadramento Funcional: Professor Adjunto A, Carga horária: 40, Regime: Dedicação exclusiva.

Outras informações:
Professor da disciplina de Parasitologia Humana junto ao Departamento de Ciências Biológicas

Atividades

  • 05/2021

    Conselhos, Comissões e Consultoria, Pró-Reitoria de Pesquisa e Pós-Graduação.,Cargo ou função, Representante do DBIO junto ao Comitê de Pesquisa -COPESQ.

  • 04/2021

    Conselhos, Comissões e Consultoria, Reitoria.,Cargo ou função, Membro da Comissão de Biossegurança - CBio/UEFS.

  • 02/2021

    Ensino, Modelagem em Ciências da Terra e do Ambiente, Nível: Pós-Graduação,Disciplinas ministradas, Tópicos Especiais

  • 07/2020

    Pesquisa e desenvolvimento, Programa de Pós-Graduação em Modelagem em Ciências da Terra e do Ambiente.,Linhas de pesquisa

  • 07/2016

    Ensino, Ciências Biológicas, Nível: Graduação,Disciplinas ministradas, Biossegurança

  • 07/2016

    Ensino, Ciências Biológicas, Nível: Graduação,Disciplinas ministradas, Biossegurança (BIO712)

  • 07/2015

    Outras atividades técnico-científicas , Departamento de Ciências Biológicas - DCBIO, Departamento de Ciências Biológicas - DCBIO.,Atividade realizada, Vice-coordenador do Laboratório de Fisiologia e Parasitologia Experimental.

  • 11/2013

    Conselhos, Comissões e Consultoria, Comitê de Ética no Uso de Animais.,Cargo ou função, Representante (suplente) do Biotério Central.

  • 07/2016 - 06/2021

    Ensino, SAÚDE COLETIVA, Nível: Pós-Graduação,Disciplinas ministradas, Orientação de Pós-Graduação

  • 11/2010 - 06/2021

    Pesquisa e desenvolvimento, Programa de Pós-Graduação em Zoologia.,Linhas de pesquisa

  • 06/2018 - 03/2020

    Direção e administração, UEFS Editora.,Cargo ou função, Membro do Conselho representando a Pró-Reitoria de Pesquisa e Pós-Graduação.

  • 11/2017 - 03/2020

    Conselhos, Comissões e Consultoria, Reitoria.,Cargo ou função, Representante titular da Pró-Reitoria de Pesquisa e Pós-Graduação junto à Comissão Interna de elaboração do Plano de Internacionalização Institucional da UEFS 2018-2022.

  • 10/2015 - 03/2020

    Conselhos, Comissões e Consultoria, Comissão Própria de Avaliação Institucional.,Cargo ou função, Representante suplente da administração superior junto à CPA.

  • 10/2015 - 03/2020

    Conselhos, Comissões e Consultoria, Comissão para o Processo de Curricularização da Extensão.,Cargo ou função, Representante da PPPG na CPCE.

  • 08/2015 - 03/2020

    Conselhos, Comissões e Consultoria, Reitoria.,Cargo ou função, Membro da Comissão de Sistematização do Projeto de Recredenciamento da UEFS.

  • 02/2013 - 03/2020

    Conselhos, Comissões e Consultoria, Pró-Reitoria de Ensino de Graduação.,Cargo ou função, Representante da PPPG junto ao Comitê Gestor da Política Nacional de Formação Inicial e Continuada de Profissionais da Educação Básica (Portaria 247/2013).

  • 11/2012 - 03/2020

    Conselhos, Comissões e Consultoria, Assessoria Especial de Relações Interinstitucionais.,Cargo ou função, Representante da Pró-Reitoria de Pesquisa e Pós-graduação na Comissão Interna de Cooperação Internacional.

  • 02/2017 - 05/2019

    Direção e administração, Pró-Reitoria de Pesquisa e Pós-Graduação.,Cargo ou função, Pró-Reitor de Pesquisa e Pós-Graduação.

  • 12/2011 - 03/2018

    Ensino, Mestrado Profissional em Saúde Coletiva, Nível: Pós-Graduação,Disciplinas ministradas, Análise de dados epidemiológicos, Conceitos e métodos estatísticos aplicados aos serviços e sistemas de saúde

  • 10/2011 - 01/2017

    Direção e administração, Pró-Reitoria de Pesquisa e Pós-Graduação.,Cargo ou função, Coordenador da Pós-Graduação (DAS-3).

  • 01/2016 - 01/2016

    Direção e administração, Pró-Reitoria de Pesquisa e Pós-Graduação.,Cargo ou função, Pró-Reitor de Pesquisa e Pós-Graduação em Exercício.

  • 06/2015 - 07/2015

    Conselhos, Comissões e Consultoria, Programa de Pós-Graduação em Zoologia.,Cargo ou função, Membro titular da Comissão para Seleção de Professor Visitante.

  • 05/2013 - 07/2015

    Outras atividades técnico-científicas , Departamento de Ciências Biológicas - DCBIO, Departamento de Ciências Biológicas - DCBIO.,Atividade realizada, Coordenador do Laboratório de Fisiologia e Parasitologia Experimental - LFPE.

  • 01/2013 - 01/2013

    Direção e administração, Pró-Reitoria de Pesquisa e Pós-Graduação.,Cargo ou função, Pró-Reitor (provimento temporário) - Portaria 1941/2012.

  • 11/2012 - 01/2013

    Conselhos, Comissões e Consultoria, Reitoria.,Cargo ou função, Membro da Comissão de Sistematização do Projeto de Recredenciamento da Universidade Estadual de Feira de Santana.

  • 10/2012 - 10/2012

    Conselhos, Comissões e Consultoria, Comitê Interno de Iniciação Científica.,Cargo ou função, Membro da Comissão Científica do XVI SEMIC-UEFS.

  • 09/2012 - 09/2012

    Conselhos, Comissões e Consultoria, Departamento de Saúde - DSAU.,Cargo ou função, Presidente da Comissão de Análise do Processo de Progressão de Carreira do Prof. José de Bessa Júnior.

  • 10/2011 - 03/2012

    Direção e administração, Colegiado do Curso de Graduação em Agronomia.,Cargo ou função, Vice-coordenador "pro tempore".

  • 09/2010 - 03/2012

    Conselhos, Comissões e Consultoria, Comitê Interno de Iniciação Científica.,Cargo ou função, Representante do Departamento de Ciências Biológicas.

  • 08/2011 - 12/2011

    Conselhos, Comissões e Consultoria, Programa de Pós-Graduação em Zoologia.,Cargo ou função, Membro da Comissão de Divulgação para Ingresso no Programa de Pós-Graduação em Zoologia.

  • 08/2011 - 12/2011

    Conselhos, Comissões e Consultoria, Programa de Pós-Graduação em Zoologia.,Cargo ou função, Membro da Comissão do Processo Seletivo para Ingresso no Programa de Pós-Graduação em Zoologia.

  • 09/2010 - 12/2011

    Conselhos, Comissões e Consultoria, Colegiado do Curso de Graduação em Enfermagem.,Cargo ou função, Representante da área II do Departamento de Ciências Biológicas.

  • 11/2010 - 11/2011

    Direção e administração, Departamento de Ciências Biológicas - DCBIO.,Cargo ou função, Coordenador da Área II - Biomédicas.

  • 02/2011 - 09/2011

    Ensino, Odontologia, Nível: Graduação,Disciplinas ministradas, Parasitologia Humana

  • 03/2011 - 06/2011

    Ensino, Zoologia, Nível: Pós-Graduação,Disciplinas ministradas, Tópicos Especiais em Zoologia: Metodologia e Análise de Experimentos

  • 12/2010 - 03/2011

    Conselhos, Comissões e Consultoria, Pró-Reitoria de Pesquisa e Pós-Graduação.,Cargo ou função, Membro da Comissão de Elaboração da Proposta de Criação do Programa de Pós-Graduação Stricto-Sensu - Mestrado Acadêmico em Medicina.

  • 08/2010 - 12/2010

    Ensino, Enfermagem, Nível: Graduação,Disciplinas ministradas, Parasitologia Humana (BIO 405)

  • 08/2010 - 12/2010

    Ensino, Ciências Biológicas, Nível: Graduação,Disciplinas ministradas, Zoonoses

  • 03/2010 - 08/2010

    Ensino, Ciências Biológicas, Nível: Graduação,Disciplinas ministradas, Parasitologia I - Protozoologia (BIO 419), Parasitologia II - Helmintologia (BIO 420)

  • 03/2010 - 08/2010

    Ensino, Ciências Farmacêuticas, Nível: Graduação,Disciplinas ministradas, Parasitologia Humana (BIO 444)

  • 03/2010 - 08/2010

    Ensino, Medicina, Nível: Graduação,Disciplinas ministradas, Mecanismos de Agressão e Defesa (SAU 602)

2006 - 2010

Universidade Paranaense

Vínculo: Celetista, Enquadramento Funcional: Professor titular, Carga horária: 40, Regime: Dedicação exclusiva.

Outras informações:
Professor da Disciplina de Parasitologia Veterinária - Curso de Graduação em Medicina Veterinária Professor da Disciplina de Metodologia e Análise de Experimentos - Curso de Mestrado em Ciência Animal Professor da Disciplina de Epidemiologia e Estudo Experimental das Zoonoses - Curso de Mestrado em Ciência Animal Professor da Disciplina de Métodos de Diagnóstico Imunológico e Molecular - Curso de Mestrado em Ciência Animal Professor da Disciplina de Literatura e Linguagem Científica - Curso de Mestrado em Ciência Animal Coordenador do Curso de Mestrado em Ciência Animal

2003 - 2006

Universidade Paranaense

Vínculo: Celetista, Enquadramento Funcional: Professor horista, Carga horária: 38

Outras informações:
Professor de Parasitologia Geral, Parasitologia Veterinária e Doenças Parasitárias dos Animais Domésticos

2004 - 2005

Universidade Paranaense

Vínculo: Bolsista recém-doutor, Enquadramento Funcional: Bolsista de produtividade em pesquisa, Carga horária: 0

Outras informações:
Bolsa de Incentivo à Produtividade em Pesquisa - Programa Institucional de Bolsas de Incentivo à Pesquisa - Nível Bolsa Doutor Master

Atividades

  • 02/2010 - 03/2010

    Conselhos, Comissões e Consultoria, Diretoria Executiva de Gestão da Pesquisa e da Pós Graduação.,Cargo ou função, Presidente da Comissão de Gerenciamento do PROSUP do Mestrado em Ciência Animal.

  • 07/2007 - 03/2010

    Conselhos, Comissões e Consultoria, Diretoria Executiva de Gestão da Pesquisa e da Pós Graduação.,Cargo ou função, Representação da Coordenação do Mestrado em Ciência Animal junto ao Colegiado da Pós-Graduação Stricto Sensu.

  • 05/2007 - 03/2010

    Conselhos, Comissões e Consultoria, CDPA - Comitê Setorial de Estudos sobre a Demanda e Permanência do Alunado.,Cargo ou função, Pesquisador institucional.

  • 02/2007 - 03/2010

    Ensino, Medicina Veterinária, Nível: Graduação,Disciplinas ministradas, Doenças Parasitárias dos Animais Domésticos

  • 02/2006 - 03/2010

    Direção e administração, Diretoria Executiva de Gestão da Pesquisa e da Pós Graduação, Umuarama Sede.,Cargo ou função, Coordenador de curso - Mestrado em Ciência Animal.

  • 02/2006 - 03/2010

    Conselhos, Comissões e Consultoria, Diretoria Executiva de Gestão da Pesquisa e da Pós Graduação, Comitê de Ética Em Pesquisa Envolvendo Experimentação Animal.,Cargo ou função, Membro de comissão permanente.

  • 10/2005 - 03/2010

    Conselhos, Comissões e Consultoria, Mestrado Em Ciência Animal.,Cargo ou função, Membro de colegiado superior.

  • 05/2003 - 03/2010

    Ensino, Medicina Veterinária, Nível: Graduação,Disciplinas ministradas, Parasitologia Veterinária

  • 02/2009 - 02/2010

    Conselhos, Comissões e Consultoria, Diretoria Executiva de Gestão da Pesquisa e da Pós Graduação.,Cargo ou função, Presidente da Comissão de Gerenciamento do PROSUP do Mestrado em Ciência Animal.

  • 11/2008 - 12/2009

    Outras atividades técnico-científicas , Mestrado Em Ciência Animal, Mestrado Em Ciência Animal.,Atividade realizada, Coordenador do projeto de Apoio à Pós-Graduação Stricto Sensu, financiado pela Fundação Araucária, Edital 13/2008.

  • 04/2007 - 12/2009

    Outras atividades técnico-científicas , Diretoria Executiva de Gestão da Pesquisa e da Pós Graduação, Diretoria Executiva de Gestão da Pesquisa e da Pós Graduação.,Atividade realizada, Coordenador de projeto de pesquisa financiado pela Fundação Araucária, Edital 04/2006.

  • 11/2009 - 11/2009

    Ensino, Mestrado em Ciência Animal, Nível: Pós-Graduação,Disciplinas ministradas, Literatura e Linguagem Científica

  • 10/2009 - 10/2009

    Ensino, Mestrado em Ciência Animal, Nível: Pós-Graduação,Disciplinas ministradas, Técnicas de Diagnóstico Imunológico e Molecular

  • 09/2009 - 09/2009

    Ensino, Clínica de Ruminantes, Nível: Especialização,Disciplinas ministradas, Doenças Parasitárias

  • 06/2009 - 06/2009

    Ensino, Meio Ambiente Com Ênfase Em Química Ambiental, Nível: Especialização,Disciplinas ministradas, Estatística Aplicada ao Meio Ambiente

  • 05/2009 - 05/2009

    Ensino, Especialização em Implantodontia, Nível: Especialização,Disciplinas ministradas, Noções de Estatística Necessárias para Pesquisa

  • 03/2009 - 03/2009

    Ensino, Mestrado em Ciência Animal, Nível: Pós-Graduação,Disciplinas ministradas, Metodologia e Análise de Experimentos

  • 02/2006 - 03/2009

    Ensino, Mestrado em Ciência Animal, Nível: Pós-Graduação,Disciplinas ministradas, Metodologia e Análise de Experimentos

  • 02/2008 - 02/2009

    Conselhos, Comissões e Consultoria, Mestrado Em Ciência Animal.,Cargo ou função, Presidente da Comissão de Gerenciamento do PROSUP do Mestrado em Ciência Animal.

  • 09/2006 - 12/2008

    Outras atividades técnico-científicas , Mestrado Em Ciência Animal, Mestrado Em Ciência Animal.,Atividade realizada, Coordenador do projeto de Auxílio às Pós-Graduações Stricto-Sensu (Chamada 10/2005 da Fundação Araucária).

  • 08/2008 - 08/2008

    Ensino, Mestrado em Ciência Animal, Nível: Pós-Graduação,Disciplinas ministradas, Técnicas de Diagnóstico Microbiológico e Parasitológico

  • 07/2008 - 07/2008

    Ensino, Meio Ambiente Com Ênfase Em Química Ambiental, Nível: Especialização,Disciplinas ministradas, Estatística Aplicada ao Meio Ambiente

  • 07/2006 - 12/2007

    Conselhos, Comissões e Consultoria, Diretoria Executiva de Gestão da Pesquisa e da Pós Graduação, Mestrado Em Biotecnologia Aplicada a Agricultura.,Cargo ou função, Membro de colegiado superior.

  • 09/2006 - 11/2007

    Ensino, Mestrado em Ciência Animal, Nível: Pós-Graduação,Disciplinas ministradas, Técnicas de Diagnóstico Imunológico e Molecular

  • 08/2006 - 10/2007

    Ensino, Mestrado em Ciência Animal, Nível: Pós-Graduação,Disciplinas ministradas, Epidemiologia e Estudo Experimental das Zoonoses

  • 05/2007 - 05/2007

    Ensino, Mestrado Em Biotecnologia Aplicada a Agricultura, Nível: Pós-Graduação,Disciplinas ministradas, Caracterização de Microrganismos de Interesse Agropecuário

  • 02/2007 - 03/2007

    Ensino, Mestrado Em Biotecnologia Aplicada a Agricultura, Nível: Pós-Graduação,Disciplinas ministradas, Estatística Experimental

  • 10/2006 - 12/2006

    Ensino, Vigilância Sanitária e Epidemiologia em Saúde, Nível: Especialização,Disciplinas ministradas, Metodologia da Pesquisa Científica

  • 03/2006 - 12/2006

    Conselhos, Comissões e Consultoria, Comissão Própria de Avaliação Institucional.,Cargo ou função, Membro do Comitê Assessor Técnico - Núcleo de Pesquisa e Estatística.

  • 11/2006 - 11/2006

    Ensino, Clínica de Ruminantes, Nível: Especialização,Disciplinas ministradas, Seminários II

  • 09/2006 - 10/2006

    Ensino, Meio Ambiente Com Ênfase Em Química Ambiental, Nível: Especialização,Disciplinas ministradas, Métodos e Técnicas de Pesquisa

  • 11/2004 - 10/2006

    Conselhos, Comissões e Consultoria, Diretoria Executiva de Gestão da Pesquisa e da Pós Graduação, Umuarama Sede.,Cargo ou função, Membro da Comissão Interna de Biossegurança (CIBio).

  • 06/2006 - 06/2006

    Ensino, Meio Ambiente Com Ênfase Em Química Ambiental, Nível: Especialização,Disciplinas ministradas, Estatística Aplicada ao Meio Ambiente

  • 03/2005 - 12/2005

    Conselhos, Comissões e Consultoria, Curso de Graduação Em Farmácia, Umuarama Sede.,Cargo ou função, Membro de colegiado superior.

  • 02/2004 - 12/2005

    Ensino, Farmácia e Bioquímica, Nível: Graduação,Disciplinas ministradas, Parasitologia Geral

  • 08/2003 - 12/2005

    Ensino, Farmácia, Nível: Graduação,Disciplinas ministradas, Parasitologia Geral - Noturno

  • 05/2003 - 12/2005

    Ensino, Medicina Veterinária, Nível: Graduação,Disciplinas ministradas, Doenças Parasitárias dos Animais Domésticos

  • 08/2005 - 11/2005

    Ensino, Medicina Veterinária, Nível: Graduação,Disciplinas ministradas, Estágio Supervisionado em Medicina Veterinária

  • 08/2005 - 11/2005

    Ensino, Medicina Veterinária, Nível: Graduação,Disciplinas ministradas, Trabalho de Conclusão de Curso

  • 02/2005 - 11/2005

    Ensino, Farmácia, Nível: Graduação,Disciplinas ministradas, Trabalho de Conclusão de Curso

  • 07/2005 - 07/2005

    Ensino, Clínica de Ruminantes, Nível: Especialização,Disciplinas ministradas, Metodologia do Trabalho Científico

1995 - 2004

Universidade Estadual Paulista Júlio de Mesquita Filho

Vínculo: Colaborador, Enquadramento Funcional: Outro, Carga horária: 4

Outras informações:
Colaborador em projetos de pesquisa

2000 - 2003

Universidade Estadual Paulista Júlio de Mesquita Filho

Vínculo: Outro, Enquadramento Funcional: Outro, Carga horária: 40

Outras informações:
Desenvolvimento de trabalho de pesquisa - Tese de Doutorado

1997 - 1999

Universidade Estadual Paulista Júlio de Mesquita Filho

Vínculo: Outro, Enquadramento Funcional: Outro, Carga horária: 40

Outras informações:
Desenvolvimento de trabalho de pesquisa - Dissertação de Mestrado

1995 - 1997

Universidade Estadual Paulista Júlio de Mesquita Filho

Vínculo: Outro, Enquadramento Funcional: Outro, Carga horária: 40

Outras informações:
Médico-Veterinário Residente da Área de Zoonoses e Saúde Pública

Atividades

  • 02/2008

    Pesquisa e desenvolvimento, GP: Doenças Bacterianas e Zoonoses Tropicais em Animais de Companhia.,Linhas de pesquisa

  • 08/2005

    Outras atividades técnico-científicas , Faculdade de Medicina Veterinária e Zootecnia de Botucatu, Faculdade de Medicina Veterinária e Zootecnia de Botucatu.,Atividade realizada, Consultor ad-hoc da revista "Medicina Veterinária e Zootecnia".

  • 02/1999 - 02/2010

    Pesquisa e desenvolvimento, NUPEZO: Núcleo de Pesquisa em Zoonoses.,Linhas de pesquisa

  • 07/2002 - 09/2002

    Ensino,,Disciplinas ministradas, Colaborador técnico do curso

  • 08/1997 - 08/1997

    Conselhos, Comissões e Consultoria, Faculdade de Medicina Veterinária e Zootecnia de Botucatu, Departamento de Higiene Veterinária e Saúde Pública.,Cargo ou função, Banca de seleção para expnasão do grupo PET-CAPES da FMVZ-UNESP-Botucatu.

  • 01/1996 - 12/1996

    Direção e administração, Faculdade de Medicina Veterinária e Zootecnia de Botucatu, Departamento de Higiene Veterinária e Saúde Pública.,Cargo ou função, Primeiro-secretário da Associação dos Médicos Veterinários Residentes da FMVZ.

  • 03/1996 - 03/1996

    Conselhos, Comissões e Consultoria, Faculdade de Medicina Veterinária e Zootecnia de Botucatu, Departamento de Higiene Veterinária e Saúde Pública.,Cargo ou função, Representante Titular na Banca Eleitoral de representante junto ao Conselho de Departamento.

  • 01/1995 - 12/1995

    Direção e administração, Faculdade de Medicina Veterinária e Zootecnia de Botucatu, Departamento de Higiene Veterinária e Saúde Pública.,Cargo ou função, Vice-presidente da Associação dos Médicos Veterinários Residentes da FMVZ.

  • 03/1995 - 03/1995

    Conselhos, Comissões e Consultoria, Faculdade de Medicina Veterinária e Zootecnia de Botucatu, Departamento de Higiene Veterinária e Saúde Pública.,Cargo ou função, Representante titular na Banca Eleitoral para eleição de representante junto ao Conselho do Departamento.

2009 - 2010

Embrapa Gado de Leite

Vínculo: Colaborador, Enquadramento Funcional: Pesquisador, Carga horária: 0

Outras informações:
Projeto multicêntrico financiado pelo CNPq.

2007 - 2011

Instituto Evandro Chagas

Vínculo: Colaborador, Enquadramento Funcional: Pesquisador, Carga horária: 0

Outras informações:
Trabalho de pesquisa financiado pelo CNPq, associado a projeto de doutorado de acadêmico da Universidade Federal do Pará.

2013 - Atual

Universidade Federal da Bahia

Vínculo: Colaborador, Enquadramento Funcional: Professor Permanente da Pós-Graduação

Outras informações:
Cedido pela Universidade Estadual de Feira de Santana para atuar junto ao Programa de Pós-Graduação em Ciência Animal nos Trópicos, da Escola de Medicina Veterinária da Universidade Federal da Bahia. Atuará como docente permanente, orientando acadêmicos de Mestrado e Doutorado, ministrando disciplinas no curso e atuando em pesquisas interinstitucionais com outros docentes do programa. Estas atividades junto à UFBA não interferirão com as atividades na Universidade Estadual de Feira de Santana.

Atividades

  • 11/2013 - 11/2013

    Ensino, Ciência Animal Nos Trópicos, Nível: Pós-Graduação,Disciplinas ministradas, Doenças Infecciosas (MEV533)