Milena de Paiva Cavalcanti

Possui graduação em Medicina Veterinária pela Universidade Federal Rural de Pernambuco (2001), sendo a Laureada da turma (média geral 9,23), Mestrado em Ciência Veterinária pela Universidade Federal Rural de Pernambuco (2004) e Doutorado em Saúde Pública pelo Centro de Pesquisas Aggeu Magalhães (CPqAM) - FIOCRUZ-Recife-PE (2008). Tem experiência na área de diagnóstico e Resposta Imune (Vacinologia), atuando principalmente no tema leishmanioses. Atualmente exerce o cargo de Tecnologista na unidade da Fundação Oswaldo Cruz em Pernambuco (CPqAM), fazendo parte do Departamento de Microbiologia e do corpo docente da Pós-Graduação em Biociências e Biotecnologia em Saúde. Bolsista de Produtividade em Pesquisa nível 2 (Imunologia) e Líder do Grupo de Pesquisas "Inovações para o controle de patógenos".

Informações coletadas do Lattes em 24/06/2020

Acadêmico

Seção coletada automaticamente pelo Escavador

Formação acadêmica

Doutorado em Saúde Pública

2005 - 2008

Centro de Pesquisas Aggeu Magalhães
Título: Desenvolvimento e Avaliação de um sistema de PCR em tempo real para o diagnóstico da infecção por Leishmania infantum
Yara de Miranda Gomes. Bolsista do(a): Conselho Nacional de Desenvolvimento Científico e Tecnológico, CNPq, Brasil. Palavras-chave: diagnóstico; leishmaniose; PCR; PCR em tempo real.Grande área: Ciências da SaúdeGrande Área: Ciências da Saúde / Área: Saúde Coletiva / Subárea: Saúde Pública.

Mestrado em Ciência Veterinária

2002 - 2004

Universidade Federal Rural de Pernambuco
Título: Intercorrência entre agentes micóticos bacterianos e parasitários em lesões cutâneas de cães com diagnóstico presuntivo de leishmaniose visceral,Ano de Obtenção: 2004
Maria Aparecida da Gloria Faustino.Bolsista do(a): Coordenação de Aperfeiçoamento de Pessoal de Nível Superior, CAPES, Brasil. Palavras-chave: Dermatopatias; cães; leishmaniose.Grande área: Ciências AgráriasGrande Área: Ciências Agrárias / Área: Medicina Veterinária / Subárea: Medicina Veterinária Preventiva.

Graduação em Medicina Veterinária

1996 - 2001

Universidade Federal Rural de Pernambuco
Título: INFECÇÕES MICÓTICAS EMLESÕES CUTÂNEAS DE CÃES NATURALMENTE INFECTADOS COM LEISHMANIA CHAGASI
Orientador: MARIA APARECIDA DA GLORIA FAUSTINO
Bolsista do(a): Conselho Nacional de Desenvolvimento Científico e Tecnológico, CNPq, Brasil.

Seção coletada automaticamente pelo Escavador

Formação complementar

2013 - 2013

Vaccinology Course. (Carga horária: 170h). , Institut Pasteur, PASTEUR, França.

2010 - 2010

Ferramentas EStatísticas para a Qualidade. (Carga horária: 8h). , SQS Consultores Associados, SQS CONSULTORES, Brasil.

2010 - 2010

I Workshop Interno do Núcleo de Plataformas Tecnol. (Carga horária: 4h). , Centro de Pesquisas Aggeu Magalhães, CPQAM, Brasil.

2009 - 2009

Interpretando a norma ABNT NBR ISO 15189:2008. (Carga horária: 30h). , Centro de Pesquisas Aggeu Magalhães, CPQAM, Brasil.

2008 - 2008

I Curso de Formação de Auditores Internos do CPqAM. (Carga horária: 24h). , Q & P Consultoria em Gestão, Q & P, Brasil.

2007 - 2007

Documentando a Qualidade em Laboratórios. (Carga horária: 24h). , Rede Metrológica de Pernambuco, REMEPE, Brasil.

2007 - 2007

Avaliação em Laboratórios. (Carga horária: 24h). , Rede Metrológica de Pernambuco, REMEPE, Brasil.

2007 - 2007

Treinamento de PCR em tempo real. (Carga horária: 9h). , Centro de Pesquisas Aggeu Magalhães, CPQAM, Brasil.

2006 - 2006

3 Curso Sensibilização, Informaçãoem Biossegurança. (Carga horária: 15h). , Fundação Oswaldo Cruz, FIOCRUZ, Brasil.

2006 - 2006

II Curso de capacitação em experimentação Animal. (Carga horária: 24h). , Fundação Oswaldo Cruz, FIOCRUZ, Brasil.

2000 - 2000

I Simpósio de Diagnóstico por Imagem. , Universidade Federal Rural de Pernambuco, UFRPE, Brasil.

2000 - 2000

Charada Dermatológica. , Associação Nacional de Clínicos Veterinários de Pequenos Animais - ES, ANCLIVEPA-ES, Brasil.

1999 - 1999

Curso Teórico de Dermatologia de Caninos e Felinos. , Associação Nacional dos Clínicos Veterinários de Pequenos Animais - AL, ANCLIVEPA-AL, Brasil.

1999 - 1999

Doença de Felinos. , Associação Nacional dos Clínicos Veterinários de Pequenos Animais, ANCLIVEPA, Brasil.

Seção coletada automaticamente pelo Escavador

Idiomas

Bandeira representando o idioma Inglês

Compreende Bem, Fala Razoavelmente, Lê Bem, Escreve Bem.

Seção coletada automaticamente pelo Escavador

Áreas de atuação

Grande área: Ciências Biológicas / Área: Imunologia.

Grande área: Ciências Biológicas / Área: Imunologia / Subárea: Imunologia Celular.

Grande área: Ciências Biológicas / Área: Imunologia / Subárea: Vacinologia.

Grande área: Ciências Biológicas / Área: Imunologia / Subárea: Medicina Veterinária.

Grande área: Ciências Biológicas / Área: Imunologia / Subárea: Biologia Molecular.

Seção coletada automaticamente pelo Escavador

Organização de eventos

Paiva-Cavalcanti, Milena . 8th International Veterinary Conference. 2014. (Congresso).

FONTES, C ; PAIVA CAVALCANTI, M ; Cruz, B. . Semana Nacional da Ciência e Tecnologia - CPqAM/FIOCRUZ. 2010. (Exposição).

FONTES, C ; PAIVA CAVALCANTI, M ; BRITO, M. E. F. . Semana Nacional da Ciência e Tecnologia - Participação da FIOCRUZ PE - Leishmanioses: conhecer para combater!. 2009. (Exposição).

Seção coletada automaticamente pelo Escavador

Participação em eventos

55 Congresso da Sociedade Brasileira de Medicina Tropical. qPCR para diagnóstico de LTA e identificação de espécies de Leishmania. 2019. (Congresso).

VII Semana de Biociências e Biotecnologia em Saúde. Ética na Pesquisa. 2019. (Congresso).

54 Congresso da Sociedade Brasileira de Medicina Tropical. 2018. (Congresso).

54 Congresso da Sociedade Brasileira de Medicina Tropical. Orientação de trabalhos em poster, apresentação oral e prêmiação. 2018. (Congresso).

6 th WorldLeish. Preliminary Evaluation of Cross-Reactivity between Commercially Available Anti-Human Monoclonal Antibodies and Mononuclear Cells /Cytokines from Dogs for Flow Cytometry Assays. 2017. (Congresso).

6 th WorldLeish. Cellular immune response analysis in dogs with visceral leishmaniasis in the presence of new recombinant antigens. 2017. (Congresso).

6 th WorldLeish. Quantitative Real time PCR technology for Leishmania species identification. 2017. (Congresso).

Worshop A, B, C, D, E do vírus Zika. 2016. (Simpósio).

23rd Congress of the International Union for Biochemistry and Molecular Biology 44th Annual Meeting of the Brazilian Society for Biochemistry and Molecular Biology. CHARACTERIZATION OF THE CELLULAR IMMUNE RESPONSE TO INFECTION BY LEISHMANIA (VIANNIA) BRAZILIENSIS IN THE PRESENCE OF GENETIC VARIANTS IN THE IL-17 GENE. 2015. (Congresso).

Simpósio de Medicina Veterinária do CESMAC.PCR: princípios e aplicações. 2014. (Simpósio).

Simpósio de Medicina Veterinária do CESMAC.Introdução ao desenvolvimento de vacinas. 2014. (Simpósio).

XVIII Congresso Brasileiro de Parasitologia Veterinária. Avaliação da aplicabilidade da técnica de PCR em tempo real para caracterização de espécies de Leishmania. 2014. (Congresso).

XVIII Congresso Brasileiro de Parasitologia Veterinária. Avaliação de diferentes alvos moleculares para caracterização de espécies de Leishmania por meio da Restriction Fragment Length Polymorphism (RFLP). 2014. (Congresso).

XVIII Congresso Brasileiro de Parasitologia Veterinária. 2014. (Congresso).

Fifth World Congress on leishmaniasis. Sample quality control system for leishmaniasis diagnosis in rodents by gliceraldehyde-3-phosphate dehydrogenase gene amplification. 2013. (Congresso).

Fifth World Congress on Leishmaniasis. Quantitative real time PCR assays for the detection of Leishmania (Viannia) braziliensis in animals and humans. 2013. (Congresso).

Fifth World Congress on Leishmaniasis. Clinical signs and laboratory abnormalities associated with Leishmania braziliensis infection in dogs from North-Eastern Brazil. 2013. (Congresso).

Fifth World Congress on Leishmaniasis. Leishmania (Viannia) braziliensis detection in animals and their ectoparasites by PCR and real time PCR. 2013. (Congresso).

Fifth World Congress on Leishmaniasis. 2013. (Congresso).

Fifth World Congress on Leishmaniasis. Use of a plasmid (PUC 18) as a DNA extraction control in a multiplex PCR assay for the diagnosis of American cutaneous leishmaniasis. 2013. (Congresso).

Fifth World Congress on Leishmaniasis. Detection of Leishmania (Viannia) spp in wild and synanthropic rodents captured in an endemic area of American cutaneous leishmaniasis in the zona da Mata of Pernambuco, Brazil. 2013. (Congresso).

XLVIII Congress of the Brazilian Society of Tropical Medicine. Development of a new Duplex Real Time PCR for Visceral Leishmaniasis diagnosis with sample quality control by TaqMan probe technology. 2012. (Congresso).

XVIII International Congress for Tropical Medicine and Malaria and XLVIII Congress of the Brazilian Society of Tropical Medicine. 2012. (Congresso).

XVIII International Congress for Tropical Medicine and Malaria a nd XLVIII Congress of the Brazilian Society of Tropical Medicine. Detection of Leishmania infantum by conventional and real time PCR in animals and their ectoparasites in Pernambuco, Brazil. 2012. (Congresso).

27 Reunião de Pesquisa Aplicada em Doença de Chagas e 15 Reunião de Pesquisa Aplicada em Leishmanioses. Detecção de Leishmania spp. em cães e gatos e seus ectoparasitos no Estado de Pernambuco.. 2011. (Congresso).

27 Reunião de Pesquisa Aplicada em Doença de Chagas e 15 Reunião de Pesquisa Aplicada em Leishmanioses. Avaliação de alvos moleculares para o diagnóstico da leishmaniose tegumentar americana por meio de PCR em tempo real.. 2011. (Congresso).

26 Reunião de Pesquisa Aplicada em Doença de Chagas e 14 Reunião de Pesquisa Aplicada em Leishmanioses. 2010. (Congresso).

Entomol 4 IV Worshop de genética e biologia molecular de insetos vetores de doenças tropicais. 2010. (Simpósio).

Worshop interno do Núcleo de Plataformas Tecnológicas da FIOCRUZ Pernambuco. 2010. (Simpósio).

XII Congresso Brasileiro de Biomedicina. Diagnóstico das Leishmanioses: alternativas moleculares para superar um desafio. 2010. (Congresso).

XLVI Congresso da Sociedade Brasileira de Medicina Tropical. Padronização de multiplex PCR para o diagnóstico da Leishmaniose Visceral. 2010. (Congresso).

International Symposium on Leishmaniasis vaccines. 2009. (Simpósio).

XLV Congresso da Sociedade Brasileira de Medicina Tropical. 22 Sessão de Temas Livres. 2009. (Congresso).

XLV Congresso da Sociedade Brasileira de Medicina Tropical. 2009. (Congresso).

XLV Congresso da Sociedade Brasileira de Medicina Tropical. Desenvolvimento de iniciadores para o diagnóstico da leishmaniose tegumentar americana por meio de PCR em tempo real. 2009. (Congresso).

XXI Congresso Brasileiro de Parasitologia e II Encontro de Parasitologia do Mercosul. Desenvolvimento e avaliação de um sistema baseado em PCR em tempo real para o diagnóstico da infecção por Leishmania (Leishmania) infantum em cães. 2009. (Congresso).

24 Reunião de pesquisa aplicada em Doença de Chagas e 12 Reunião de Pesquisa aplicada em leishmanioses.Caso autóctone de leishmaniose visceral na Região Metropolitana do Recife, PE, Brasil. 2008. (Encontro).

24 Reunião de Pesquisa Aplicada em Doença de Chagas e 12 Reunião de Pesquisa Aplicada em Leishmanioses.Desenvolvimento e avaliação de um sistema baseado em PCR em tempo real para o diagnóstico da infecção por Leishmania infantum. 2008. (Encontro).

24 Reunião de Pesquisa Aplicada em Doença de Chagas e 12 Reunião de Pesquisa Aplicada em Leishmanioses. 2008. (Encontro).

I Forum de Descentralização do Diagnóstico Laboratorial das Leishmanioses no Estado de Pernambuco/LACEN. 2008. (Encontro).

III Workshop de Genética e Biologia Molecular de Insetos vetores de Doenças Tropicais.PCR em tempo real. 2008. (Oficina).

III Workshop de Genética e Biologia Molecular de Insetos Vetores de Doenças Tropicais. 2008. (Oficina).

I Workshop de Inovação Tecnológica em Saúde da FIOCRUZ/PE. 2008. (Oficina).

I Workshop dos Serviços de Referência do CPqAM/FIOCRUZ. 2008. (Simpósio).

Semana Nacional da Ciência e Tecnologia - Caravana da Ciência.Leishmanioses. 2007. (Outra).

X Jornada Científica da Pós-Graduação. Desenvolvimento e avaliação de PCR em tempo real para o diagnóstico da infecção por L. chagasi. 2007. (Congresso).

XX Congresso Brasileiro de Parasitologia. PCR em tempo Real. 2007. (Congresso).

XX Congresso Brasileiro de Parasitologia. Epidemiologia das Doenças Parasitárias. 2007. (Congresso).

XX Congresso Brasileiro de Parasitologia. Biologia Molecular. 2007. (Congresso).

XX Congresso Brasileiro de Parasitologia. 2007. (Congresso).

XX Congresso Brasileiro de Parasitologia. Protozoologia. 2007. (Congresso).

XXIII Reunião aplicada em doenças de chagas e leishmanioses.Desenvolvimento e avaliação de PCR em tempo real par o diagnóstico da infecção por Leishmania infantum. 2007. (Encontro).

I Seminário de Propriedade Intelectual e Inovação Tecnológica do CPqAM. 2006. (Seminário).

I Congresso Nacional de Saúde Pública Veterinária. I Congresso Nacional de Saúde Pública Veterinária. 2005. (Congresso).

III SIMPOS.III Simpósio de Pesquisa e Pós - Graduação da UFRPE. 2002. (Simpósio).

I workshop alagoano sobre Leishmanioses.I Workshop alagoano sobre Leishmanioses. 2002. (Outra).

XI Congresso de Iniciação Científica da UFRPR. XI Congresso de Iniciação Científica da UFRPE. 2002. (Congresso).

Curso Charada dermatológica.Curso Charada Dermatológica. 2000. (Outra).

I Simpósio de disgnóstico por imagem em medicina veterinária.I Simpósio de diagnóstico por imagem em medicina veterinária. 2000. (Simpósio).

X CIC. X Congresso de iniciação científica da UFRPE. 2000. (Congresso).

Curso de Doenças de Felinos.Curso de Doenças de Felinos. 1999. (Outra).

Curso teórico de dermatologia de caninos e felinos.Curso Teórico de Dermatologia de Caninos e Felinos. 1999. (Outra).

IV Congresso Pernambucano de Medicina Veterinária. IV Congresso Pernambucano de medicina veterinária e V Seminário nordestino de caprino-ovinocultura. 1999. (Congresso).

IX CIC. IX COngresso de iniciação científica da UFRPE. 1999. (Congresso).

VII AGRINORDESTE.VII Aginordeste - Seminário sobre a modernização do setor primário da economia nordestina. 1999. (Seminário).

Workshop sobre doença de Chagas.Workshop sobre doença de Chagas. 1999. (Outra).

XXVI CONBRAVET. XXVI Congresso Brasileiro de Medicina Veterinária. 1999. (Congresso).

III Simpósio de atualização em medicina veterinária.III Simpósio de atualização em medicina veterinária. 1998. (Simpósio).

VI AGRINORDESTE.VI AGRINORDESTE - Seminário sobre a modernização do setor primário da economia nordestina. 1998. (Seminário).

VIII CIC. VIII Congresso de iniciação científica da UFRPE. 1998. (Congresso).

Seção coletada automaticamente pelo Escavador

Participação em bancas

Aluno: Cíntia Nascimento da Costa Oliveira

Lorena, V. M. B.; VASCONCELOS, L. R. S.; COSTA, T. B.; PAIVA CAVALCANTI, M.. APLICAÇÃO DO DIAGNÓSTICO MOLECULAR PARA CARACTERIZAÇÃO DOS PACIENTES ENVOLVIDOS NO SURTO DE DOENÇA DE CHAGAS EM PERNAMBUCO. 2020. Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Eiji Kevin Nakasone Nakasone

ALVES, L. C.; SILVA JUNIOR, V. A.; OLIVEIRA, V. V. G.; PAIVA CAVALCANTI, M.. ALIAÇÃO DO USO DO Tiazoacetilpirimida 04 NO TRATAMENTO DE CÃES COM INFECÇÃO NATURAL POR Leishmania infantum. 2020. Dissertação (Mestrado em Biociência Animal) - Universidade Federal Rural de Pernambuco.

Aluno: Marianny Fernanda Teixeira Pacheco

PAIVA CAVALCANTI, M; GUIMARAES, R. L.; PITA, W. B.; ARAUJO, A. R. L.. Pesquisa de variantes genéticas no gene TP53 e avaliação do seu impacto prognóstico na leucemia mielóide aguda. 2019. Dissertação (Mestrado em Genética) - Universidade Federal de Pernambuco.

Aluno: Laís Andrielly Baracho da Costa

NAPOLEAO, T. H.;Paiva-Cavalcanti, Milena de; LUCENA, N.. Avaliação da atividade anti-tumoral de moléculas de quinona-metide em cultura de linhagens de células hematológicas malignas. 2019. Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Tayná Correia de Goes

BEZERRA, M. A. C.; WALLAU, G. L.; PAIVA CAVALCANTI, M.. Análise e aplicabilidade da região IGS rRNA de Leishmania spp. para identificação de espécies que causam a leishmaniose tegumentar americana.. 2019. Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Michelle da Silva Barros

Costa, V M A;Paiva-Cavalcanti, Milena; Clarice Lins. Avaliação das quimiocinas CCL2/MCP-1, CCL5/RANTES, CXCL8/IL-8, CXCL9/MIG e CXCL10/IP-10 em soro de pacientes com as formas clínicas cardíaca e indeterminada da doença de Chagas.. 2018. Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Carlos Alberto Neves de Andrade

VIDAL, C. F. L.;Paiva-Cavalcanti, Milena; Leal, N C. Perfil de sensibilidade e caracterização molecular de isolados clínicos de Staphylococcus spp. associados a infecções relacionadas à assistência à saúde em hospital terciário do Recife-PE. 2018. Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Guilhermy Victor Sousa de Araújo

Paiva-Cavalcanti, Milena; PITA, W. B.; GUIMARAES, R. L.. Significado clínico do número relativo de cópias de DNA mitocondrial (mtDNA) em neoplasias hematológicas de origem mielóide. 2018. Dissertação (Mestrado em Genética) - Universidade Federal de Pernambuco.

Aluno: Igor Vasconcelos Rocha

MORAIS, M. M. C.;de Paiva Cavalcanti, Milena; Leal, N C. Identificação de mecanismos de resistência antimicrobiana de bactérias Gram negativas prevalentes em superfícies e hemoculturas de unidades de terapia intensiva em Caruaru-PE. 2017. Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Mayara Souza Barbalho

MELO NETO, O. P.; FREIRE, E. R.;Paiva-Cavalcanti, Milena de. Perfil de imunogenicidade da proteína GP63 codificada por múltiplos parálogos em Leishmania braziliensis. 2017. Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Lays Adrianne Mendonça Trajano Silva

PAIVA CAVALCANTI, M.; Accioly, M. C.; XAVIER, D. E.. Caracterização da resposta imune celular em cães frente a novos antígenos de Leishmania infantum. 2017. Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Walter Lins Barbosa

Paiva-Cavalcanti, Milena; LIMA JUNIOR, M. S. C.; Medeiros, Z. M.. Análise das regiões polimórficas do gene HASPB (k26) de Leishmania infantum em amostras clínicas positivas para leishmaniose visceral e coinfecção LV/HIV. 2016. Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Nathaly Alexandre do Nascimento

PAIVA, PMG;Paiva-Cavalcanti, Milena; SILVA FILHA, M. H. N. L.. Avalia de alfa-glicosidases de Culex quinquefasciatus e impacto de mutações na alfa-glicosidase Cqm1 na fisiologia dos insetos. 2016. Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Rômulo Pessoa e Silva

PEREIRA, V. R. A.; MONTENEGRO, R A; PAIVA CAVALCANTI, M.. Estratégias para o aprimoramento do diagnóstico molecular na leishmaniose visceral. 2015. Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Wagner José Tenório dos Santos

ISEPPON, A. M. B.; PAIVA CAVALCANTI, M.; XAVIER, D. E.. Otimização das condições para superexpressão em Escherichia coli de proteínas quiméricas com potencial para o diagnóstico da leishmaniose visceral. 2015. Dissertação (Mestrado em Genética) - Universidade Federal de Pernambuco.

Aluno: Rayana Carla Silva de Morais

MENDES-MARQUES, C. L.; BRAYNER, F.; PAIVA CAVALCANTI, M.. Aplicabilidade da técnica de PCR em tempo real para caracterização de espécies de Leishmania. 2015. Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Renata Lins Carneiro Leão

OLIVEIRA, S. A.; Regina Bressan; Melo, F. L.;Paiva-Cavalcanti, Milena. Avaliação do papel da galectina-3 na patogênese da hepatopatia crônica experimental. 2015. Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Jacilene Lourenço da Silva

PAIVA CAVALCANTI, M.; RAMOS, R. A. N.; MAIA, F. C. L.; SILVA JUNIOR, V. A.;ALVES, L. C.. Avaliação dos Parâmetros bioquímicos, alterações estruturais, imunomarcação e carga parasitária em órgãos do sistema urinário de cães com infecção natural por Leishmania (Leishmania) infantum (Nicolle, 1908).. 2015. Dissertação (Mestrado em Ciência Animal Tropical) - Universidade Federal Rural de Pernambuco.

Aluno: Keicyanne Fernanda Lessa dos Anjos

CORREIA, MTS;Paiva-Cavalcanti, Milena; Regina Bressan. Avaliação do Biocompatibilidade e da propriedade bactericida de nanotubos de dióxido de titânio impregnados com lectina e nanopartículas de prata para aplicações biomédicas. 2015. Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Juliana Bezerra Medeiros Viana

LIMA JUNIOR, M. S. C.;Paiva-Cavalcanti, Milena deRodrigues, E.H.G.. Análise de assinaturas de minicírculos de kDNA de Leishmania spp. presentes em amostras clínicas de pacientes com leishmaniose tegumentar Americana de áreas endêmicas de Pernambuco. 2015. Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Suênia da Cunha Gonçalves

Paiva-Cavalcanti, Milena; PEREIRA, V. R. A.; Melo, F. L.; MONTENEGRO, L. M. L.; Clarice Lins. Desenvolvimento de ferramentas moleculares baseadas e PCR multiplex para inclusão de controles de qualidade amostral no diagnóstico das leishmanioses. 2014. Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Renan Garcia gomes

GARCIA, P. S.; Clarice Lins; LUCENA, N.; COELHO, M. R. C. D.; PAIVA CAVALCANTI, M.. Estudo da variabilidade genética da região 3' não traduzida do gene HLA-G e expressão da molécula HLA-G na lesão de mucosa na doença inflamatória intestinal. 2014. Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Anna Lígia de Castro Figueiredo

MONTENEGRO, L. M. L.; PEREIRA, V. R. A.; Clarice Lins; Accioly, M. C.;Paiva-Cavalcanti, Milena. Avaliação da participação do receptor antagonista de IL-13 (IL13Ralfa2) na relação com os graus de fibrose hepática na esquistossomose mansônica. 2014. Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Camylla Carvalho de Melo

MACIEL, M A V;Paiva-Cavalcanti, Milena; Leal, N C. Aspectos fenotípicos e moleculares de isolados de Acinetobacter baumanni relacionados à infecção nosocomial. 2014. Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Elisama Helvecio

PAIVA, PMG; ALVES, L C; SANTOS, MAVM; Melo, TPRP;Paiva-Cavalcanti, Milena. Caracterização funcional do gene da glutationa-S-transferase epsilon 2 (GSTE2) em Aedes aegypt. 2014. Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Aline Caroline da Silva

PEREIRA, V. R. A.; PITTA, M. G. R.; Accioly, M. C.; HERNANDES, M. Z.;PAIVA CAVALCANTI, M. Análise in vitro do potencial imunomodulador e leishmanicida de derivados de tiossemicarbazona r ftalimida. 2013. Dissertação (Mestrado em Inovação Terapêutica) - Universidade Federal de Pernambuco.

Aluno: THAYS MIRANDA DE ALMEIDA

PEREIRA, V. R. A.; PAIVA CAVALCANTI, M.; PITTA, M. G. R.. Perfil da expressão gênica de mediadores da resposta imune celular de pacientes com Leishmaniose Tegumentar ativa. 2013. Dissertação (Mestrado em Inovação Terapêutica) - Universidade Federal de Pernambuco.

Aluno: José Luiz de Oliveira Magalhães

Silva, M S B; PAIVA CAVALCANTI, M.; FONTES, C. Sistema de Gestão da Qualidade e Biossegurança no Laboratório de Biossegurança Nível 3 da FIOCRUZ/PE: elaboração de proposta de implantação. 2013. Dissertação (Mestrado em Mestrado Profissional) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Amanda Silva dos Santos Aliança

SARAIVA, K L A;Paiva-Cavalcanti, Milena; Regina Bressan. Estudo da atividade biológica de produtos naturais de macroalgas do litoral nordestino sobre Leishmania amazonensis. 2012. Dissertação (Mestrado em Mestrado Acadêmico) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Laís Ariane de Siqueira Lira

Lorena, V. M. B.PAIVA CAVALCANTI, M; Schlindler, H. C.. Análise do desempenho da técnica de PCR em tempo real para o diagnóstico da tuberculose pulmonar. 2012. Dissertação (Mestrado em Mestrado Acadêmico) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Fabiana Cristina Fulco Santos

Lorena, V. M. B.PAIVA CAVALCANTI, M; Schlindler, H. C.. Avaliação do desempenho da técnica de PCR em tempo real em diferentes amostras biológicas utilizadas para o diagnóstico da tuberculose extrapulmonar. 2012. Dissertação (Mestrado em Mestrado Acadêmico) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Érika de Cássia Vieira da Costa

PAIVA CAVALCANTI, M.; Paiva, A.. Estudo da soroprevalência de hantavírus e Yersinia pestis em áreas focais de peste no Nordeste do Brasil. 2011. Dissertação (Mestrado em Pós -Graduação em Ciências Biológicas) - Universidade Federal de Pernambuco.

Aluno: Elaine Cristina Bomfim de Lima

ALVES, L. C.; PAIVA CAVALCANTI, M.; Medeiros, Z. M.. Qualificação: Concordância da cultura em relação ao exame direto e a reação em cadeia da polimerase em aspirado de medula óssea no diagnóstico de leishmaniose visceral. 2011. Dissertação (Mestrado em Mestrado Acadêmico) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Fabiana Cristina Fulco Santos

Lorena, V. M. B.PAIVA CAVALCANTI, M; Schlindler, H. C.. Qualificação - Avaliação do método molecular baseado na técnica de PCR em tempo real para o diagnóstico da tuberculose extrapulmonar. 2011. Dissertação (Mestrado em Mestrado Acadêmico) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Leandro Batista Wanderley

Muniz;PAIVA CAVALCANTI, M; Melo, F. L.. Avaliação da especificidade dos primers RV1 e RV2 para o diagnóstico molecular da leishmaniose visceral. 2011. Dissertação (Mestrado em Mestrado Acadêmico) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Pietra Lemos Costa

Andrade, M. S.; PAIVA CAVALCANTI, M.;Brandão-Filho, S.. Comportamento da fauna de flebotomíneos, com ênfase em Lu. longipalpis em área endêmica para leishmaniose visceral, Passira-Agreste de Pernambuco. 2011. Dissertação (Mestrado em Mestrado Acadêmico) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Vanessa Cristina Fitipaldi Veloso Guimarães

Ximenes, M F F M; Melo, F. L.;Brandão-Filho, S.ALVES, L. C.PAIVA CAVALCANTI, M. Avaliação da infecção natural de flebotomíneos (Díptera: Psychodidae) no município de São Vicente Ferrer, Pernambuco. 2011. Dissertação (Mestrado em Mestrado Acadêmico) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Laís Ariane de Siqueira Lira

Lorena, V. M. B.; PAIVA CAVALCANTI, M.; Schlindler, H. C.. Qualificação- Análise do desempenho da técnica de PCR em tempo real na detecção específica e quantificação absoluta do Mycobacterium tuberculosis para o diagnóstico da TB pulmonar. 2011. Dissertação (Mestrado em Mestrado Acadêmico) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Andrea Santos Lima

Ximenes, E. C.;PAIVA CAVALCANTI, M; Schlindler, H. C.. Detecção rápida e diferenciação de espécies de micobactérias através de um sistema de PCR multiplex. 2010. Dissertação (Mestrado em Mestrado Acadêmico) - Centro de Pesquisas Aggeu Magalhães.

Aluno: José ferreira Marinho Júnior

ALVES, L. C.; Medeiros, Z. M.;PAIVA CAVALCANTI, MBrandão-Filho, S.. Identificação de hospedeiros reservatórios e espécies de Leishmania envolvidos na transmissão e manutenção da leishmaniose tegumentar americana em área endêmica da Zona da Mata Norte de Pernambuco. 2010. Dissertação (Mestrado em Mestrado Acadêmico) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Eduardo de Oliveira Rosas

PAIVA CAVALCANTI, M; BRITO, F. L. C.;ALVES, L. C.. Avaliação das alterações eletrocardiográficas e detecção de troponina I cardíaca em cães soropositivos para leishmaniose visceral. 2009. Dissertação (Mestrado em Ciência Veterinária) - Universidade Federal Rural de Pernambuco.

Aluno: Rômulo Pessoa e Silva

PAIVA CAVALCANTI, M.; VASCONCELOS, L. R. S.; Clarice Lins; VIANA, I.; Accioly, M. C.;Lorena, V. M. B.. AVALIAÇÃO DO POTENCIAL IMUNOPROFILÁTICO E IMUNOTERÁPICO DE NOVOS ANTÍGENOS RECOMBINANTES DE Leishmania infantum: UMA ABORDAGEM EM LEISHMANIOSE VISCERAL CANINA. 2020. Tese (Doutorado em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Elis Dionísio da Silva

PITTA, M. G. R.; Accioly, M. C.; VASCONCELOS, L. R. S.; Montenegro, S.; PEREIRA, V. R. A.;PAIVA CAVALCANTI, M. Aplicação da citometria de fluxo no diagnóstico da leishmaniose visceral humana.. 2019. Tese (Doutorado em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Heytor Victor Pereira da Costa Neco

SOUZA, J. R.; VIANA, I.;de Paiva Cavalcanti, Milena; OLIVEIRA, S. A.; Clarice Lins. Análise da participação das células Th17 e Th22 na infecção pelo vírus linfotrópico da célula T humana. 2019. Tese (Doutorado em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Rayana Carla Silva de Morais

Paiva-Cavalcanti, Milena; GUEDES, D; ARAUJO, P. S. R.; PEREIRA, V. R. A.; Medeiros, Z. M.. Ensaios de multiplex PCR em tempo real (Taq Man probe) para identificação de espécies de Leishmania relacionadas com a etiologia da leishmaniose tegumentar americana. 2019. Tese (Doutorado em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Leila Rodrigues de Mendonça Vieira

GOMES, D. A.; PELICIARI-GARCIA, R. A.; GIL, L. H. V. G.; PAIVA CAVALCANTI, M.; FRANCA, R. F. O.. Vias apoptóticas induzidas pela infecção por vírus zika em linhagem de células neuronais. 2019. Tese (Doutorado em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Artur Leonel de Castro Neto

CALSA JUNIOR, T.; MELO NETO, O. P.;Paiva-Cavalcanti, Milena; PAIVA, M. H. S.; LIMA JUNIOR, M. S. C.. Avaliação e caracterização de proteínas antigênicas e de superfície de Leishmania sp. e seu papel no diagnóstico e patogênese das leishmanioses.. 2018. Tese (Doutorado em Genética) - Universidade Federal de Pernambuco.

Aluno: Laíse Aline Martins dos Santos

PEIXOTO, C. A.; PEREIRA, V. R. A.; OLIVEIRA, S. A.; SILVA, T. G.; TEIXEIRA, K. P. S. B.;Paiva-Cavalcanti, Milena. Avaliação do potencial terapêutico da série de novos derivados tiazolidínicos em modelos de lesão pulmonar aguda. 2018. Tese (Doutorado em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Suenia da Cunha Gonçalves de Albuquerque

Paiva-Cavalcanti, Milena de; MELO, C. M. L.; Costa, V M A; SILVA FILHA, M. H. N. L.; VASCONCELOS, L. R. S.. Avaliação da associação entre o SNP-IL17A-197G/A (rs2275913) e susceptibilidade à leishmaniose tegumentar Americana, e sua influência sobre a resposta imune celular.. 2018. Tese (Doutorado em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Renan Garcia gomes

DONADI, E. A.; Costa, V M A; VASCONCELOS, L. R. S.; PAIVA CAVALCANTI, M.; LUCENA, N.. Polimorfismo genético, expressão de mRNA na mucosa intestinal e níveis circulantes da molécula HLA-G e citocinas IL-10, TNF, e IFN-y em pacientes com doença de Crohn e retocolite ulcerativa. 2018. Tese (Doutorado em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Fabiana Cristina Fulco Santos

LIMA, A. S.;Paiva-Cavalcanti, Milena; Montenegro, S.; Medeiros, Z. M.; Schlindler, H. C.. Avaliação do desempenho do teste Quantiferon TB Gold para o diagnóstico da tuberculose latente em pacientes imunodeprimidos do estado de Pernambuco. 2018. Tese (Doutorado em Doutorado em Saúde Pública) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Diego Arruda Falcão

SANTOS, N.;PAIVA CAVALCANTI, M; ARAUJO, A. S.; VASCONCELOS, L. R. S.; BEZERRA, M. A. C.. Marcadores moleculares e sua relevância nas manifestações clínicas de pacientes com anemia falciforme. 2018. Tese (Doutorado em Genética) - Universidade Federal de Pernambuco.

Aluno: Larissa Isabela Oliveira de Souza

SILVA, L. C. N.; NAPOLEAO, T. H.;Paiva-Cavalcanti, Milena; MOURA, D. M. N.; Regina Bressan. Avaliação in vitro do potencial tripanocida, citotóxico e imunomodulador de óleos essenciais de plantas da Caatinga. 2017. Tese (Doutorado em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Renata dos Santos Almeida

SALLES, T. J. M.; FREITAS, J. C. O. C.;Paiva-Cavalcanti, Milena de; PENA, L. J.; LUCENA, N.. Avaliação do papel de moléculas imunológicas solúveis, polimorfismos genéticos e microRNAs em leucemia linfoblástica aguda de células T da infância. 2017. Tese (Doutorado em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Diego de Hollanda Cavalcanti Tavares

PITTA, M. G. R.; BEZERRA, M. B. C. F.; Montenegro, S.; XAVIER, D. E.; PEREIRA, V. R. A.; HERNANDES, M. Z.;Paiva-Cavalcanti, Milena. Avaliação da citometria de fluxo no diagnóstico das leishmanioses utilizando antígenos recombinantes. 2017. Tese (Doutorado em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Bruna Santos Lima Figueiredo de Sá

SHAW, J. J.; HERNANDES, M. Z.;Paiva-Cavalcanti, Milena; WALLAU, G. L.;Brandão Filho, Sinval Pinto. Estudo da diversidade genética de cepas de Leishmania (Viannia) braziliensis isoladas em regiões endêmicas no estado de Pernambuco, Nordeste do Brasil. 2017. Tese (Doutorado em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Taciana Mirely Maciel Higino

Accioly, M. C.; SILVA JUNIOR, V. A.; PAIVA CAVALCANTI, M.; PEREIRA, V. R. A.; Regina Bressan. Avaliação in vitro e in vivo dos efeitos do composto P-MAPA isolado de Aspergillus oryzae sobre Trypanosoma cruzi. 2017. Tese (Doutorado em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Eloína Maria de Mendonça Santos

Melo, TPRP; VASCONCELOS FILHO, S. D.;de Paiva Cavalcanti, Milena; Medeiros, Z. M.; FONTES, C. Avaliação de um biolarvicida à base de Lysinibacillus sphaericus (Lsp) e Bacillus thuringiensis israelensis (Bti) para controle de Culex quinquefasciatus e Aedes aegypti.. 2017. Tese (Doutorado em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Lívia Christina Alves da Silva

XAVIER, D. E.; PAIVA CAVALCANTI, M.; BARROS, M P S; MELO NETO, O. P.; BALBINO, T C L. Caracterização molecular de isolados clínicos e ambientais de Aeromonas spp. obtidos no estado de Pernambuco. 2015. Tese (Doutorado em Genética) - Universidade Federal de Pernambuco.

Aluno: Ana Paula Sampaio Feitosa

Rocha, H; PAIVA CAVALCANTI, M.; AGUIAR, A; WANDERLEY, V.; LOPES, A C S. Resposta imune celular e humoral de Rhipicephalus sanguineus (Latreille, 1806) (Acari: Ixodidae) desafiados com Leishmania infantum (Nicolle, 1908). 2015. Tese (Doutorado em Medicina Tropical) - Universidade Federal de Pernambuco.

Aluno: Marina de Assis Souza

PEREIRA, V. R. A.;Paiva-Cavalcanti, Milena; Montenegro, S.; FERRAZ, C.; PITTA, M. G. R.. Quantificação de mediadores dos perfis Th1, Th2, Th17 e Treg na resposta imune contra leishmaniose tegumentar Americana ativa e após cura clínica. 2014. Tese (Doutorado em Inovação Terapêutica) - Universidade Federal de Pernambuco.

Aluno: Tereza Emmanuelle de Farias Rotondano

ALMEIDA, Alzira Paiva de; Silva, M S B;Lorena, V. M. B.; PAIVA CAVALCANTI, M.. Doenças transmitidas por carrapatos em cães nas mesorregiões do sertão e agreste do estado da Paraíba. 2014. Tese (Doutorado em Ciências Biológicas) - Universidade Federal de Pernambuco.

Aluno: Juliana Maria Azevedo Lyra

ANDRADE, C.; PAIVA CAVALCANTI, M.; PITTA, M. G. R.; LUCENA, N.. Avaliação de ferramentas moleculares para detecção de fungos patogênicos relevantes para a saúde humana.. 2014. Tese (Doutorado em Inovação Terapêutica) - Universidade Federal de Pernambuco.

Aluno: EDENEIDE MARIA XAVIER

Balbino, V. Q.; PAIVA CAVALCANTI, M.;Rodrigues, E.H.G.; PEREIRA, V. R. A.; SANTOS, N.. Avaliação de uma nova abordagem diagnóstica baseada em um nanocompósito para a leishmaniose visceral. 2014. Tese (Doutorado em Genética) - Universidade Federal de Pernambuco.

Aluno: Maria Carolina Accioly Brelaz de Castro

PEREIRA, V. R. A.; Montenegro, S.;Paiva-Cavalcanti, Milena. Estudo do papel de células T na leishmaniose tegumentar americana. 2013. Tese (Doutorado em Inovação Terapêutica) - Universidade Federal de Pernambuco.

Aluno: Maria Almerice Lopes da Silva

ALVES, L. C.; Montenegro, S.;PAIVA CAVALCANTI, M; Medeiros, Z. M.. Desenvolvimento de sistemas baseados em NESTED-PCR convencional e em único tubo para o diagnóstico da leishmaniose visceral humana. 2012. Tese (Doutorado em Doutorado em Saúde Pública) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Yone Vila Nova Cavalcanti

Paiva-Cavalcanti, Milena; Costa, V M A; PEREIRA, V. R. A.. Avaliação do perfil de produção e expressão de mediadores da resposta imune celular em comunicantes e indivíduos com história de tuberculose pulmonar. 2012. Tese (Doutorado em Inovação Terapêutica) - Universidade Federal de Pernambuco.

Aluno: Carina Lucena Mendes

Silva, M S B; Tenório, M;PAIVA CAVALCANTI, M; Paiva, A.; Leal, N C. Caracterização molecular de cepas de Aeromonas spp isoladas durante um surto de diarréia em São Bento do Una, PE, em 2004. 2011. Tese (Doutorado em Doutorado em Saúde Pública) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Rosana de Albuquerque Montenegro

PAIVA CAVALCANTI, MLorena, V. M. B.; Moitinho, C.; ARAUJO, P. S. R.; Schlindler, H. C.. Avaliação do RNA mensageiro (RNAm) do Mycobacterium tuberculosis como marcador de cura em pacientes com tuberculose pulmonar. 2011. Tese (Doutorado em Doutorado em Saúde Pública) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Maria Sandra Andrade

PEREIRA, V. R. A.;PAIVA CAVALCANTI, M; S. Jefrey; Balbino, V. Q.;Brandão-Filho, S.. Avaliação da Infecciosidade Experimental de Pequenos Roedores Silvestres e Sinantrópicos como hospedeiros reservatórios de Leishmania (Viannia) braziliensis. 2010. Tese (Doutorado em Doutorado em Saúde Pública) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Silvia Maria Santos Carvalho

Medeiros, A. C. R.; Miranda, JC; Medeiros, Z. M.; Rodrigues, E. H.; PAIVA CAVALCANTI, M.;Brandão-Filho, S.. Caracterização da leishmaniose tegumentar americana e flebotomíneos envolvidos na transmissão, no município de Ilhéos, Zona da Mata do estado da Bahia. 2010. Tese (Doutorado em Doutorado em Saúde Pública) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Leila Inês de Aguiar Raposo da Câmara Coelho

Brandão-Filho, S.PAIVA CAVALCANTI, M; BALBINO, W.; RAPELA, A.. Caracterização de Leishmania spp em amostras isoladas de pacientes portadores de leishmaniose tegumentar americana de área endêmica da Região NOrte. 2010. Tese (Doutorado em Doutorado em Saúde Pública) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Karla Patrícia de Oliveira Luna

SILVA, M. B.; Moitinho, C.; Clarice Lins;PAIVA CAVALCANTI, M; PEREIRA, V. R. A.. Avaliação da Resposta Imune em indivíduos picados pela serpente Bothrops erythromelas antes e após o tratamento soroterápico. 2010. Tese (Doutorado em Doutorado em Saúde Pública) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Filipe Dantas-Torres

Brandão-Filho, S.; BALBINO, W.;FAUSTINO, M. A. G.; Barbosa, C S;PAIVA CAVALCANTI, M. Rhipicephalus sanguineus e a epidemiologia da leishmaniose visceral no estado de Pernambuco. 2009. Tese (Doutorado em Saúde Pública) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Laíse Aline Martins dos Santos

PEIXOTO, C. A.; PEREIRA, V. R. A.; OLIVEIRA, S. A.; SILVA, T. G.; TEIXEIRA, K. P. S. B.;Paiva-Cavalcanti, Milena. Avaliação do potencial terapêutico da série de novos derivados tiazolidínicos em modelo de lesão pulmonar aguda. 2008. Tese (Doutorado em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: DIEGO LINS GUEDES

LIMA JUNIOR, M. S. C.; PAIVA CAVALCANTI, M.; Medeiros, Z. M.. Avaliação de biomarcadores como preditores de cura, latência, reativação e mortalidade em leishmaniose visceral em pessoas co-infectadas com HIV no estado de Pernambuco. 2019. Exame de qualificação (Doutorando em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Elisama Helvecio

NAPOLEAO, T. H.; WALLAU, G. L.; AYRES, C.; PAIVA CAVALCANTI, M.; ROHDE, C.. Caracterização do Cluster de Glutationa - S-Transferases da classe EPSILON de Aedes Aegypti e o seu papel na resistência aos inseticidas químicos. 2018. Exame de qualificação (Doutorando em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Diego Arruda Falcão

Paiva-Cavalcanti, Milena; VASCONCELOS, L. R. S.; SILVA, J. A.. A via do TGFbeta e sua importância no desenvolvimento de úlceras dos membros inferiores em pacientes com anemia falciforme. 2018. Exame de qualificação (Doutorando em Genética) - Universidade Federal de Pernambuco.

Aluno: Walter Lins Barbosa Júnior

BRESANI, C. C.;Paiva-Cavalcanti, Milena; Medeiros, Z. M.. Estudo de fatores genéticos e epigenéticos envolvidos na susceptibilidade a leishmaniose visceral em pacientes co-infectados com HIV. 2018. Exame de qualificação (Doutorando em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Rômulo Pessoa e Silva

PAIVA CAVALCANTI, M.;ALVES, L. C.; Clarice Lins. Avaliação do perfil de resposta imune celular in vitro de cães frente a novos antígenos de Leishmania spp. 2018. Exame de qualificação (Doutorando em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Keycianne Fernanda Lessa dos Anjos

MACHADO, G.; XAVIER, D. E.; MELO, J. V.; PAIVA CAVALCANTI, M.. Biofuncionalização da superfície do titânio (cp) para aplicações biomédicas. 2018. Exame de qualificação (Doutorando em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Tatiane Alexandre de Araújo

BONFIM, C. V.;Paiva-Cavalcanti, Milena; FONTES, C; PAIVA, M. H. S.. Pesquisa de avaliação da transmissão de Wuchereria bancrofti por xenomonitoramento molecular em áreas com filariose linfática no Brasil. 2018. Exame de qualificação (Doutorando em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Rayana Carla Silva de Morais

Paiva-Cavalcanti, Milena; REZENDE, A. M.; SANTOS, B. A.. Ensaios de multiplex PCR em tempo real (TaqMan probe) para identificação de espécies de Leishmania relacionada com a etiologia da leishmaniose tegumentar Americana. 2017. Exame de qualificação (Doutorando em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Artur Leonel de Castro Neto

Paiva-Cavalcanti, Milena; WALLAU, G. L.; ARAUJO, A. R. L.. Estudo de múltiplos parálogos de GP63 de Leishmania braziliensis e seu papel na relação parasito-hospedeiro. 2017. Exame de qualificação (Doutorando em Genética) - Universidade Federal de Pernambuco.

Aluno: Fabiana Cristina Fulco Santos

PAIVA CAVALCANTI, M.; MENDES, A. C. G.; Schlindler, H. C.. Avaliação do desempenho do teste Quantiferon-TB Gold para o diagnóstico da tuberculose latente em pacientes imunodeprimidos do estado de Pernambuco. 2016. Exame de qualificação (Doutorando em Doutorado em Saúde Pública) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Suenia da Cunha Gonçalves de Albuquerque

PAIVA CAVALCANTI, M; SILVA FILHA, M. H. N. L.; SOUZA, J. R.. Caracterização da imunidade celular à infecção por Leishmania (Viannia) braziliensis na presença de SNP na região promotora do gene da IL-17A. 2016. Exame de qualificação (Doutorando em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Anna Lígia de Castro Figueredo

Paiva-Cavalcanti, Milena de; MOURA, L. C. R. V.; SILVA, M. A. L.. Estudo da resposta imune humoral e celular para avaliação de critério de cura pós-terapêutica em pacientes infectados com esquistossomose mansônica. 2016. Exame de qualificação (Doutorando em Medicina Tropical) - Universidade Federal de Pernambuco.

Aluno: Klaudia Emanuela Ramos Tenorio

Paiva-Cavalcanti, Milena; ARAUJO, P. S. R.; BEZERRA, M. A. C.. Influência dos polimorfismos genéticos no desenvolvimento de coinfecções em indivíduos HIV positivos. 2016. Exame de qualificação (Doutorando em Genética) - Universidade Federal de Pernambuco.

Aluno: Bruna Santos Lima

BRANDÃO-FILHO, S. P.Paiva-Cavalcanti, MilenaRodrigues, E.H.G.. Estudo da diversidade genética de cepas de Leishmania (Viannia) braziliensis isoladas em regiões endêmicas no estado de Pernambuco, NE do Brasil. 2015. Exame de qualificação (Doutorando em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Maria Carolina Acciolly Brelaz de Castro

PEREIRA, V. R. A.; Montenegro, S.;Paiva-Cavalcanti, Milena. Estudo do papel de celulas T na leishmaniose tegumentar Americana. 2013. Exame de qualificação (Doutorando em Inovação Terapêutica) - Universidade Federal de Pernambuco.

Aluno: Juliana Lyra

LUCENA, N.; BRAGA, C.; PAIVA CAVALCANTI, M.. Desenvolvimento de teste molecular para detecção de fungos de importância médica. 2013. Exame de qualificação (Doutorando em Inovação Terapêutica) - Universidade Federal de Pernambuco.

Aluno: Leandro Batista Wanderley

Caldeira, RL; PAIVA CAVALCANTI, M.; BRAGA, MC. Validação da técnica de NESTED-PCR em único tubo e desenvolvimento de um kit para o diagnóstico de esquistossomose em caramujos (Biomphalaria glabrata) e amostras biológicas humanas.. 2013. Exame de qualificação (Doutorando em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Ana Paula Sampaio Feitos

Costa, V M A;ALVES, L. C.; PAIVA CAVALCANTI, M.. Avaliação da relação da Leishmania chagasi (Cunha e Chagas, 1937) com Rhipicephalus sanguineus (Letreille, 1806) (Acari: Ixodidae) em condições laboratoriais. 2012. Exame de qualificação (Doutorando em Programa de Pós-Graduação em Medicina Tropical) - Universidade Federal de Pernambuco.

Aluno: Daniele Silva de Moraes Van-Lume

Lorena, V. M. B.PAIVA CAVALCANTI, M; Montenegro, S.. Avaliação das células T regulatórias na hepatite C, na esquistossomose e na co-infecção. 2011. Exame de qualificação (Doutorando em Doutorado em Saúde Pública) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Rosana de Albuquerque Montenegro

PAIVA CAVALCANTI, M; Tenório, M; Schlindler, H. C.. Avaliação do RNA mensageiro (RNAm) de Mycobacterium tuberculosis como marcador de cura de pacientes com tuberculose pulmonar. 2010. Exame de qualificação (Doutorando em Doutorado em Saúde Pública) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Maria Almerice Lopes da Silva

Medeiros, Z. M.; Muniz; Montenegro, S.;Paiva-Cavalcanti, Milena; Ferraz. Desenvolvimento de sistemas baseados em Nested-PCR para identificação de espécie parasitária e para o diagnóstico de leishmaniose visceral em sangue e urina, utilizando como alvo o espaçador interno transcrito-1 (ITS-1) do DNAr. 2010. Exame de qualificação (Doutorando em Doutorado em Saúde Pública) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Filipe Dantas Torres

BALBINO, W.; Figueiredo, R.;PAIVA CAVALCANTI, M; Medeiros, Z. M.. Avaliação do papel do Rhipicephalus sanguineus na transmissão de Leishmania infantum sensu latu. 2008. Exame de qualificação (Doutorando em Doutorado em Saúde Pública) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Igor Vasconcelos Rocha

CAMPANA, E. H.; PAIVA CAVALCANTI, M.; Leal, N C; XAVIER, D. E.. Estudo de variantes de beta-lactamases ADC de isolados clínicos de Acinetobacter spp. na resistência aos Beta-lactâmicos. 2019. Exame de qualificação (Mestrando em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Cíntia Nascimento da Costa Oliveira

VASCONCELOS, L. R. S.; ALVES, S. M. M.;Lorena, V. M. B.; PAIVA CAVALCANTI, M.. Desenvolvimento de um diagnóstico molecular para a doença de Chagas.. 2019. Exame de qualificação (Mestrando em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Eiji Kevin Nakasone Nakasone

ALVES, L. C.; PAIVA CAVALCANTI, M.; SILVA JUNIOR, V. A.. AVALIAÇÃO DO USO DO TIAZOACETILPIRIMIDA 04 (TAP ? 04) NO TRATAMENTO EXPERIMENTAL DE CÃES COM INFECÇÃO NATURAL POR Leishmania infantum. 2019. Exame de qualificação (Mestrando em Biociência Animal) - Universidade Federal Rural de Pernambuco.

Aluno: Tayná Correia de Goes

Paiva-Cavalcanti, Milena; BEZERRA, M. A. C.; WALLAU, G. L.. Análise in silico e aplicabilidade em qPCR multiplex (TaqMan probe) da região IGS rRNA de Leishmania spp. para identificação de espécies que causam a leishmaniose tegumentar americana. 2018. Exame de qualificação (Mestrando em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Laís Adrielly Baracho da Costa

LUCENA, N.; MELO, C. M. L.;Paiva-Cavalcanti, Milena. Avaliação da atividade antitumoral de moléculas de quinona-metide em cultura de linhagens de células hematológicas e de células isoladas de crianças com leucemia. 2018. Exame de qualificação (Mestrando em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Marianny Fernanda Teixeira Pacheco

PITA, W. B.; REGO, M. J. B. M.; PAIVA CAVALCANTI, M.. Pesquisa de mutações no gene TP53 e avaliação do seu impacto prognóstico na leucemia mielóide aguda. 2018. Exame de qualificação (Mestrando em Genética) - Universidade Federal de Pernambuco.

Aluno: Tâmisa Morais Rêgo

FRANCA, R. F. O.; DHALIA, R.; PAIVA, M. H. S.;de Paiva Cavalcanti, Milena. Avaliação e desenvolvimento de RT-PCR em tempo real para detecção do vírus chikungunya. 2017. Exame de qualificação (Mestrando em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Lays Adrianne Mendonça Trajano Silva

Paiva-Cavalcanti, Milena; Clarice Lins; BRELAZ-DE-CASTRO, MARIA CAROLINA ACCIOLY;Lorena, V. M. B.. Caracterização da resposta imune celular em cães frente a novos antígenos de Leishmania infamtum. 2017. Exame de qualificação (Mestrando em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Carlos Alberto das Neves de Andrade

Leal, N C; XAVIER, D. E.;Paiva-Cavalcanti, Milena; CAVALCANTI, F. L. S.. Perfil de sensibilidade e caracterização molecular de isolados clínicos de Staphylococcus spp. associados a IRAS em hospital terciário do Recife-PE. 2017. Exame de qualificação (Mestrando em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Carlos Alberto das Neves de Andrade

Leal, N C; XAVIER, D. E.;Paiva-Cavalcanti, Milena; CAVALCANTI, F. L. S.. Perfil de sensibilidade e caracterização molecular de isolados clínicos de Staphylococcus spp. associados à IRAS em hospital terciário do Recife-PE. 2017. Exame de qualificação (Mestrando em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Michelle da Silva Barros

Montenegro, S.; SANTOS, P. D. A.;Lorena, V. M. B.Paiva-Cavalcanti, Milena. Avaliação de quimiocinas na cardiopatia chagásica crônica. 2017. Exame de qualificação (Mestrando em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Igos Vasconcelos Rocha

LOPES, A C S; PAIVA CAVALCANTI, M.; Leal, N C. Identificação de mecanismos de resistência antimicrobiana de bactérias Gram negativas prevalentes em superfícies de unidades de terapia intensiva em Caruaru-PE. 2016. Exame de qualificação (Mestrando em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Marcela Pereira Salazar

Paiva-Cavalcanti, Milena; BRAGA, M. C.; Schlindler, H. C.. Avaliação da acurácia de método molecular automatizado na detecção rápida do Mycobacterium tuberculosis para o diagnóstico das formas paucibacilares da tuberculose em populações vulneráveis. 2016. Exame de qualificação (Mestrando em Mestrado Acadêmico) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Aline dos Santos Peixoto

Paiva-Cavalcanti, Milena; Melo, F. L.; MONTARROYOS, U. R.; Medeiros, Z. M.. Validação da PCR multiplex em tempo real para identificação e diferenciação de micobactérias não tuberculosas. 2015. Exame de qualificação (Mestrando em Ciencias da Saude) - Universidade de Pernambuco.

Aluno: Elverson Soares de Melo

CARVALHO, H.; AYRES, C.; ALVES, L C; GUEDES, D; PAIVA CAVALCANTI, M.. Estudo comparativo da expressão dos genes imunológicos FREPs entre as espécies Biomphalaria glabrata, B. straminea e B. occidentalis, frente à infecção por Schistosomma mansoni. 2014. Exame de qualificação (Mestrando em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Renata Lins Carneiro Leão

Accioly, M. C.; Regina Bressan; OLIVEIRA, S. A.; MONTENEGRO, R A; PAIVA CAVALCANTI, M.. Avaliação do papel da Galectina-3 na patogênese da hepatopatia crônica experimental. 2014. Exame de qualificação (Mestrando em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Rossana Suelle Nascimento dos Santos

Costa, V M A; PAIVA CAVALCANTI, M.; LUCENA, N.; REIS, C R S; ALVES, L C. Avaliação da expressão das isoformas da molécula HLA-G e do perfil da resposta imune em pacientes com Lupus eritematoso sistêmico juvenil (LESJ). 2014. Exame de qualificação (Mestrando em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Rômulo Pessoa e Silva

MONTENEGRO, R A; PEREIRA, V. R. A.; PAIVA CAVALCANTI, M.; DOCENA, C.; SANTOS, F A B. Avaliação de novas estratégias para o diagnóstico molecular da leishmaniose visceral. 2014. Exame de qualificação (Mestrando em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Keicyanne Fernanda Lessa dos Anjos

MACHADO, G.;Paiva-Cavalcanti, Milena; MELO, J. V.; MATTOS, A. B.; PEREIRA, V. R. A.. Avaliação da Biocompatibilidade e da propriedade bactericida de nanotubos de dióxido de titânio impregnados com nanopartículas para aplicações biomédicas. 2014. Exame de qualificação (Mestrando em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Rayana Carla Silva de Morais

Paiva-Cavalcanti, Milena; SANTOS, F A B; MENDES-MARQUES, C. L.; MONTENEGRO, R A; PEREIRA, V. R. A.. Avaliação da aplicabilidade da técnica de PCR em tempo real para caracterização de espécies de Leishmania. 2014. Exame de qualificação (Mestrando em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Juliana Bezerra Medeiros Viana

REIS, C R S; Medeiros, Z. M.;Brandão Filho, Sinval Pinto; Melo, F. L.;Paiva-Cavalcanti, Milena. Análise de assinaturas de minicírculos do kDNA de Leishmania spp. presentes em amostras clínicas de pacientes com leishmaniose tegumentar Americana nas formas ativa e recidivante de áreas endêmicas do estado de Pernambuco. 2014. Exame de qualificação (Mestrando em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Suenia da Cunha Gonçalves de Albuquerque

PAIVA CAVALCANTI, M.; Melo, F. L.; Clarice Lins; FEGUEREDO, L. A.; BRAYNER, F.. Desenvolvimento de ferramentas moleculares baseadas e multiplex PCR e qPCR para inclusão de controles de qualidade amostral no diagnóstico das leishmanioses. 2013. Exame de qualificação (Mestrando em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Anna Lígia de Castro Figueredo

Clarice Lins;Lorena, V. M. B.; PEREIRA, V. R. A.; PAIVA CAVALCANTI, M.. Avaliação do papel do receptor antagonista de IL-13 (IL-Ra2) e sua relação com os graus de fibrose hepática na esquistossomose mansônica. 2013. Exame de qualificação (Mestrando em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Aline Caroline da Silva

PEREIRA, V. R. A.; Accioly, M. C.; PAIVA CAVALCANTI, M.. Análise in vitro do potencial imunomodulador e leishmanicida de derivados de tiossemicarbazona. 2013. Exame de qualificação (Mestrando em Inovação Terapêutica) - Universidade Federal de Pernambuco.

Aluno: THAYS MIRANDA DE ALMEIDA

PEREIRA, V. R. A.; PAIVA CAVALCANTI, M.. Perfil da expressão de mediadores da resposta imune celular de pacientes com leishmaniose tegumentar ativa. 2013. Exame de qualificação (Mestrando em Inovação Terapêutica) - Universidade Federal de Pernambuco.

Aluno: Thiago André Santos de Andrade

PAIVA CAVALCANTI, M; Medeiros, Z. M.; Júnior, J. F. M.. Perfil epidemiológico dos casos de leishmaniose tegumentar americana no município de Igarassu -PE no período de 2008 a 2010. 2011. Monografia (Aperfeiçoamento/Especialização em Especialização em Saúde Pública) - Centro de Pesquisas Aggeu Magalhães.

Aluno: Marina de Assis Souza

PAIVA CAVALCANTI, M; MEDEIROS, Z.; MOURA, P.; PEREIRA, V. R. A.. Quantificação da Expressão de Citocinas em pacientes com Leishmaniose Tegumentar Americana ativa e após cura clínica. 2010. Monografia (Aperfeiçoamento/Especialização em Especialização em Biologia Molecular) - Universidade de Pernambuco.

Aluno: Brenda Costa Dias

Paiva-Cavalcanti, MilenaMorais, R C S; SANDES, J.. Avaliação da expressão gênica de citocinas associadas à resposta imune celular na infecção por Leishmania sp. em populações de áreas endêmicas para leishmaniose tegumentar no estado de PE. 2016. Trabalho de Conclusão de Curso (Graduação em Ciências Biológicas) - Universidade Federal de Pernambuco.

Aluno: Tayná Correia de Goes

Paiva-Cavalcanti, Milena; ALMEIDA JUNIOR, A. S. A.; BARBOSA JUNIOR, W. L.. Desenvolvimento de qPCR multiplex para identificação de Leishmania spp. relacionadas com a etiologia da leishmaniose tegumentar Americana. 2016. Trabalho de Conclusão de Curso (Graduação em Biomedicina) - Centro universitário Maurício de Nassau - Recife.

Aluno: Lays Adrianne Mendonça Trajano Silva

Paiva-Cavalcanti, Milena; OLIVEIRA, G. A.;Morais, R C S. Avaliação de ensaios de multiplex PCR em tempo real para o dignóstico molecular das leishmanioses. 2015. Trabalho de Conclusão de Curso (Graduação em Biomedicina) - Universidade Federal de Pernambuco.

Aluno: Flaviana Alves dos Santos

PITTA, M. G. R.; PAIVA CAVALCANTI, M.. Avaliação da atividade anticâncer dos novos derivados tiazacrídinicos frente às linhagens de leucemia aguda CCRf-CEM e HI-60. 2014. Trabalho de Conclusão de Curso (Graduação em Biomedicina) - Universidade Federal de Pernambuco.

Aluno: Rayana Carla Silva de Morais

PAIVA CAVALCANTI, M.; MAIA, C. S.;Gonçalves, S. C.SILVA, RP. População de ectoparasitos em animais domésticos e sua relação com a epidemiologia da leishmaniose visceral no estado de Pernambuco. 2013. Trabalho de Conclusão de Curso (Graduação em Licenciatura em Ciências Biológicas) - Universidade Federal Rural de Pernambuco.

Aluno: Amanda Ferreira de Almeida

PEREIRA, V. R. A.;Paiva-Cavalcanti, Milena; Moitinho, C.. Análise de marcadores fenotípicos no sangue periférico de pacientes portadores de leishmaniose tegumentar americana. 2010. Trabalho de Conclusão de Curso (Graduação em Biomedicina) - Universidade Federal de Pernambuco.

Aluno: Ana Isabele Freitas de Araújo

Brandão-Filho, S.PAIVA CAVALCANTI, M. Roedores Silvestres e flebotomíneos envolvidos na eco-epidemiologia da leishmaniose tegumentar americana no município de Vicência, PE, Brasil. 2010. Trabalho de Conclusão de Curso (Graduação em Licenciatura em Ciências Biológicas) - Universidade Federal Rural de Pernambuco.

Aluno: Gabriela Menezes Silva do Nascimento

PAIVA CAVALCANTI, MBRITO, M. E. F.. Epidemiologia da leishmaniose visceral no estado de Pernambuco, Nordeste-Brasil. 2009. Trabalho de Conclusão de Curso (Graduação em Biomedicina) - Centro universitário Maurício de Nassau - Recife.

Aluno: Vanessa Cristina Fitipaldi Veloso Guimarães

Rodrigues, E. H.; DANTAS TORRES, F;PAIVA CAVALCANTI, M. Pesquisa de hospedeiros Reservatórios de Leishmania (Viannia) braziliensis em área endêmica para Leishmaniose Tegumentar Americana. 2008. Trabalho de Conclusão de Curso (Graduação em Biomedicina) - Universidade Federal de Pernambuco.

Aluno: Andresa Pereira de Oliveira

PAIVA CAVALCANTI, M; PEREIRA, V. R. A.; Rodrigues, E. H.. Hospedeiros reservatórios envolvidos na ecoepidemiologia da leishmaniose tegumentar americana em centro de treinamento militar na Zona da Mata de Pernambuco. 2008. Trabalho de Conclusão de Curso (Graduação em Ciências Biológicas) - Universidade Federal de Pernambuco.

Aluno: Marcela Ferreira Melo

Brandão-Filho, S.PAIVA CAVALCANTI, M. Prevalência de anticorpos anti-leishmania em cães de São Vicente Ferrer, Pernambuco Brasil. 2008. Trabalho de Conclusão de Curso (Graduação em Biomedicina) - Centro universitário Maurício de Nassau - Recife.

Aluno: Mariana Eufrazia de Santana

MELO NETO, O. P.; HENRIQUE, E.; DOCENA, C.;PAIVA CAVALCANTI, M. Clonagem e Expressão De Genes Relevantes para a Resposta Imune da Leishmaniose Tegumentar Americana. 2007. Trabalho de Conclusão de Curso (Graduação em Biomedicina) - Universidade Federal de Pernambuco.

Aluno: Simonne Rachell de Castro Morais

PAIVA CAVALCANTI, M. Diagnóstico Sorológico e parasitológico da leishmaniose visceral canina em Teresina-PI e identificação de flebotomíneos na área florestal do Parque Zoobotânico Teresina-PI. 2004. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Federal Rural de Pernambuco.

Aluno: Juliana Paula Santos Azevedo

PAIVA CAVALCANTI, M. Dermatopatias Parasitárias: Demodicose, Escabiose, Pediculose e Miíase cutânea-Relatos de casos. 2004. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Federal Rural de Pernambuco.

Aluno: Felipe Dantas Torres

PAIVA CAVALCANTI, M. Investigação epidemiológica na Região de Antigo foco de leishmaniose visceral canina na Cidade do Recife. 2004. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Federal Rural de Pernambuco.

Aluno: Rachel Lira Barreto

PAIVA CAVALCANTI, M. Educação em saúde no controle de escorpiões no Recife. 2003. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Federal Rural de Pernambuco.

Aluno: Carlos Alberto do Nascimento Ramos

PAIVA CAVALCANTI, M; MAIA, F. C. L.. Padronização de um sistema de purificação da proteína recombinante MSP2 de Anaplasma marginale por eletroeluição. 2003. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Federal Rural de Pernambuco.

PAIVA CAVALCANTI, M.. Banca do processo seletivo para bolsas de iniciação científica PIBIC/PIBIT FIOCRUZ. 2019. Fundação Osvaldo Cruz.

PAIVA CAVALCANTI, M.. Seminário PosDoc FACEPE. 2019. Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco.

PAIVA CAVALCANTI, M.. III SEMINÁRIO DE AVALIAÇÃO PARCIAL CHAMADA PÚBLICA N 14/2016 PREVENÇÃO E COMBATE AO VÍRUS ZIKA. 2019. Coordenação de Aperfeiçoamento de Pessoal de Nível Superior.

PAIVA CAVALCANTI, M.; OLIVEIRA, S. A.; VARJAL, A.; Costa, V M A; DHALIA, R.. Seleção Doutorado em Biociências e Biotecnologia em Saúde, turma 2020. 2019. Centro de Pesquisas Aggeu Magalhães.

Paiva-Cavalcanti, Milena; Clarice Lins; MONTENEGRO, L. M. L.. Banca da 26 Reunião Anual de Iniciação Científica da FIOCRUZ-PE. 2018. Centro de Pesquisas Aggeu Magalhães.

Paiva-Cavalcanti, Milena. Banca do processo seletivo para bolsas de iniciação científica PIBIC/PIBIT FIOCRUZ. 2018. Fundação Oswaldo Cruz.

PAIVA CAVALCANTI, M.. Avaliação de resumos a serem apresentados no 54 Congresso da Sociedade Brasileira de Medicina Tropical. 2018. Sociedade Brasileira de Medicina Tropical.

Paiva-Cavalcanti, Milena. Seminário Pós-Doc 2018 FACEPE. 2018. Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco.

Paiva-Cavalcanti, Milena. Parecerista de Tese: Lectina de Bothrops leucurus: avaliação do efeito leishmanicida e correlação com a modulação da resposta imune em macrófagos peritoneais. 2018. Centro de Pesquisas Aggeu Magalhães.

PAIVA CAVALCANTI, M. II SEMINÁRIO DE AVALIAÇÃO PARCIAL CHAMADA PÚBLICA N 14/2016 PREVENÇÃO E COMBATE AO VÍRUS ZIKA. 2018. Coordenação de Aperfeiçoamento de Pessoal de Nível Superior.

de Paiva Cavalcanti, Milena. PARECERISTA Dissertação: Identificação de mecanismos de Resistência antimicrobiana de bactérias Gram negativas prevalentes em superfícies e hemoculturas de unidades de terapia intensiva em Caruaru-PE.. 2017. Centro de Pesquisas Aggeu Magalhães.

Paiva-Cavalcanti, Milena de. PARECERISTA DE TESE: Avaliação in vitro do potencial tripanocida, citotóxico e imunomodulador de óleos essenciais de plantas da caatinga. 2017. Centro de Pesquisas Aggeu Magalhães.

de Paiva-Cavalcanti, Milena; PEREIRA, V. R. A.. Banca do Seminário Pos-Doc FACEPE. 2017. Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco.

Paiva-Cavalcanti, Milena de; DOCENA, C.; XAVIER, D. E.; MOURA, D. M. N.. Banca da Reunião Anual de Iniciação Científica da FIOCRUZ/PE. 2016. Centro de Pesquisas Aggeu Magalhães.

Paiva-Cavalcanti, Milena de; Regina Bressan. Banca da 20 Jornada de Iniciação Científica da FACEPE. 2016. Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco.

Paiva-Cavalcanti, Milena. Processo seletivo PIBIC FIOCRUZ. 2015. Fundação Oswaldo Cruz.

PAIVA CAVALCANTI, M.; CESSE, E.. Comissão avaliadora da 19 Jornada de Iniciação Científica da FACEPE. 2015. Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco.

Paiva-Cavalcanti, Milena. Processo seletivo PIBIC-FACEPE. 2015. Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco.

Clarice Lins;Paiva-Cavalcanti, Milena; FRANCA, R. F. O.; PENA, L. J.. Processo seletivo do Doutorado em Biociências e Biotecnologia em Saúde do CPqAM. 2015. Centro de Pesquisas Aggeu Magalhães.

PAIVA CAVALCANTI, M.. PARECERISTA de Dissertação: Avaliação da participação do receptor antagonista de IL13 (IL13Ralfa2) na relação com os graus de fibrose hepática na esquistossomose mansônica. 2014. Centro de Pesquisas Aggeu Magalhães.

Paiva-Cavalcanti, Milena. Parecerista de Dissertação: Avaliação da participação do receptor antagonista de IL13 (IL13Ralfa2) na relação com os graus de fibrose hepática na esquistossomose mansônica. 2014. Centro de Pesquisas Aggeu Magalhães.

Paiva-Cavalcanti, Milena. Processo seletivo para bolsas de iniciação científica-PIBIC/FIOCRUZ. 2014. Fundação Oswaldo Cruz.

Paiva-Cavalcanti, Milena. Avaliador do processo seletivo de bolsas de iniciação tecnológica PIBIT/FIOCRUZ. 2014. Fundação Oswaldo Cruz.

Paiva-Cavalcanti, Milena. 18 Jornada de Iniciação Científica da FACEPE. 2014. Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco.

Paiva-Cavalcanti, Milena. Seminário de Avaliação do Programa Nacional de Pós-Doutorado (PNPD). 2014. Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco.

Paiva-Cavalcanti, Milena. Avaliador do Processo seletivo PIBIC-FIOCRUZ/CNPq. 2013. Fundação Oswaldo Cruz.

PAIVA CAVALCANTI, M. Avaliador do processo de seleção PIBIT FIOCRUZ. 2013. Fundação Oswaldo Cruz.

REIS, C R S; Montenegro, S.; Leal, N C; Silva, M S B;PAIVA CAVALCANTI, M. Qualificação de Mestrado: Aplicação da técnica de LOOP no desenvolvimento de um teste para o diagnóstico da peste. 2012. Centro de Pesquisas Aggeu Magalhães.

PAIVA CAVALCANTI, M. Parecerista de Dissertação: Avaliação de diferentes amostras biológicas utilizadas para o diagnóstico da TB extrapulmonar através da PCR em tempo real. 2012. Centro de Pesquisas Aggeu Magalhães.

PAIVA CAVALCANTI, M. Parecerista de Dissertação: Análise do desempenho da técnica de PCR em tempo real para o diagnóstico da TB pulmonar. 2012. Centro de Pesquisas Aggeu Magalhães.

PAIVA CAVALCANTI, M. Parecerista de Dissertação: Concordância da cultura em relação ao exame direto e a reação em cadeia da polimerase em aspirado de medula óssea no diagnóstico de leishmaniose visceral. 2012. Centro de Pesquisas Aggeu Magalhães.

PAIVA CAVALCANTI, M.. Avaliador do Processo seletivo para o Edital do PIBIC - FIOCRUZ/CNPq. 2012. Fundação Oswaldo Cruz.

Clarice Lins; PAIVA CAVALCANTI, M.; BRAYNER, F.; OLIVEIRA, S. A.; VARJAL, A.. Processo seletivo para Mestrado Acadêmico em Biociências e Biotecnologia Turma 2013. 2012. Centro de Pesquisas Aggeu Magalhães.

Brito, A M; Lira, T; FONTES, C; Miranda, J.; Leal, N C;Paiva-Cavalcanti, Milena. Banca de seleção para o Mestrado Profissional em Saúde Pública. 2011. Centro de Pesquisas Aggeu Magalhães.

PAIVA CAVALCANTI, M.. Avaliação do processo seletivo do PIBIC FIOCRUZ 2011-2012. 2011. Centro de Pesquisas Aggeu Magalhães.

PAIVA CAVALCANTI, MLorena, V. M. B.; Moitinho, C.; ARAUJO, P. S. R.; Schlindler, H. C.. Parecerista da Tese de Doutorado - Avaliação do RNA mensageiro (RNAm) do Mycobacterium tuberculosis como marcador de cura em pacientes com tuberculose pulmonar. 2011. Centro de Pesquisas Aggeu Magalhães.

ALVES, L. C.PAIVA CAVALCANTI, M; Medeiros, Z. M.. Qualificação de mestrado: Concordância da cultura em relação ao exame direto e a reação em cadeia da polimerase em aspirado de medula óssea no diagnóstico de leishmaniose visceral. 2011. Centro de Pesquisas Aggeu Magalhães.

PAIVA CAVALCANTI, M. Parecerista Dissertação Mestrado- Identificação de hospedeiros reservatórios e espécies de Leishmania envolvidos na transmissão e manutenção da leishmaniose tegumentar americana em área endêmica da Zona da Mata Norte de Pernambuco. 2010. Centro de Pesquisas Aggeu Magalhães.

PAIVA CAVALCANTI, M. Parecerista Dissertação Mestrado Detecção rápida e diferenciação de espécies de micobactérias através de um sistema de PCR multiplex. 2010. Centro de Pesquisas Aggeu Magalhães.

PAIVA CAVALCANTI, M. Avaliador do Processo seletivo para PIBIC/FIOCRUZ. 2010. Fundação Oswaldo Cruz.

PAIVA CAVALCANTI, M; Clarice Lins; Regina Bressan; Idê Gurgel. Mestrado em Saúde Pública do CPqAM FIOCRUZ/PE. 2009. Centro de Pesquisas Aggeu Magalhães.

Seção coletada automaticamente pelo Escavador

Comissão julgadora das bancas

Leonildo Bento Galiza da Silva

RAMADINHA, Regina Helena Ruckert; GOMES, Yara de Miranda;SILVA, L. B. G.. Intercorrência entre agentes micóticos, bacterianos e parasitários em lesões cutâneas de cães com diagnóstico presuntivo de Leishmaniose visceral canina. 2004. Dissertação (Mestrado em Ciência Veterinária) - Universidade Federal Rural de Pernambuco.

Constança Felicia de Paoli de Carvalho Britto

BRITTO, C. Desenvolvimento e avaliação de um sistema baseado em PCR em Tempo Real para o diagnóstico da infecção por Leishmania (Leishmania) infantum.. 2008. Tese (Doutorado em Saúde Pública) - Centro de Pesquisas Aggeu Magalhães.

Yara de Miranda Gomes

GOMES, Y. M.; RAMADINHA, R. H. R.; SILVA, L. B. G.. Intercorrência entre agentes micóticos, bacterianos e parasitários em lesões cutâneas de cães com diagnóstico presuntivo de leishmaniose visceral canina.. 2004. Dissertação (Mestrado em Medicina Veterinária) - Universidade Federal Rural de Pernambuco.

Yara de Miranda Gomes

BRITTO, C.;ALVES, L. C.LEAL, N. C.; SILVA-FILHA, M. H. N. L.;GOMES, Y. M.. Desenvolvimento e avaliação de um sistema baseado em PCR em tempo real para o diagnóstico da infeccção por Leishmania (Leishmania) infantum. 2008. Tese (Doutorado em Doutorado) - Centro de Pesquisas Aggeu Magalhães/FIOCRUZ.

Yara de Miranda Gomes

ALVES, L. C.GOMES, Y. M.LEAL, N. C.. Desenvolvimento e avaliação de PCR em tempo real para o diagnóstico da infecção por Leishmania chagasi.. 2007. Exame de qualificação (Doutorando em Doutorado) - Centro de Pesquisas Aggeu Magalhães/FIOCRUZ.

Maria Helena Neves Lobo Silva Filha

SILVA FILHA M.H.N.L.; Britto, C; ALVES, L. C.; LEAL, N. C.; GOMES, Yara de Miranda. Desenvolvimento e avaliação de um sistema baseado em PCR em tempo real para o diagnóstico da infecção por Leishmania (Leishmania) infantum em cães. 2008. Tese (Doutorado em Doutorado Em Saúde Pública) - Centro de Pesquisas Aggeu Magalhães.

Nilma Cintra Leal

Britto C.F.P.C.; ALVES, L. C.;LEAL, Nilma Cintra; SILVA FILHA, Maria Helena Neves Lobo;GOMES, Y. M.. Desenvolvimento e avaliaçõ de um sistema baseado em PCR em tempo real para o diagnóstico da infecção por Leishmania (Leishmania) infantum. 2008. Tese (Doutorado em Doutorado Em Saúde Pública) - Centro de Pesquisas Aggeu Magalhães.

Leucio Câmara Alves

BRITTO, C. F. P. C.;ALVES, L. C; LEAL, N. C.; SILVA FILHA, M. H. N. L.;GOMES, Y. M.; RODRIGUES, E. H.; MELO, F. L.. Desenvolvimento e avaliação de um sistema baseado em PCR em tempo real para o diagnóstico da infecção por Leishmania (Leishmania) infantum. 2008. Tese (Doutorado em Pós-graduação em Saúde Pública) - Fundação Oswaldo Cruz.

Leucio Câmara Alves

ALVES, L. C. .. 2001. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Federal Rural de Pernambuco.

Fabio Lopes de Melo

ALVES, L. C.;Nilma Cintra LealGOMES, Y. M.MELO, F. L.; PEREIRA, V. R. A.. Desenvolvimento e avaliação de PCR em tempo real para o diagnóstico da infecção por Leishmania chagasi. 2007. Exame de qualificação (Doutorando em Curso de Doutourado em Saúde Pública) - Centro de Pesquisas Aggeu Magalhães.

Rinaldo Aparecido Mota

CAVALCANTI, M. P.;MOTA, R. A.. Infecções micóticas e bacterianas associadas a lesões de Leishimaniose cutânea em cães. 2001. Trabalho de Conclusão de Curso (Graduação em Medicina Veterinária) - Universidade Federal Rural de Pernambuco.

Eduardo Henrique Gomes Rodrigues

Brito, Contança Felícia de Paoli; ALVES, Leucio Câmara; Leal, Nilma Cintra; Filha, Maria Helena Silva; Melo, F.L.;RODRIGUES EH. Desenvolvimento e avaliação de um sistema baseado em PCR em tempo real para o diagnóstico da infecção por Leishmania (Leishmania) infantum. 2008. Tese (Doutorado em Doutorado em Saúde Pública) - Centro de Pesquisas Aggeu Magalhães.

Seção coletada automaticamente pelo Escavador

Orientou

Maria Gabriella Nunes de Melo

Imunologia aplicada ao desenvolvimento de novas estratégias de controle para as leishmanioses: uma abordagem terapêutica em leishmaniose tegumentar americana; ; Início: 2020; Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães, Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco; (Orientador);

Victor Vaitkevicius Antão de Souza

Imunologia aplicada ao desenvolvimento de novas estratégias de controle para as leishmanioses: Uma abordagem em leishmaniose visceral canina; Início: 2019; Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães, Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco; (Orientador);

Ana Carla da Silva

CARACTERIZAÇÃO METABÓLICA in vitro DOS EFEITOS DA INFECÇÃO POR Trypanosoma cruzi EM ADIPÓCITOS HUMANOS MEDIANTE O TRATAMENTO COM BENZNIDAZOL; Início: 2020; Tese (Doutorado em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães; (Coorientador);

Cíntia Nascimento da Costa Oliveira

Doença de Chagas no estado de Pernambuco: uma abordagem diagnóstica e de tipagem molecular de Trypanosoma cruzi; ; Início: 2020; Tese (Doutorado em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães; (Coorientador);

Alexsandra Frazao de Andrade

Avaliação de bioativos da microalga Chlorella vulgaris para cicatrização de lesões decorrentes de Leishmaniose Tegumentar Americana; Início: 2020; Tese (Doutorado em Biociência Animal) - Universidade Federal Rural de Pernambuco; (Coorientador);

Bárbara Silva Lima

Avaliação do potencial imunomodulador de microalgas candidatas ao desenvolvimento de terapias contra a leishmaniose visceral humana; ; Início: 2020; Orientação de outra natureza; Centro de Pesquisas Aggeu Magalhães; Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco; (Orientador);

Cíntia Nascimento da Costa Oliveira

APLICAÇÃO DO DIAGNÓSTICO MOLECULAR PARA CARACTERIZAÇÃO DOS PACIENTES ENVOLVIDOS NO SURTO DE DOENÇA DE CHAGAS EM PERNAMBUCO; 2018; Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães, Fundação Osvaldo Cruz; Coorientador: Milena de Paiva Cavalcanti;

Eiji Kevin Nakasone Nakasone

ALIAÇÃO DO USO DO Tiazoacetilpirimida 04 NO TRATAMENTO DE CÃES COM INFECÇÃO NATURAL POR Leishmania infantum; 2018; Dissertação (Mestrado em Biociência Animal) - Universidade Federal Rural de Pernambuco,; Coorientador: Milena de Paiva Cavalcanti;

Lays Adrianne Mendonça Trajano Silva

Caracterização da resposta imune celular em cães frente a novos antígenos de Leishmania infantum; 2016; Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães,; Orientador: Milena de Paiva Cavalcanti;

Tayná Correia de Goes

Avaliação de alvos moleculares para identificação de Leishmania spp; de importância clínica na leishmaniose tegumentar Americana por qPCR multiplex; 2016; Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães,; Orientador: Milena de Paiva Cavalcanti;

Rômulo Pessoa e Silva

Avaliação da técnica de PCR em tempo real para o diagnóstico da leishmaniose visceral em amostras de urina; 2015; Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior; Orientador: Milena de Paiva Cavalcanti;

Rayana Carla Silva de Morais

Avaliação da aplicabilidade da técnica de PCR em tempo real para caracterização de espécies de Leishmania spp; ; 2015; Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães,; Orientador: Milena de Paiva Cavalcanti;

Suênia da Cunha Gonçalves

Desenvolvimento de ferramentas moleculares baseadas PCR para inclusão de controles de qualidade no diagnóstico das leishmanioses; 2014; Dissertação (Mestrado em Mestrado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior; Orientador: Milena de Paiva Cavalcanti;

Gilsan Aparecida de Oliveira

Detecção de anticorpos anti-Toxoplasma gondii em leite de caprinos em Pernambuco; 2008; Dissertação (Mestrado em Medicina Veterinária) - Universidade Federal Rural de Pernambuco,; Coorientador: Milena de Paiva Cavalcanti;

Rômulo Pessoa e Silva

Avaliação do perfil de resposta imune celular in vitro de cães frente a novos antígenos de Leishmania spp; ; 2016; Tese (Doutorado em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães,; Orientador: Milena de Paiva Cavalcanti;

Rayana Carla Silva de Morais

Ensaios de multiplex PCR em tempo real (TaqMan probe) para identificação de Leishmania spp; relacionadas com a etiologia da leishmaniose tegumentar Americana; 2015; Tese (Doutorado em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior; Orientador: Milena de Paiva Cavalcanti;

Thacianna Barreto da Costa

ATIVIDADE ANTIFÚNGICA DE MACRÓFAGOS ALVEOLARES DE RATOS SUBMETIDOS À DESNUTRIÇÃO NEONATAL: ANÁLISE DA EXPRESSÃO DE RECEPTORES, ATIVIDADE FAGOCITICA, PRODUÇÃO DE MEDIADORES PRÓ-INFLAMATÓRIOS E MORTE CELULAR APÓS INFECÇÃO, IN VITRO, POR Candida Albicans; 2014; Tese (Doutorado em Medicina Tropical) - Universidade Federal de Pernambuco,; Coorientador: Milena de Paiva Cavalcanti;

Natália Gomes de Morais

EFEITO DA DESNUTRIÇÃO NEONATAL SOBRE SINALIZAÇÃO INTRACELULAR E VIABILIDADE DE MACRÓFAGOS ALVEOLARES INFECTADOS, IN VITRO, COM Staphylococcus aureus METICILINA SENSÍVEL E METICILINA RESISTENTE; 2014; Tese (Doutorado em Medicina Tropical) - Universidade Federal de Pernambuco,; Coorientador: Milena de Paiva Cavalcanti;

Suênia da Cunha Gonçalves

Caracterização da resposta imune celular à infecção por L; (V; ) braziliensis na presença de variações genéticas para a IL-17; 2014; Tese (Doutorado em Doutorado em Biociências e Biotecnologia) - Centro de Pesquisas Aggeu Magalhães, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior; Orientador: Milena de Paiva Cavalcanti;

EDENEIDE MARIA XAVIER

Avaliação de uma nova abordagem diagnóstica baseada em um nanocompósito para a leishmaniose visceral; 2014; Tese (Doutorado em Genética) - Universidade Federal de Pernambuco,; Coorientador: Milena de Paiva Cavalcanti;

Thiago André Santos de Andrade

Perfil epidemiológico dos casos de leishmaniose tegumentar americana no município de Igarassu/PE no período de 2008 a 2010; 2011; Monografia; (Aperfeiçoamento/Especialização em Especialização em Saúde Pública) - Centro de Pesquisas Aggeu Magalhães; Orientador: Milena de Paiva Cavalcanti;

Maria Gabriella Nunes de Melo

Acompanhamento clínico-terapêutico de pacientes com diferentes etiologias para leishmaniose tegumentar americana; 2018; Trabalho de Conclusão de Curso; (Graduação em Biomedicina) - Centro Universitário Tiradentes; Orientador: Milena de Paiva Cavalcanti;

Victor Vaitkevicius Antão de Souza

Avaliação do potencial imunoprofilático e imunoterápico de novas proteínas quiméricas de Leishmania infantum: uma abordagem em leishmaniose visceral canina; ; 2018; Trabalho de Conclusão de Curso; (Graduação em Bacharelado em Ciências Biológicas) - Faculdade Frassinetti do Recife; Orientador: Milena de Paiva Cavalcanti;

Brenda Costa Dias

Avaliação da expressão gênica de citocinas associadas à resposta imune celular na infecção por Leishmania sp; em populações de áreas endêmicas para leishmaniose tegumentar no estado de PE; 2016; Trabalho de Conclusão de Curso; (Graduação em Ciências Biológicas) - Universidade Federal de Pernambuco; Orientador: Milena de Paiva Cavalcanti;

Tayná Correia de Goes

DESENVOLVIMENTO DE qPCR MULTIPLEX PARA IDENTIFICAÇÃO DE Leishmania spp; ENVOLVIDAS NA ETIOLOGIA DA LEISHMANIOSE TEGUMENTAR AMERICANA; 2016; Trabalho de Conclusão de Curso; (Graduação em Biomedicina) - Centro universitário Maurício de Nassau - Recife; Orientador: Milena de Paiva Cavalcanti;

Lays Adrianne Mendonça Trajano Silva

Avaliação de ensaios de multiplex PCR em tempo real para o diagnóstico molecular das leishmanioses; 2015; Trabalho de Conclusão de Curso; (Graduação em Biomedicina) - Universidade Federal de Pernambuco; Orientador: Milena de Paiva Cavalcanti;

Camila Accioly Pituba

O USO DA REAÇÃO DA CADEIA EM POLIMERASE (PCR) NO DIAGNÓSTICO COMPROBATÓRIO DA LEISHMANIOSE VISCERAL CANINA; 2015; Trabalho de Conclusão de Curso; (Graduação em Medicina Veterinária) - Centro Universitário CESMAC; Orientador: Milena de Paiva Cavalcanti;

Rayana Carla Silva de Morais

População de ectoparasitos em animais domésticoa e sua relação com a epidemiologia da leishmaniose visceral no estado de Pernambuco; 2013; Trabalho de Conclusão de Curso; (Graduação em Licenciatura em Ciências Biológicas) - Universidade Federal Rural de Pernambuco; Orientador: Milena de Paiva Cavalcanti;

Rômulo Pessoa e Silva

PADRONIZAÇÃO DO USO DO PLASMÍDEO pUC 18 COMO CONTROLE DO PROCESSO DE EXTRAÇÃO DE DNA EM PCR MULTIPLEX PARA O DIAGNÓSTICO DA LEISHMANIOSE TEGUMENTAR AMERICANA; 2012; Trabalho de Conclusão de Curso; (Graduação em Biomedicina) - Universidade Federal de Pernambuco, Conselho Nacional de Desenvolvimento Científico e Tecnológico; Orientador: Milena de Paiva Cavalcanti;

Suênia da Cunha Gonçalves

Aplicação do gene G3PD de mamíferos como controle de qualidade amostral em multiplex PCR para o diagnóstico das leishmanioses; 2011; Trabalho de Conclusão de Curso; (Graduação em Biomedicina) - Universidade Federal de Pernambuco; Orientador: Milena de Paiva Cavalcanti;

Anny Caroliny de Oliveira Silva

AVALIAÇÃO in vitro DA RESPOSTA IMUNE CELULAR EM CÃES FRENTE À PROTEÍNA RECOMBINANTE Lci10 DE Leishmania infantum; 2018; Iniciação Científica; (Graduando em Medicina Veterinária) - Centro universitário Maurício de Nassau - Recife, Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco; Orientador: Milena de Paiva Cavalcanti;

Maria Gabriella Nunes de Melo

Acompanhamento clinico-terapêutico de pacientes com diferentes etiologias para leishmaniose tegumentar Americana; 2017; Iniciação Científica; (Graduando em Biomedicina) - Faculdade Integrada de Pernambuco, Conselho Nacional de Desenvolvimento Científico e Tecnológico; Orientador: Milena de Paiva Cavalcanti;

Victor Vaitkevicius Antão de Souza

AVALIAÇÃO DA RESPOSTA IMUNE CELULAR EM CÃES FRENTE A PROTEÍNA QUIMÉRICA Q1 DE Leishmania infantum; 2017; Iniciação Científica; (Graduando em Bacharelado em Ciências Biológicas) - Faculdade Frassinetti do Recife, Conselho Nacional de Desenvolvimento Científico e Tecnológico; Orientador: Milena de Paiva Cavalcanti;

Victor Vaitkevicius Antão de Souza

AVALIAÇÃO DA RESPOSTA IMUNE CELULAR EM CÃES FRENTE A PROTEÍNA QUIMÉRICA Q1 DE Leishmania infantum; 2016; Iniciação Científica; (Graduando em Bacharelado em Ciências Biológicas) - Faculdade Frassinetti do Recife, Conselho Nacional de Desenvolvimento Científico e Tecnológico; Orientador: Milena de Paiva Cavalcanti;

Tayná Correia de Goes

Análise in silico e avaliação de diferentes alvos moleculares para identificação de Leishmania spp; ; 2015; Iniciação Científica; (Graduando em Biomedicina) - Centro universitário Maurício de Nassau - Recife, Conselho Nacional de Desenvolvimento Científico e Tecnológico; Orientador: Milena de Paiva Cavalcanti;

Lays Adrianne Mendonça Trajano Silva

Avaliação de ensaios de multiplex PCR em tempo real para o diagnóstico molecular das leishmanioses; 2014; Iniciação Científica; (Graduando em Biomedicina) - Universidade Federal de Pernambuco, Conselho Nacional de Desenvolvimento Científico e Tecnológico; Orientador: Milena de Paiva Cavalcanti;

Brenda Costa Dias

Avaliação da expressão gênica de citocinas associadas à resposta imune celular na infecção por Leishmania (V; ) braziliensis em população de área endêmica do Estado de Pernambuco; 2014; Iniciação Científica; (Graduando em Ciências Biológicas) - Universidade Federal de Pernambuco, Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco; Orientador: Milena de Paiva Cavalcanti;

Lays Adrianne Mendonça Trajano Silva

Utilização de DNA externo como controle do método de extração em PCR multiplex para o diagnóstico da leishmaniose visceral; 2013; Iniciação Científica; (Graduando em Biomedicina) - Universidade Federal de Pernambuco, Conselho Nacional de Desenvolvimento Científico e Tecnológico; Orientador: Milena de Paiva Cavalcanti;

Rômulo Pessoa e Silva

Padronização do uso do plasmídeo pUC 18 como controle de extração de DNA em multiplex PCR para o diagnóstico das leishmanioses; 2012; Iniciação Científica; (Graduando em Biomedicina) - Universidade Federal de Pernambuco, Conselho Nacional de Desenvolvimento Científico e Tecnológico; Orientador: Milena de Paiva Cavalcanti;

Suênia da Cunha Gonçalves

Padronização de PCR multiplex e PCR multiplex em tempo real para o diagnóstico das leishmanioses; ; 2011; Iniciação Científica; (Graduando em Biomedicina) - Universidade Federal de Pernambuco, Conselho Nacional de Desenvolvimento Científico e Tecnológico; Orientador: Milena de Paiva Cavalcanti;

Lays Adrianne Mendonça Trajano Silva

Avaliação da resposta imune celular em cães frente a novos antígenos (quimeras) de Leishmania spp; ; 2015; Orientação de outra natureza - Centro de Pesquisas Aggeu Magalhães, Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco; Orientador: Milena de Paiva Cavalcanti;

Cíntia Nascimento da Costa

Avaliação da aplicabilidade da técnica de PCR em tempo real para caracterização de espécies de Leishmania spp; ; 2014; Orientação de outra natureza - Centro de Pesquisas Aggeu Magalhães, Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco; Orientador: Milena de Paiva Cavalcanti;

Cíntia Nascimento da Costa Oliveira

Caracterização da resposta imune celular à infecção por L; (V; ) braziliensis na presença de variações genéticas para a IL-17; 2014; Orientação de outra natureza - Centro de Pesquisas Aggeu Magalhães, Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco; Orientador: Milena de Paiva Cavalcanti;

FABIA CARLA DA SILVA SOARES

POPULAÇÃO DE ECTOPARASITOS EM ANIMAIS DOMÉSTICOS E SUA RELAÇÃO COM A EPIDEMIOLOGIA DAS LEISHMANIOSES EM PERNAMBUCO; 2011; Orientação de outra natureza - Centro de Pesquisas Aggeu Magalhães, Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco; Orientador: Milena de Paiva Cavalcanti;

Suênia da Cunha Gonçalves

Aplicação do gene G3PD de mamíferos como controle de qualidade amostral em multiplex PCR para o diagnóstico das leishmanioses; 2011; Orientação de outra natureza - Centro de Pesquisas Aggeu Magalhães, Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco; Orientador: Milena de Paiva Cavalcanti;

Rayana Carla Silva de Morais

População de ectoparasitos em animais domésticos e sua relação com a epidemiologia das leishmanioses no Estado de Pernambuco; 2011; Orientação de outra natureza - Centro de Pesquisas Aggeu Magalhães, Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco; Orientador: Milena de Paiva Cavalcanti;

Seção coletada automaticamente pelo Escavador

Foi orientado por

Frederico Guilherme Coutinho Abath

Avaliação da reacao em cadeia da polimerase e sorologia para o dignóstico da infeccao por L; chagasi em caes; Início: 2005; Tese (Doutorado em Saúde Pública) - Fundação Oswaldo Cruz; (Coorientador);

Maria Aparecida da gloria Faustino

Intercorrência entre agentes micóticos, bacterianos e parasitários em lesões cutâneas de cães com diagnóstico presuntivo de leishmaniose canina; 2004; Dissertação (Mestrado em PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIA VETERINÁRIA) - UNIVERSIDADE FEDERAL RURAL DE PERNAMBUCO, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior; Orientador: Maria Aparecida da Gloria Faustino;

Maria Aparecida da gloria Faustino

INFECÇÕES BACTERIANAS E MICÓTICAS EM CÃES NATURALMENTE INFECTADOS COM Leshmania chagasi; ; 2001; 0 f; Trabalho de Conclusão de Curso; (Graduação em Medicina Veterinária) - Universidade Federal Rural de Pernambuco; Orientador: Maria Aparecida da Gloria Faustino;

Maria Aparecida da gloria Faustino

INFECÇÕES FÚNGICAS E BACTERIANAS EM CÃES NATURALMENT INFECTADOS COM LEISHMANIA CHAGASI; 2001; 0 f; Iniciação Científica; (Graduando em Medicina Veterinária) - Universidade Federal Rural de Pernambuco, Conselho Nacional de Desenvolvimento Científico e Tecnológico; Orientador: Maria Aparecida da Gloria Faustino;

Leucio Câmara Alves

Intercorrencia entre agentes micóticos bacterianos parasitarios em lesoes cutaneas de caes com LVC; 2004; 70 f; Dissertação (Mestrado em Programa de Pos Graduação Em Ciencia Veterinaria) - UNIVERSIDADE FEDERAL RURAL DE PERNAMBUCO,; Coorientador: Leucio Camara Alves;

Leucio Câmara Alves

; ; 2001; Trabalho de Conclusão de Curso; (Graduação em Medicina Veterinária) - Universidade Federal Rural de Pernambuco; Orientador: Leucio Camara Alves;

Leucio Câmara Alves

LEISHMANIOSE VISCERAL CANINA; 2000; 0 f; Trabalho de Conclusão de Curso; (Graduação em Programa de Pos-graduação em Ciência Veterinária) - Universidade Federal Rural de Pernambuco; Orientador: Leucio Camara Alves;

Wayner Vieira de Souza

Desenvolvimento e avaliação de um sistema baseado em PCR tempo real para o diagnóstico da infecção por Leishmania (Leishmania) infantum; ; 2008; Tese (Doutorado em Saúde Pública) - Centro de Pesquisas Aggeu Magalhães Fiocruz,; Coorientador: Wayner Vieira de Souza;

Seção coletada automaticamente pelo Escavador

Produções bibliográficas

  • SILVA, J. L. ; OLIVEIRA, V. V. G. ; SILVA, L. A. M. T. ; SILVA, RP ; Alves, Leucio C. ; PAIVA CAVALCANTI, M ; SILVA JUNIOR, V. A. . Evaluation of Serum Biochemical Parameters, Structural Changes, Immunohistochemistry and Parasite Load in the Urinary System of Dogs Infected Naturally by Leishmania infantum. JOURNAL OF COMPARATIVE PATHOLOGY , v. 167, p. 26-31, 2019.

  • SILVA, RP ; SOUZA, V. V. A. ; Andrade, T A S ; SILVA, A. C. O. ; OLIVEIRA, G. A. ; TRAJANO-SILVA, LAYS ADRIANNE ; NAKASONE, E. K. N. ; PAIVA CAVALCANTI, M . The diagnosis of canine visceral leishmaniasis in Brazil: Confronting old problems. EXPERIMENTAL PARASITOLOGY , v. 199, p. 9-16, 2019.

  • MORAIS, NATÁLIA GOMES DE ; COSTA, THACIANNA BARRETO DA ; FERREIRA DE LIMA, LUIZ FELIPE ; BASÍLIO, DYOWANI DOS SANTOS ; MORAIS, NADJA NARA GOMES DE ; PAIVA CAVALCANTI, MILENA DE ; PEREIRA, VALÉRIA RÊGO ALVES ; DE CASTRO, CELIA MARIA MACHADO BARBOSA . Impact of neonatal malnutrition on expression TLR-9, NF-kB and cytokines of macrophages infected in vitro with methicillin resistant Staphylococcus aureus. MICROBIAL PATHOGENESIS , v. 132, p. 254-260, 2019.

  • GONÇALVES DE ALBUQUERQUE, SUÊNIA DA CUNHA ; OLIVEIRA, C. N. C. ; VAITKEVICIUS-ANTAO, V. ; SILVA, A. C. ; Lorena, V. M. B. ; PAIVA CAVALCANTI, M. . Study of association of the rs2275913 IL-17A single nucleotide polymorphism and susceptibility to cutaneous leishmaniasis caused by Leishmania braziliensis. CYTOKINE , v. 123, p. 154784, 2019.

  • SANDES, JANA MESSIAS ; NASCIMENTO MOURA, DANIELLE MARIA ; DIVINA DA SILVA SANTIAGO, MOANA ; BARBOSA DE LIMA, GUSTAVO ; CABRAL FILHO, PAULO EUZÉBIO ; DA CUNHA GONÇALVES DE ALBUQUERQUE, SUÊNIA ; de Paiva Cavalcanti, Milena ; FONTES, ADRIANA ; BRESSAN QUEIROZ FIGUEIREDO, REGINA CELIA . The effects of endoplasmic reticulum stressors, tunicamycin and dithiothreitol on Trypanosoma cruzi. EXPERIMENTAL CELL RESEARCH , v. 383, p. 111560, 2019.

  • HELVECIO, ELISAMA ; ROMÃO, TATIANY PATRÍCIA ; DE CARVALHO LEANDRO, DANILO ; DE OLIVEIRA, IÊDA FERREIRA ; CAVALCANTI, ANTONIO EMANUEL HOLANDA D. ; REIMER, LISA ; de Paiva Cavalcanti, Milena ; DE OLIVEIRA, ANA PATRÍCIA SILVA ; PAIVA, PATRÍCIA MARIA GUEDES ; NAPOLEÃO, THIAGO HENRIQUE ; WALLAU, GABRIEL LUZ ; DE -MELO-NETO, OSVALDO P. ; DE MELO SANTOS, MARIA ALICE VARJAL ; AYRES, CONSTÂNCIA FLÁVIA JUNQUEIRA . Polymorphisms in GSTE2 is associated with temephos resistance in Aedes aegypti. PESTICIDE BIOCHEMISTRY AND PHYSIOLOGY , v. xx, p. xx-xx, 2019.

  • TRAJANO-SILVA, LAYS ADRIANNE MENDONÇA ; PESSOA-E-SILVA, RÔMULO ; GONÇALVES-DE-ALBUQUERQUE, SUÊNIA DA CUNHA ; MORAIS, RAYANA CARLA SILVA DE ; COSTA-OLIVEIRA, CÍNTIA NASCIMENTO DA ; GOES, TAYNÁ CORREIA DE ; Paiva-Cavalcanti, Milena de . Standardization and evaluation of a duplex real-time quantitative PCR for the detection of Leishmania infantum DNA: a sample quality control approach. Revista da Sociedade Brasileira de Medicina Tropical , v. 50, p. 350-357, 2017.

  • GOMES DE MORAIS, NATÁLIA ; BARRETO DA COSTA, THACIANNA ; BEZERRA DE LIRA, JOANA MARIA ; DA CUNHA GONÇALVES DE ALBUQUERQUE, SUÊNIA ; ALVES PEREIRA, VALÉRIA RÊGO ; PAIVA CAVALCANTI, M ; De CASTRO, C. M. M. B. . TLR and NLRP3 inflammasome expression deregulation in macrophages of adult rats subjected to neonatal malnutrition and infected with methicillin-resistant Staphylococcus aureus. NUTRITION , v. 33, p. 174-180, 2017.

  • GONÇALVES-DE-ALBUQUERQUE, SUÊNIA DA C. ; PESSOA-E-SILVA, RÔMULO ; TRAJANO-SILVA, LAYS A. M. ; DE GOES, TAYNÁ CORREIA ; DE MORAIS, RAYANA C. S. ; DA C. OLIVEIRA, CÍNTIA N. ; DE LORENA, VIRGÍNIA M. B. ; de Paiva-Cavalcanti, Milena . The Equivocal Role of Th17 Cells and Neutrophils on Immunopathogenesis of Leishmaniasis. Frontiers in Immunology , v. 8, p. 1-11, 2017.

  • COSTA, T. B. ; MORAIS, N. G. ; PEDROSA, A. L. F. ; Gonçalves, S. C. ; CASTRO, M. C. A. B ; PEREIRA, V. R. A. ; Paiva-Cavalcanti, Milena de ; DE CASTRO, CÉLIA MARIA MACHADO BARBOSA . Neonatal malnutrition programs the oxidant function of macrophages in response to Candida albicans. Microbial Pathogenesis , v. 95, p. 68-76, 2016.

  • SILVA DE MORAIS, RAYANA CARLA ; NASCIMENTO DA COSTA OLIVEIRA, CINTIA ; DA CUNHA GONÇALVES DE ALBUQUERQUE, SUÊNIA ; MENDONÇA TRAJANO SILVA, LAYS ADRIANNE ; PESSOA-E-SILVA, RÔMULO ; ALVES DA CRUZ, HEIDI LACERDA ; Felinto de Brito, Maria Edileuza ; de Paiva Cavalcanti, Milena . Real-time PCR for Leishmania species identification: Evaluation and comparison with classical techniques. Experimental Parasitology , v. 165, p. 43-50, 2016.

  • SILVA, RP ; SILVA, L. A. M. T. ; SILVA, M. A. L. ; Gonçalves, S. C. ; GOES, T. C. ; Morais, R C S ; Melo, F. L. ; Paiva-Cavalcanti, Milena . Evaluation of urine for Leishmania infantum DNA detection by real-time quantitative PCR. Journal of Microbiological Methods , v. 131, p. 34-41, 2016.

  • DA C. GONÇALVES-DE-ALBUQUERQUE, SUÊNIA ; PESSOA-E-SILVA, RÔMULO ; TRAJANO-SILVA, LAYS A. M. ; DE MORAIS, RAYANA C. S. ; Brandão-Filho, Sinval P. ; de Paiva-Cavalcanti, Milena . Inclusion of Quality Controls on Leishmaniases Molecular Tests to Increase Diagnostic Accuracy in Research and Reference Laboratories. Molecular Biotechnology , v. 57, p. 318-324, 2015.

  • de Paiva-Cavalcanti, Milena ; DE MORAIS, RAYANA CARLA SILVA ; PESSOA-E-SILVA, RÔMULO ; TRAJANO-SILVA, LAYS ADRIANNE MENDONÇA ; GONÇALVES-DE-ALBUQUERQUE, SUÊNIA DA CUNHA ; TAVARES, DIEGO DE HOLLANDA CAVALCANTI ; BRELAZ-DE-CASTRO, MARIA CAROLINA ACCIOLY ; SILVA, RAFAEL DE FREITAS E ; PEREIRA, VALÉRIA RÊGO ALVES . Leishmaniases diagnosis: an update on the use of immunological and molecular tools. CELL BIOSCI , v. 5, p. 1-10, 2015.

  • DE MORAIS, NATÁLIA GOMES ; DA COSTA, THACIANNA BARRETO ; PEDROSA, AMANDA LÚCIA FARIAS ; DE CASTRO, MARIA CAROLINA ACCIOLY BRELAZ ; DA GONÇALVES DE ALBUQUERQUE, SUÊNIA CUNHA ; PEREIRA, VALÉRIA RÊGO ALVES ; de Paiva Cavalcanti, Milena ; DE CASTRO, CÉLIA MARIA MACHADO BARBOSA . Effect of neonatal malnutrition on expression of nitric oxide synthase enzyme, production of free radicals and in vitro viability of alveolar macrophages infected with methicillin-sensitive and methicillin-resistant Staphylococcus aureus. European Journal of Nutrition (Print) , v. 55, p. 403-411, 2015.

  • DA COSTA, THACIANNA BARRETO ; DE MORAIS, NATÁLIA GOMES ; DE LIRA, JOANA MARIA BEZERRA ; DE ALMEIDA, THAYS MIRANDA ; GONÇALVES-DE-ALBUQUERQUE, SUÊNIA DA CUNHA ; PEREIRA, VALÉRIA RÊGO ALVES ; PAIVA CAVALCANTI, M ; De CASTRO, C. M. M. B. . Relation between neonatal malnutrition and gene expression: inflammasome function in infections caused by Candida Albicans. European Journal of Nutrition (Print) , v. 1, p. 1-12, 2015.

  • GONÇALVES-DE-ALBUQUERQUE, SUÊNIA DA ; E SILVA, RÔMULO PESSOA ; DE MORAIS, RAYANA CARLA ; TRAJANO-SILVA, LAYS ADRIANNE ; RÉGIS-DA-SILVA, CARLOS GUSTAVO ; BRANDÃO-FILHO, SINVAL PINTO ; de Paiva-Cavalcanti, Milena . Tracking false-negative results in molecular diagnosis: proposal of a triplex-PCR based method for leishmaniasis diagnosis. The Journal of Venomous Animals and Toxins Including Tropical Diseases (Online) , v. 20, p. 16-30, 2014.

  • Morais, R C S ; Gonçalves, S. C. ; Costa, PL ; Gaudêncio, K. ; Silva, F. J. ; SILVA, RP ; BRITO, M. E. F. ; BRANDÃO-FILHO, S. P. ; TORRES, Filipe Dantas ; Paiva-Cavalcanti, Milena . Detection of Leishmania infantum in animals and their ectoparasites by conventional PCR and real time PCR. Experimental & Applied Acarology (Dordrecht. Online) , v. 59, p. 473-481, 2013.

  • Paiva-Cavalcanti, Milena ; Dantas-Torres, Filipe ; Gonçalves, S. C. ; MORAIS, R. C. S. ; BRITO, M. E. F. ; Otranto, Domenico ; BRANDÃO-FILHO, S. P. . Quantitative real time PCR assays for the detection of Leishmania (Viannia) braziliensis in animals and humans. Molecular and Cellular Probes , v. 27, p. 122-128, 2013.

  • MORAIS, RAYANA CARLA SILVA DE ; GONÇALVES, SUÊNIA DA CUNHA ; SILVA, RÔMULO PESSOA E ; COSTA, PIETRA LEMOS ; SILVA, KAMILA GAUDÊNCIO DA ; SILVA, FERNANDO JOSÉ DA ; BRANDÃO-FILHO, SINVAL PINTO ; Dantas-Torres, Filipe ; de Paiva-Cavalcanti, Milena . Detection and quantification of Leishmania braziliensis in ectoparasites from dogs. Veterinary Parasitology (Print) , v. 196, p. 506-508, 2013.

  • Gonçalves, S. C. ; Regis da Silva, C. G. ; BRITO, M. E. F. ; Brandão-Filho, S. ; Paiva-Cavalcanti, Milena . APPLICATION OF THE MAMMALIAN GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE GENE FOR SAMPLE QUALITY CONTROL IN MULTIPLEX PCR FOR DIAGNOSIS OF LEISHMANIASIS. The Journal of Venomous Animals and Toxins Including Tropical Diseases (Online) , v. 18, p. 188-197, 2012.

  • BRITO, M. E. F. ; ANDRADE, Maria Sandra ; TORRES, Filipe Dantas ; Rodrigues, E.H.G. ; PAIVA CAVALCANTI, M ; ALMEIDA, Alzira Paiva de ; Brandão Filho, Sinval Pinto ; BRANDÃO-FILHO, S. P. . Cutaneous leishmaniasis in northeastern Brazil: a critical appraisal of studies conducted in State of Pernambuco. Revista da Sociedade Brasileira de Medicina Tropical (Impresso) , v. 45, p. 1-4, 2012.

  • Dantas-Torres, Filipe ; SOLLANO-GALEGO, L. ; BANETH, G. ; RIBEIRO, V. M. ; PAIVA CAVALCANTI, M ; OTRANTO, D. . Canine leishmaniosis in the Old and New Worlds: unveiled similarities and differences. Trends in Parasitology , v. 28, p. 531-538, 2012.

  • FEGUEREDO, L. A. ; Paiva-Cavalcanti, Milena ; Almeida, E. L. ; BRANDÃO-FILHO, S. P. ; Dantas-Torres, Filipe . Clinical and hematological findings in Leishmania braziliensis-infected dogs from Pernambuco, Brazil. Revista Brasileira de Parasitologia Veterinária (Online) , v. 21, p. 418-420, 2012.

  • Dantas-Torres, Filipe ; Lorusso, Vincenzo ; Testini, Gabriella ; Paiva-Cavalcanti, Milena ; Figueredo, Luciana A. ; Stanneck, Dorothee ; Mencke, Norbert ; Brandão-Filho, Sinval P. ; Alves, Leucio C. ; Otranto, Domenico . Detection of Leishmania infantum in Rhipicephalus sanguineus ticks from Brazil and Italy. Parasitology Research , v. 106, p. 857-860, 2010.

  • Dantas-Torres, Filipe ; Martins, Thiago F. ; Paiva-Cavalcanti, Milena de ; Figueredo, Luciana A. ; Lima, Bruna S. ; Brandão-Filho, Sinval P. . Transovarial passage of Leishmania infantum kDNA in artificially infected Rhipicephalus sanguineus. Experimental Parasitology , v. 125, p. 184-185, 2010.

  • Dantas-Torres, Filipe ; PAIVA CAVALCANTI, M ; Figueredo, Luciana A. ; Melo, Marcela F. ; da Silva, Fernando J. ; da Silva, Amílton L. ; Almeida, Ericka L. ; Brandão-Filho, Sinval P. . Cutaneous and visceral leishmaniosis in dogs from a rural community in northeastern Brazil. Veterinary Parasitology (Print) , p. 313-317, 2010.

  • PAIVA CAVALCANTI, M. ; SILVA, P. S. ; BRITO, M. E. F. ; Brandão-Filho, S. . Gestão de Qualidade: Implementação do Serviço de Referência em Leishmanioses de Pernambuco-Brasil. Revista de Patologia Tropical (Impresso) , v. 39, p. 151-156, 2010.

  • PAIVA CAVALCANTI, M. ; Regis da Silva, C. G. ; GOMES, Y. M. . Comparison of real-time PCR and conventional PCR for detection of Leishmania (Leishmania) infantum infection: an overview. The Journal of Venomous Animals and Toxins Including Tropical Diseases (Online) , v. 16, p. 537-542, 2010.

  • de Paiva Cavalcanti, Milena ; Felinto de Brito, Maria Edileuza ; de Souza, Wayner Vieira ; de Miranda Gomes, Yara ; Abath, Frederico G.C. . The development of a real-time PCR assay for the quantification of Leishmania infantum DNA in canine blood. VETERINARY JOURNAL , v. 182, p. 356-358, 2009.

  • PAIVA CAVALCANTI, M. ; Lorena, V. M. B. ; GOMES, Y. M. . Avanços Biotecnológicos para o Diagnóstico das Doenças Infecciosas e Parasitárias. Revista de Patologia Tropical (Impresso) , v. 37, p. 1-14, 2008.

  • LIRA, R. A. ; PAIVA CAVALCANTI, M ; SILVA, E. D. ; FERREIRA, A. G. P. ; ALVES, L. C. ; NAKAZAWA, M. ; ABATH, F. G. C. ; GOMES, Y. M. . Canine Visceral Leishmaniosis: A Comparative Analysis of the EIE-Leishmaniose-Visceral-Canina-Bio-Manguinhos and the IFI-Leishmaniose-Visceral-Canina-Bio-Manguinhos Kits. Veterinary Parasitology, 2006.

  • BRITO, S. S. ; PAIVA CAVALCANTI, M ; FAUSTINO, M. A. G. ; RAMOS, C. A. N. ; ALVES, L. C. . Otite Parasitária em bovinos na Estação Experimental Jõao Pessoa (EEJP) - EMEPA - Paraíba. Ciência Veterinária nos Trópicos , v. 8, p. 84/1,2,3-87, 2005.

  • PAIVA CAVALCANTI, M ; FAUSTINO, M. A. G. ; SILVA, L. B. G. ; ALVES, L. C. . Aspectos Clínicos das Dermatopatias Infecciosas e Parasitárias em cães com diagnóstico presuntivo de leishmaniose visceral. Clínica Veterinária (São Paulo) , Nacional, v. anoX, n.58, p. 36-42, 2005.

  • PAIVA CAVALCANTI, M ; FAUSTINO, M. A. G. ; GOMES FILHO, J. B. ; ALVES, L. C. . Freqüência de Dermatófitos e fungos saprófitas em caninos e felinos com sintomatologia sugestiva de dermatopatia micótica atendidos no Hospital Veterinário da UFRPE. Clínica Veterinária (São Paulo) , nacional, v. 43, p. 24-28, 2003.

  • PAIVA CAVALCANTI, M ; FAUSTINO, M. A. G. ; GOMES FILHO, J. B. ; ALVES, L. C. . Otomicose canina por Aspergillus sp. - Relato de caso. A Hora Veterinária , Porto Alegre, v. 23, n.134, p. 25-25, 2003.

  • PAIVA CAVALCANTI, M ; ALVES, L. C. ; BORBA, M. A. C. ; FAUSTINO, M. A. G. ; MOTTA, R. A. ; SILVA, L. B. G. . Infecções micóticas e bacterianas em lesões cutâneas de cães naturalmente infectados com Leishmania chagasi. Ciência Animal , Fortaleza - Ceará, v. 11, n.1, p. 281-281, 2001.

Seção coletada automaticamente pelo Escavador

Outras produções

DEPAIVACAVALCANTI, M . Consultor Ad Hoc FAPEMIG. 2017.

PAIVA CAVALCANTI, M. . Gestora- Fiscal técnica - Diagnóstico da Covid-19 FIOCRUZ. 2020.

Paiva-Cavalcanti, Milena ; BRITO, M. E. F. ; Brandão-Filho, S. . População de ectoparasitos em animais domésticos e sua relação com a epidemiologia das leishmanioses no Estado de Pernambuco - Resultados parciais (Igarassu).. 2011.

Paiva-Cavalcanti, Milena ; BRITO, M. E. F. ; Brandão-Filho, S. . População de ectoparasitos em animais domésticos e sua relação com a epidemiologia das leishmanioses no Estado de Pernambuco- Resultados parciais (Passira). 2011.

PAIVA CAVALCANTI, M . Parecer Técnico para a FAPEMIG. 2010.

PAIVA CAVALCANTI, M ; Brandão-Filho, S. ; BRITO, M. E. F. ; Almeida, E. L. ; Soares, F. C. ; Rodrigues, E. H. ; Júnior, J. F. M. . POP-Procedimentos operacionais padrão. 2010.

PAIVA CAVALCANTI, M ; BRITO, M. E. F. ; Brandão-Filho, S. . POPs- Procedimentos Operacionais Padrão. 2008.

SANTOS, E. S. C. ; MONTENEGRO, M. M. ; PAIVA CAVALCANTI, M . Bula do BioKit de coleta ELISA S7. 2004.

PAIVA CAVALCANTI, M . NETV. 2009. (Programa de rádio ou TV/Entrevista).

PAIVA CAVALCANTI, M ; SOUZA, C. V. . Programa AlÔ Saúde. 2004. (Programa de rádio ou TV/Entrevista).

PAIVA CAVALCANTI, M. . RELATÓRIO FINAL DE PESQUISA PROEP-FIOCRUZ-CPqAM APQ-1558-2.13/15. 2019. (Relatório de pesquisa).

Paiva-Cavalcanti, Milena ; PEREIRA, V. R. A. . Tropical Diseases: An overview of major diseases occurring in the Americas. 2017. (Editoração/Livro).

Paiva-Cavalcanti, Milena . Relatório Final: DESENVOLVIMENTO DE FERRAMENTAS MOLECULARES BASEADAS EM MULTIPLEX PCR PARA INCLUSÃO DE CONTROLES DE QUALIDADE AMOSTRAL NO DIAGNÓSTICO DAS LEISHMANIOSES.. 2017. (Relatório de pesquisa).

Paiva-Cavalcanti, Milena . Relatório UNIVERSAL 2014. 2017. (Relatório de pesquisa).

Paiva-Cavalcanti, Milena . Relatório Parcial - Seminário de Avaliação PPSUS. 2015. (Relatório de pesquisa).

PEREIRA, V. R. A. ; PAIVA CAVALCANTI, M. . Professora colaboradora da Disciplina de Pós-Graduação: Imunologia aplicada ao estudo e desenvolvimento de fármacos. 2013. (Curso de curta duração ministrado/Outra).

PAIVA CAVALCANTI, M. ; BRITO, M. E. F. ; Brandão-Filho, S. . População de ectoparasitos em animais domésticos e sua relação com a epidemiologia das leishmanioses no município de Passira-PE. 2012. (Relatório de pesquisa).

PAIVA CAVALCANTI, M . I Curso de PCR como ferramenta molecular para o diagnóstico das Parasitoses. 2011. (Curso de curta duração ministrado/Outra).

Melo, F. L. ; Paiva-Cavalcanti, Milena . Oficina: Uso do PCR no diagnóstico da esquistossomose, leishmaniose e filariose. 2010. (Curso de curta duração ministrado/Outra).

Andrade, T A S ; PAIVA CAVALCANTI, M . POPULAÇÃO DE ECTOPARASITOS EM ANIMAIS DOMÉSTICOS E SUA RELAÇÃO COM A EPIDEMIOLOGIA DAS LEISHMANIOSES NO DISTRITO DE TRÊS LADEIRAS ? IGARASSU/PE. 2010. (Relatório de pesquisa).

Imprensa CPqAM ; Brandão-Filho, S. ; BRITO, M. E. F. ; PAIVA CAVALCANTI, M . Serviço de Referência Regional em Leishmanioses CPqAM/FIOCRUZ. 2009. (Desenvolvimento de material didático ou instrucional - Folder).

Imprensa CPqAM ; Brandão-Filho, S. ; BRITO, M. E. F. ; PAIVA CAVALCANTI, M . Leishmanioses. 2008. (Desenvolvimento de material didático ou instrucional - Folheto).

PAIVA CAVALCANTI, M ; BRITO, M. E. F. ; Brandão-Filho, S. . Procedimento operacional padrão. 2008. (Procedimentos).

PAIVA CAVALCANTI, M ; Melo, F. L. ; FERRAZ, C. ; BALBINO, W. ; TORRES, F. D. . Biologia Molecular Aplicada à Parasitologia. 2007. (Curso de curta duração ministrado/Outra).

Seção coletada automaticamente pelo Escavador

Projetos de pesquisa

  • 2020 - Atual

    TÍTULO DO ANTEPROJETO: CARACTERIZAÇÃO METABÓLICA in vitro DOS EFEITOS DA INFECÇÃO POR Trypanosoma cruzi EM ADIPÓCITOS HUMANOS MEDIANTE O TRATAMENTO COM BENZNIDAZOL, Projeto certificado pelo(a) coordenador(a) Virginia Maria Barros de Lorena em 04/03/2020., Descrição: O Benznidazol é o fármaco preconizado para o tratamento da doença de Chagas no Brasil. No entanto, na fase crônica da doença, este fármaco apresenta eficácia limitada, a qual é evidenciada por meio da ausência de cura parasitológica. Além disso, pouco se sabe acerca dos mecanismos farmacocinéticos e dinâmicos da droga em questão, apesar desta ser usada como tratamento há mais de 40 anos. Sabendo-se da hipótese que o Tecido Adiposo (TA) funciona como reservatório do Trypanosoma cruzi, este fato pode estar relacionado às falhas terapêuticas. O metabolismo de adipócitos inclui não somente a manutenção dos níveis de ácidos graxos, mas a produção de fatores bioativos, como as adipocinas. Essas proteínas apresentam diversas funções, tais como atuação na resistência à insulina, homeostase energética, angiogênese, lipólise, crescimento celular e proteção cardiovascular. Além disso, proteínas morfogenéticas ósseas podem ser expressas no TA, contribuindo para a diferenciação e desenvolvimento de pré-adipócitos. Uma vez que ainda não está claro como o parasito consegue manter a infecção por tanto tempo, fugindo da resposta imune, e qual a influência do TA nesta dinâmica; associando-se ao conhecimento de que o TA é um órgão endócrino e imune em adição ao princípio de que, para se obter a cura do paciente, é necessário ocorrer o sinergismo entre a resposta imunológica do indivíduo e ação do fármaco, faz-se necessário entender os mecanismos imunes exercidos pelo TA humano infectado com T. cruzi frente ao tratamento com Benznidazol.. , Situação: Em andamento; Natureza: Pesquisa. , Alunos envolvidos: Doutorado: (2) . , Integrantes: Milena de Paiva Cavalcanti - Integrante / Virgínia Maria Barros de Lorena - Coordenador.

  • 2020 - Atual

    Doença de Chagas no estado de Pernambuco: uma abordagem diagnóstica e de tipagem molecular de Trypanosoma cruzi., Projeto certificado pelo(a) coordenador(a) Virginia Maria Barros de Lorena em 03/03/2020., Descrição: A doença de Chagas (DC) é uma condição negligenciada causada pelo protozoário Trypanosoma cruzi (T. cruzi), subdividido em sete discrete typing units (DTUs), que representam diferenças quanto à distribuição geográfica, grau de patogenia e susceptibilidade/resistência ao tratamento etiológico. A doença apresenta duas fases, aguda e crônica, e o diagnóstico realiza-se por meio de técnicas diretas e sorológicas, respectivamente às fases. Contudo, há dificuldade na confirmação sorológica de casos inconclusivos/discordantes. Para conclusão destes, a Reação em Cadeia da Polimerase (PCR) é recomendada pelo II Consenso Brasileiro em Doença de Chagas. Em continuidade a linha de pesquisa iniciada em 2018, no qual o sistema de primers para PCR em tempo real (qPCR) TcSAT-IAM (alvo DNA satélite) foi desenvolvido, e por não se dispor na rotina laboratorial de um método molecular validado que possa vir a ser utilizado para o diagnóstico da fase crônica da doença e acompanhamento de indivíduos que recebem o tratamento etiológico, mostra-se de grande importância a busca pela validação desta ferramenta diagnóstica. Recentemente ocorreu no município de Ibirimim, no sertão pernambucano, o primeiro surto da DC no estado. O TcSAT-IAM foi aplicado para auxílio no diagnóstico dos casos decorrentes do surto e para o acompanhamento da evolução clínico-terapêutica dos pacientes. No presente estudo propõe-se a validação da técnica molecular para a detecção do DNA de T. cruzi em amostras de pacientes crônicos da doença de Chagas, bem como a tipagem das DTUs circulantes no estado de Pernambuco por meio da realização de uma qPCR multiplex, de modo que tais informações possam servir para maior entendimento da ocorrência de determinadas DTUs relacionando à evolução clínico-terapêutica, permitindo tanto explorar melhor as características relacionadas ao prognóstico e tratamento desta enfermidade referente a aspectos do parasito, quanto a atualizar dados epidemiológicos acerca da DC.. , Situação: Em andamento; Natureza: Pesquisa. , Alunos envolvidos: Mestrado acadêmico: (1) Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Integrante / Virgínia Maria Barros de Lorena - Coordenador., Número de orientações: 1

  • 2020 - Atual

    Avaliação de bioativos da microalga Chlorella vulgaris para cicatrização de lesões decorrentes de Leishmaniose Tegumentar Americana, Descrição: Apesar de muitos medicamentos e/ou compostos terem sido testados para o tratamento da leishmaniose, poucos progressos foram feitos no sentido de desenvolvimento. No entanto, bioativos naturais obtidos a partir de micro-organismos fotossintetizantes, como os extratos brutos e/ou metabólitos isolados oriundos desses poderiam atuar na inibição do crescimento de Leishmania sp. e na cicatrização das lesões, sem induzir importantes efeitos citotóxicos em células do hospedeiro. Estudos prévios têm demonstrado que cianobactérias e macroalgas (algas marinhas) inibem o crescimento de Leishmania sp. em condições in vitro sendo considerado uma potencial ferramenta para a prospecção de novas alternativas de tratamento (BALUNAS et al., 2010; BALUNAS et al., 2012; FREILE-PELEGRIN et al., 2008; LININGTON et al., 2008). As microalgas apresentam potencial atrativo para indústria farmacêutica, cosmética e nutricional (GIL-CHÀVEZ et al., 2013; WANG et al., 2015). A microalga é facilmente cultivável, necessitando de nutrientes sem custo e/ou de custo reduzido, como CO2, água, sais minerais e luz, para a produção da biomassa, possui alta taxa de crescimento, menor ocupação de terra e consumo de água, evidenciando que as microalgas têm muitas vantagens sobre o cultivo de outros organismos (CHISTI, 2007, 2008). As diferentes vias metabólicas ativadas, como estratégias de defesa por cada espécie de microalga, explicam sua imensa diversidade em termos de composição estrutural e química (MORAIS et al., 2015). Dentre as espécies de microalgas, destaca-se a Chlorella vulgaris devido a sua propriedade de produzir diferentes bioativos com ação antimicrobiana, antioxidantes, antiviral, antitumoral, imunomoduladora, anti-inflamatória e cicatrizante (MELO et al., 2019; SAEIDNIA et al., 2009; UMA et al., 2011; YADAVALLI et al., 2018). Considerando a necessidade de novos produtos com atividade cicatrizante e antiparasitária, essa proposta tem a finalidade de produzir a partir de Chlorella vulgaris substâncias ativas biologicamente contra as três espécies mais prevalentes no Brasil: L. braziliensis, espécie de maior importância epidemiológica, devido sua ampla distribuição em todas as áreas onde a LTA é endêmica; L. guyanensis, com grande importância no Norte do país; L. amazonensis, responsável pela forma grave e rara da LTA, apresentando resistência à terapia convencional. Outra perspectiva é a inclusão de medicamentos adjuvantes aos já disponíveis no mercado, visto que existe a resistência por algumas espécies, efeitos adversos e longo período de tratamento com os medicamentos atuais.. , Situação: Em andamento; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (1) / Mestrado acadêmico: (2) / Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Raquel Pedrosa Bezerra - Integrante.

  • 2018 - 2020

    Desenvolvimento de um diagnóstico molecular para a doença de Chagas., Projeto certificado pelo(a) coordenador(a) Virginia Maria Barros de Lorena em 04/06/2019., Descrição: A doença de Chagas é uma doença negligenciada com elevada carga de morbimortalidade, causada pelo protozoário Trypanosoma cruzi (T. cruzi) e acomete indivíduos em todo o mundo. O diagnóstico etiológico realiza-se através da detecção de formas tripomastigotas no sangue do indivíduo ou através de métodos imunológicos pela detecção de anticorpos específicos, nas fases aguda e crônica, respectivamente. Porém, apesar dos avanços, ainda há dificuldade na confirmação sorológica de casos inconclusivos ou discordantes. Para confirmação do diagnóstico, o Ministério da Saúde recomenda a Reação em Cadeia Polimerase (PCR). Contudo não existe uma PCR, seja qualitativa ou quantitativa, padronizada e validada nacionalmente. Diversos grupos de pesquisa têm avaliado a PCR, que apresenta altas sensibilidade e especificidade na amplificação de sequências tanto de DNA do cinetoplasto (kDNA), quanto DNA nuclear (SAT-DNA) de T. cruzi. Estudos preliminares utilizando os sistemas de primers TCZ e/ou Cruzi, ambos para o SAT-DNA, demonstram que estes poderiam ser eficazes para diagnosticar indivíduos suspeitos de infecção chagásica. Assim, propõem-se o desenvolvimento e avaliação de uma metodologia diagnóstica baseada em PCR em tempo real para detecção de DNA de T. cruzi, visando sua implementação no Serviço de Referência em Doença de Chagas (SRDC) do Instituto Aggeu Magalhães (IAM), Fundação Oswaldo Cruz (FIOCRUZ). Para tanto, com auxílio do software Mega7, realizou-se o alinhamento múltiplo das sequências do kDNA e do SAT-DNA de T. cruzi no intuito de identificar potenciais regiões alvo. Por meio do Basic Local Alignment Search Tool nucleotide (BLASTn) foram realizadas avaliações de especificidade, análises da conservação, cobertura e identidade das sequências. Para o desenho dos primers o software Primer BLAST foi utilizado. Ensaios moleculares para padronizar as condições de reação dos primers foram realizados, tanto com os sistemas desenvolvidos neste estudo quanto para àqueles preditos na literatura. Os sistemas TcB (F-5?AGGCATTGGTCTGAGTTGTGT3? e R-5?ACACCAATACCTACCACCACTT3?) e CzB (F-5?AGGTGGGGGTTCGATTGG3? e R-5?CCTACCACCACTTAAATACAG3?) foram desenhados para detecção do kDNA e, para o SAT-DNA, o sistema TcSAT (F-5?AAATTCCTCCAAGCAGCGGA3? e R-5?ATGAATGGCGGGAGTCAGAG3?) foi criado. Após análises, os sistemas TcSAT e Cruzi apresentaram limite de detecção de 1fg de DNA de T. cruzi, não apresentando amplificação para o DNA de outros tripanossomatídeos, e foram escolhidos para seguir à próxima fase, de testes em amostras, esperando-se o alcance de um sistema sensível e específico na detecção do DNA de T. cruzi em amostras de portadores da infecção de Chagas.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Mestrado acadêmico: (1) . , Integrantes: Milena de Paiva Cavalcanti - Integrante / Virgínia Maria Barros de Lorena - Coordenador., Número de produções C, T & A: 1 / Número de orientações: 1

  • 2018 - Atual

    Imunologia aplicada ao desenvolvimento de novas estratégias de controle para as leishmanioses, Descrição: Com base na premissa de que uma vacina eficaz associada a um bom esquema terapêutico é a única estratégia para o real controle das leishmanioses; este projeto visa a busca por estes dois pilares aplicados à quebra do ciclo de transmissão e melhorias na assistência à população afetada. Estudos prévios do grupo identificaram vários antígenos promissores para ensaios vacinais e terapêuticos, os quais demonstraram uma reversão da resposta de perfil Th2 em Th1, sugerindo uma atividade imunomoduladora. Em relação à terapia atual, os dados prévios de acompanhamento dos pacientes demonstraram diversos cenários, tais como, cura parasitológica e permanência da lesão; cura clínica com aumento de carga parasitária; permanência da lesão com diminuição ou aumento da carga parasitária. Estes resultados reforçam a necessidade da busca por terapias que relacionem a complexidade das leishmanioses bem como, a resposta imune dos pacientes, uma vez que, para o sucesso terapêutico, acredita-se que exista uma dependência das alterações na resposta imune do hospedeiro frente ao parasito. Neste contexto, a busca por medicamentos moduladores de resposta imune, a serem aplicados de forma aditiva ou substituta à terapia atual, é urgente e necessária. Espera-se com esta pesquisa, avaliar o perfil de resposta imune celular induzida por novos compostos/fármacos e/ou medicamentos com conhecida atividade imunomoduladora e antígenos de Leishmania spp., em pacientes com leishmanioses e cães com e sem Leishmaniose Visceral (LV). Após a triagem diagnóstica, as amostras serão classificadas em grupos para análise por meio do cultivo celular com os diferentes estímulos e análises do perfil de resposta imune por PCR em tempo real, citometria de fluxo e ELISA. Espera-se obter subsídios científicos que direcionem estudos para o desenvolvimento de vacinas (proteicas e/ou DNA) e/ou formulações medicamentosas, com aplicações para a Saúde Pública, objetivando a promoção de melhorias na terapêutica da população afetada, aliadas à interrupção do ciclo de transmissão por meio da imunização do principal reservatório doméstico para a LV, os cães.. , Situação: Em andamento; Natureza: Pesquisa. , Alunos envolvidos: Mestrado acadêmico: (2) Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / LEUCIO CÂMARA ALVES - Integrante / Osvaldo Pompílio de Melo Neto - Integrante / Virgínia Maria Barros de Lorena - Integrante / Regina Bressan - Integrante / Paulo Sergio Ramos de Araújo - Integrante / Franklin Barbalho Magalhães - Integrante / Vera Lúcia de Menezes - Integrante / Ronaldo Nascimento de Oliveira - Integrante., Número de produções C, T & A: 3 / Número de orientações: 4

  • 2015 - 2019

    Ensaios de multiplex PCR em tempo real (TaqMan probe) para identificação de Leishmania spp. relacionadas com a etiologia da leishmaniose tegumentar Americana, Descrição: Em continuidade a linha de pesquisa iniciada em 2012; onde os resultados obtidos demostraram que a qPCR, através da Tm, é uma ferramenta útil para o direcionamento da espécie do parasito presente na amostra em análise; estamos propondo verificar o uso da tecnologia TaqMan probe através de um sistema de qPCR-multiplex para diferenciar Leishmania spp. envolvidas com a forma clínica mais disseminada da doença (LT); utilizando diferentes sistemas e sondas específicas para cada espécie alvo. As espécies de interesse para este estudo são: L. (V.) braziliensis, por ser a espécie de maior importância epidemiológica, devido sua ampla distribuição em todas as áreas onde a LTA é endêmica, além de sua importância clínica, uma vez que esta é responsável pelos casos de leishmaniose mucocutânea; L. (L.) amazonensis, responsável pela leishmaniose difusa, sendo a forma mais grave e rara da LT, e por apresentar resistência ao tratamento; L. (V.) shawi, responsável pela forma mais simples e freqüente, a leishmaniose cutânea localizada. A perspectiva de utilização de qPCR-multiplex em serviços considerados de referência, pode superar as expectativas de um diagnóstico, que além de seguro, rápido, sensível, específico, com habilidade quantitativa, ainda será capaz de caracterizar a espécie existente na amostra, o que pode ser fundamental para contribuir com estudos futuros relacionados ao desenvolvimento de novos fármacos para terapia e prevenção. Além da possibilidade de acompanhamento dos pacientes, através da informação de carga parasitária e correlação com a evolução clínica em resposta ao tratamento com o antimonial, fármaco de primeira escolha, ou com Amphotericina B, usado como segunda alternativa, em ocorrência de resistência.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (1) / Mestrado acadêmico: (1) / Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Maria edileuza Felinto de Brito - Integrante / Sinval Pinto Brandão Filho - Integrante., Financiador(es): Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco - Auxílio financeiro.Número de orientações: 5

  • 2015 - Atual

    Avaliação da resposta imune celular em cães frente a novos antígenos (quimeras) de Leishmania spp., Descrição: As leishmanioses encontram-se como doenças endêmicas, negligenciadas, com surtos epidêmicos sendo relatados em diversas cidades, posicionando o Brasil como o principal responsável pelos casos registrados na América Latina com 26.008 casos/ano, número superior aos registrados em outros países Latinos. A multiplicidade de fatores envolvidos na transmissão e diagnóstico das leishmanioses constitui-se em dificuldades para se formular estratégias eficientes de controle. Avanços científicos importantes têm sido apresentados em relação ao tratamento, diagnóstico e prevenção destas enfermidades; no entanto, a eficácia destas estratégias ainda é insuficiente e os índices de morbidade e mortalidade em todo o mundo mostram uma tendência crescente e preocupante. Autores ressaltam que o desenvolvimento de uma vacina segura e acessível, parece oferecer a única e verdadeira alternativa para o controle das leishmanioses. Neste contexto, para obter uma resposta imune protetora, o entendimento da imunogenética das leishmanioses é essencial. De um modo geral, o quadro clínico e a resposta imune são semelhantes quando comparamos cães e humanos. O passo fundamental na geração de imunidade anti-Leishmania é a manutenção da proporção de células T CD4+ e T CD8+, que culmina na secreção de diferentes citocinas necessárias para a imunomodulação e a resistência. A susceptibilidade envolve a participação da IL-10 e de células B. Apesar de válido, o paradigma Th1/Th2 é um modelo simplificado, que precisa de revisão, dado que hoje em dia existem outros subtipos celulares, como células T regulatórias e células Th17 que também parecem apresentar papel importante na susceptibilidade e resistência às leishmanioses. Estudos recentes relatam que pesquisas para aplicação clínica de uma vacina segura e eficaz contra as leishmanioses permanecem em situação crítica, sendo a combinação de diferentes antígenos parasitários uma alternativa para ajudar a obter uma vacina com as características adequadas de proteção. Neste sentido, o sucesso destes estudos está cada vez mais dependente da construção de subunidades imunogênicas. Para suprir esta lacuna científica, pesquisadores do CPqAM/FIOCRUZ-PE e do CPqGM/FIOCRUZ-BA, identificaram vários antígenos de L. infantum com grande potencial para utilização no diagnóstico das formas humana e canina da LV. Boa parte destes antígenos se caracteriza por possuir regiões ricas em motivos repetitivos, de tamanho e número de repetições variados, sendo a maioria incluída em um pedido de patente submetido ao INPI pela FIOCRUZ (número de registro ? PI0900961-2; data de depósito ? 23/03/2009). Os resultados obtidos com os novos antígenos nativos mostraram boa resposta antigênica contra soros de cães, algumas atingindo mais de 90% de sensibilidade, o que os torna promissores também, para utilização em estudos na área da vacinologia. Diante dos bons resultados, os pesquisadores do Grupo de Pesquisas de Biologia Molecular de Tripanossomatídeos, do Departamento de Microbiologia do CPqAM/FIOCRUZ-PE trabalharam na reconstrução dos melhores antígenos recombinantes em proteínas quiméricas, constituídas pelas regiões antigênicas das melhores proteínas testadas isoladamente; as quais estão sendo avaliadas quanto a sua sensibilidade e especificidade em diferentes populações humanas e caninas expostas a LV no Brasil. Desta forma, espera-se com esta pesquisa, avaliar a resposta imune celular de cães positivos para as diferentes formas clínicas das leishmanioses, frente às proteínas quiméricas desenvolvidas no CPqAM/FIOCRUZ-PE, para obtenção de subsídios científicos que direcionem estudos para o desenvolvimento de vacinas, com aplicações para a Saúde Pública, objetivando a promoção de melhorias na qualidade de vida da população afetada, aliadas ao bem estar animal.. , Situação: Em andamento; Natureza: Pesquisa. , Alunos envolvidos: Mestrado acadêmico: (1) Doutorado: (2) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Osvaldo Pompílio de Melo Neto - Integrante / Virgínia Maria Barros de Lorena - Integrante / Franklin Barbalho Magalhães - Integrante / Danielle Maria Nascimento Moura - Integrante., Número de orientações: 1

  • 2014 - 2019

    Caracterização da resposta imune celular à infecção por Leishmania (Viannia) braziliensis na presença de variações genéticas no gene da IL-17, Descrição: A leishmaniose tegumentar Americana (LTA) pertence a um complexo de doenças parasitárias causadas por protozoários do gênero Leishmania, transmitidas ao homem por picadas de insetos conhecidos como flebotomíneos. A infecção por L. (V.) braziliensis frequentemente apresenta lesões cutâneas expansivas e persistentes, com tendência a produzir metástases na mucosa nasal em alguns casos. Os linfócitos T são decisivos na resposta imune do hospedeiro na LTA, podendo levar à cura espontânea ou persistência da infecção com o consequente agravamento das lesões. Apesar de válido em vários aspectos, o paradigma do balanceamento entre os perfis celulares Th1/Th2 é um modelo simplificado, que precisa de revisão. Tipos celulares recentemente identificados, como as células Th17, demonstram ter grande influência no desenvolvimento de resistência ou susceptibilidade. No entanto, algumas questões acerca das funções das células Th17 humanas e da IL-17 nas infecções, ainda não estão completamente elucidadas. Estudos genéticos têm relatado associações entre polimorfismos em genes de citocinas e susceptibilidade a muitas doenças infecciosas em seres humanos. Neste sentido, estes mediadores tornaram-se importantes alvos de investigação. Diversos estudos de variantes do gene IL-17 e sua relação com doenças têm sido realizados desde a identificação das células Th17. O SNP -197 G/A está localizado na região promotora do gene influenciando na regulação de sua expressão, e tem sido associado à maior susceptibilidade a doenças inflamatórias. Esta proposta, portanto, tem como objetivo caracterizar a resposta imune celular à infecção por L. (V.) braziliensis na presença do polimorfismo -197 G/A no gene da interleucina 17 e sua associação com resistência e susceptibilidade à LTA. A melhor compreensão da influência dos níveis de IL-17 na geração e regulação da resposta imune celular poderá proporcionar subsídios para o direcionamento de pesquisas e desenvolvimento de imunoterápicos e imunoprofiláticos. A associação da função imunológica desta citocina, e sua relação com o SNP -197 G/A poderá contribuir para a validação de novos marcadores prognósticos, permitindo melhor avaliação das populações expostas. Os resultados obtidos poderão contribuir para o planejamento estratégico de ações de saúde pública, possibilitando futuros estudos farmacogenéticos para otimização da terapêutica e consequentemente, para o melhor controle da LTA.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (1) / Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Maria edileuza Felinto de Brito - Integrante / Virgínia Maria Barros de Lorena - Integrante., Financiador(es): Fundação Oswaldo Cruz - Auxílio financeiro / Conselho Nacional de Desenvolvimento Científico e Tecnológico - Auxílio financeiro., Número de produções C, T & A: 2 / Número de orientações: 3

  • 2013 - 2015

    Avaliação da técnica de PCR em tempo real para o diagnóstico da leishmaniose visceral em amostras de urina, Descrição: Para auxiliar na redução do número de casos da leishmaniose visceral (LV), a forma mais grave dentre as leishmanioses, é de fundamental importância que se faça a detecção precoce e a rápida implementação do tratamento. Um direcionamento das medidas de controle, baseando-se em dados epidemiológicos acurados, também deve ser realizado. Entretanto, os métodos convencionais de diagnóstico utilizados apresentam limitações. Neste contexto, a biologia molecular tem se tornado cada vez mais relevante, com desenvolvimento de técnicas moleculares, em destaque à Reação em Cadeia da Polimerase (PCR). A PCR quantitativa em tempo real (qPCR) é um método mais sensível, específico e que traz maior segurança e praticidade, possuindo ainda capacidade de quantificação do DNA do agente etiológico. Essas técnicas possibilitam a detecção do material genético do parasito a partir de variadas amostras biológicas. Entretanto, a obtenção de espécimes como biópsia de medula óssea e sangue oferecem riscos ao paciente e ao profissional que efetua a coleta e/ou análise laboratorial. Portanto, um crescente interesse na utilização de amostras não invasivas e seguras, como a urina, tem surgido. Desta forma, este projeto tem o objetivo de avaliar a urina como amostra biológica para o diagnóstico da LV, utilizando a qPCR como ferramenta diagnóstica. Espera-se obter resultados que possibilitem implementar uma ferramenta diagnóstica confiável para os hospitais de referência em leishmanioses, credenciados ao Sistema Único de Saúde (SUS), que proporcione conforto ao paciente e também praticidade e segurança ao profissional de saúde, e que possa contribuir com a redução dos casos de LV a partir do diagnóstico precoce de indivíduos doentes e/ou potencialmente reservatórios, além do acompanhamento de pacientes positivos e prevenção de recidivas.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (1) / Mestrado acadêmico: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Zulma Maria de Medeiros - Integrante / Sinval Pinto Brandão Filho - Integrante., Financiador(es): Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco - Auxílio financeiro / Fundação Oswaldo Cruz - Bolsa / Conselho Nacional de Desenvolvimento Científico e Tecnológico - Auxílio financeiro., Número de produções C, T & A: 2 / Número de orientações: 1

  • 2012 - 2015

    Avaliação da aplicabilidade da técnica de PCR em tempo real para caracterização de espécies de Leishmania spp., Descrição: A Leishmaniose Tegumentar Americana (LTA) é causada por protozoários, do gênero Leishmania, envolvidos em um complexo ciclo biológico. No Brasil, sete espécies estão envolvidas com a etiologia da doença, distribuídas em todas as regiões geográficas e responsáveis por diferentes manifestações clínicas. Diante disso, o diagnóstico em conjunto com a identificação da espécie é de grande importância clínico-terapêutica. Este trabalho tem por objetivo avaliar a aplicabilidade da técnica de PCR quantitativa em tempo real (qPCR) para identificação de espécies de Leishmania envolvidas com a etiologia da LTA. Foram realizados ensaios de qPCR para padronização da Temperatura de melting (Tm) utilizando cepas de referência de diferentes espécies de Leishmania. Após o diagnóstico em amostras de sangue de animais domésticos utilizando a qPCR, as amostras positivas foram analisadas através de suas Tm, e os produtos de qPCR foram purificados e sequenciados. Dez amostras previamente caracterizadas por isoenzimas, também foram analisadas através da Tm. Ainda como teste de referência, foi padronizada uma Restriction Fragment Length Polymorphism (RFLP) utilizando as cepas de referência. Através da padronização da Tm das espécies, foram criados dois intervalos de análise: 1 (Tm = 78-79,99°C), que compreende: Leishmania (V.) braziliensis, Leishmania (V.) panamensis, Leishmania (V.) lainsoni, Leishmania (V.) guyanensis e Leishmania (V.) shawi; e 2 (Tm = 80-82,2°C), que compreende: Leishmania (V.) naiffi, Leishmania (L.) amazonensis e Leishmania (L.) mexicana. Um total de 223 amostras positivas foram analisadas, destas, 58 incluídas no intervalo 1 e 165 no intervalo 2. O sequencimento de 94 destas amostras foi correspondente à L. (V.) braziliensis, L. (V.) panamensis e L. (V.) guyanensis. A análise da Tm das amostras caracterizadas por isoenzimas demonstrou 80% de concordância (p = 0,6499) entre o padrão-ouro (isoenzimas) e os intervalos desenvolvidos neste estudo. Os resultados do sequenciamento foram concordantes com a qPCR em 43,62% das amostras. A RFLP e qPCR tiveram 27,74% de concordância. Análise estatística mostrou que a qPCR e sequenciamento são testes sem diferenças estatísticas significantes (p = 0,2566). Sendo assim, é possível concluir que a Tm da qPCR pode ser utilizada como um método para direcionamento da espécie de Leishmania presente na amostra em análise, sendo necessário a realização de métodos clássicos de caracterização, quando a precisão na identificação do parasito for crucial para implementação do tratamento, como em casos de resistência e/ou recidiva da doença. A utilização desta tecnologia pode ser ainda mais precisa quando for utilizada a metodologia com sondas desenhadas para cada espécie de Leishmania, sendo necessários estudos futuros para comprovar esta perspectiva.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Mestrado acadêmico: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Maria edileuza Felinto de Brito - Integrante / Sinval Pinto Brandão Filho - Integrante., Financiador(es): Fundação Oswaldo Cruz PE - Auxílio financeiro., Número de produções C, T & A: 5 / Número de orientações: 1

  • 2010 - 2018

    Desenvolvimento de ferramentas moleculares com aplicação do gene G3PD de mamíferos como controle de qualidade amostral para o diagnóstico das leishmanioses., Descrição: O Brasil é atualmente o principal responsável pelos casos de leishmaniose registrados na América Latina; apesar disso, as leishmanioses encontram-se como doenças endêmicas negligenciadas com surtos epidêmicos sendo relatados em diversas cidades, especialmente na região Nordeste, onde estão 48% dos casos. A doença constitui-se em importante problema de saúde pública, cuja letalidade pode alcançar 10% quando não instituído o tratamento adequado. O diagnóstico e a terapia precoce são decisivos para o indivíduo e de suma importância para a comunidade, uma vez que pacientes infectados podem atuar como reservatórios e contribuir para a transmissão da doença. Diante do exposto, métodos moleculares de diagnóstico como a PCR, têm sido aprimorados para produzir resultados confiáveis em curto espaço de tempo, tornando-se indiscutivelmente vantajosos em relação às técnicas convencionalmente usadas. Os avanços na tecnologia da PCR promoveram o surgimento da PCR em tempo real (qPCR), que possibilita estudos quantitativos, levando a diagnósticos ainda mais precisos. Nesse contexto, objetiva-se padronizar uma PCR multiplex e qPCR multiplex, usando controles de qualidade da reação e do método de extração (gene G3PD de mamíferos e plasmídeo pUC 18, respectivamente) de modo a proporcionar o máximo de confiabilidade aos resultados em curto espaço de tempo, com redução dos custos com reagentes e fornecimento de alta tecnologia em diagnóstico, com viabilidade de aplicação nas rotinas dos Serviços de Referência e em estudos epidemiológicos.. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (3) / Mestrado acadêmico: (2) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Maria edileuza Felinto de Brito - Integrante / Sinval Pinto Brandão-Filho - Integrante / Carlos Gustavo Regis da Silva - Integrante / Suênia da cunha Gonçalves - Integrante / Rayana Carla Silva de Morais - Integrante / Rômulo Pessoa e Silva - Integrante / Lays Adrianne Mendonça Trajano Silva - Integrante., Financiador(es): Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa / Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Bolsa / Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco - Bolsa / Fundação Oswaldo Cruz - Auxílio financeiro / Centro de Pesquisas Aggeu Magalhães - Auxílio financeiro., Número de produções C, T & A: 36 / Número de orientações: 8

  • 2010 - 2013

    População de ectoparasitos em animais domésticos e sua relação com a epidemiologia das leishmanioses em Pernambuco, Descrição: As leishmanioses são um complexo de doenças parasitárias de caráter zoonótico causadas por diferentes espécies de protozoários tripanosomatideos. São consideradas como sério problema de saúde pública, estando dentre as seis mais importantes doenças infecciosas no mundo. Apresentam distribuição cosmopolita, estando ausente unicamente na Antártida. Na América Latina, o Brasil é o principal responsável pelos casos notificados. A principal forma de transmissão da leishmaniose visceral (LV) e da leishmaniose tegumentar Americana (LTA), em seus ciclos naturais, é a vetorial. No Novo Mundo, os insetos vetores são dípteros, fêmeas, do gênero Lutzomyia. No entanto, frente a algumas evidências científicas já comprovadas, alguns autores acreditam que, na ausência destes vetores, existe a possibilidade de outros ectoparasitos do cão como Rhipicephalus sanguineus, Ctenocephalides canis e Ctenocephalides felis, serem possíveis transmissores da LV. Em relação à LTA, as pesquisas ainda estão insipientes. Sendo assim, mediante a importância destas enfermidades no âmbito da saúde pública, das evidências epidemiológicas e experimentais da participação de outros ectoparasitos na sua cadeia de transmissão e, o complexo ciclo que envolve um conjunto de interações entre protozoários, seus hospedeiros reservatórios e vetores, os quais podem variar de região para região, estudos são necessários para um melhor entendimento da epidemiologia das leishmanioses para que assim, possamos inserir medidas mais eficazes no programa de controle em todo Estado de Pernambuco. Em conjunto com o projeto ?Desenvolvimento de ferramentas moleculares com aplicação do gene G3PD de mamíferos como controle de qualidade amostral para o diagnóstico das leishmanioses? aprovado para financiamento pelo PAPES VI-FIOCRUZ/2011, foi desenvolvido e validado um novo sistema diagnóstico para a análise molecular por meio de PCR em tempo real e quantificação da carga parasitária de Leishmania Viannia braziliensis; durante o. , Situação: Concluído; Natureza: Pesquisa. , Alunos envolvidos: Graduação: (2) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Felipe Dantas Torres - Integrante / Luciana Aguiar Fegueredo - Integrante / Sinval Pinto Brandão-Filho - Integrante / Suênia da cunha Gonçalves - Integrante / Rayana Carla Silva de Morais - Integrante / Rômulo Pessoa e Silva - Integrante / Lays Adrianne Mendonça Trajano Silva - Integrante., Financiador(es): Centro de Pesquisas Aggeu Magalhães - Auxílio financeiro / Conselho Nacional de Desenvolvimento Científico e Tecnológico - Auxílio financeiro / Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco - Bolsa / Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Bolsa., Número de produções C, T & A: 5 / Número de orientações: 3

Seção coletada automaticamente pelo Escavador

Projetos de desenvolvimento

  • 2005 - 2008

    Desenvolvimento e avaliação de PCR em tempo real para o diagnóstico da leishmaniose visceral em cães, Descrição: O diagnóstico precoce da leishmaniose visceral (LV) é importante para evitar danos severos que podem levar o paciente à morte. Neste contexto, os métodos convencionais apresentam limitações, existindo a necessidade de se desenvolver uma ferramenta que seja capaz de promover um diagnóstico acurado. Assim, há cerca de dez anos, os métodos moleculares vêm sendo desenvolvidos com destaque para a tecnologia da reação em cadeia da polimerase (PCR). A alta sensibilidade e especificidade, a habilidade de detectar e identificar o protozoário envolvido, e o fato de poder ser aplicada diretamente em amostras clínicas, produzindo um resultado confiável dentro de poucas horas, são vantagens indiscutíveis da PCR em relação aos métodos de diagnóstico tradicionais. Recentemente, a PCR apresentou um significativo avanço em sua tecnologia; é a PCR quantitativa em tempo real (qPCR), capaz de promover a quantificação acurada e o monitoramento, em tempo real, do produto amplificado. Objetivou-se desenvolver e avaliar um sistema baseado em qPCR para o diagnóstico da infecção por Leishmania infantum, bem como efetuar uma análise comparativa com a PCR convencional utilizada no Serviço de Referência em Leishmanioses de Pernambuco, visando a possibilidade de implantação nas rotinas de diagnóstico para LV. Com base na seqüência NCBI Z35273.1 de L. infantum disponível no BLAST-NCBI foram desenhados primers específicos para o complexo L. donovani. A combinação dos primers gerou sistemas de detecção, os processos de otimização efetuados no ABI PRISM 7000 (Applied Biosystems) resultaram nas seguintes condições de ciclagem: 95 C/15s, 60 C/1 min. Foi utilizado como padrão, 2 μl de DNA genômico de L. chagasi (MHOM/BR/1974/PP75) e controle negativo (amostra sem DNA); para um volume final de 50 μl foram adicionados 3 pmoles de cada primer e 25 μl de SYBR Green Master Mix (Applied Biosystems). Todas as amostras foram produzidas em duplicata, a reação foi efetuada com 40 ciclos. A curva-p. , Situação: Concluído; Natureza: Desenvolvimento. , Alunos envolvidos: Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Yara de Miranda Gomes - Integrante / Frederico Guilherme Coutinho Abath - Integrante / Wayne Vieira Souza - Integrante., Financiador(es): Centro de Pesquisas Aggeu Magalhães - Auxílio financeiro / Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa., Número de produções C, T & A: 9

  • 2005 - 2008

    Desenvolvimento e avaliação de PCR em tempo real para o diagnóstico da leishmaniose visceral em cães, Descrição: O diagnóstico precoce da leishmaniose visceral (LV) é importante para evitar danos severos que podem levar o paciente à morte. Neste contexto, os métodos convencionais apresentam limitações, existindo a necessidade de se desenvolver uma ferramenta que seja capaz de promover um diagnóstico acurado. Assim, há cerca de dez anos, os métodos moleculares vêm sendo desenvolvidos com destaque para a tecnologia da reação em cadeia da polimerase (PCR). A alta sensibilidade e especificidade, a habilidade de detectar e identificar o protozoário envolvido, e o fato de poder ser aplicada diretamente em amostras clínicas, produzindo um resultado confiável dentro de poucas horas, são vantagens indiscutíveis da PCR em relação aos métodos de diagnóstico tradicionais. Recentemente, a PCR apresentou um significativo avanço em sua tecnologia; é a PCR quantitativa em tempo real (qPCR), capaz de promover a quantificação acurada e o monitoramento, em tempo real, do produto amplificado. Objetivou-se desenvolver e avaliar um sistema baseado em qPCR para o diagnóstico da infecção por Leishmania infantum, bem como efetuar uma análise comparativa com a PCR convencional utilizada no Serviço de Referência em Leishmanioses de Pernambuco, visando a possibilidade de implantação nas rotinas de diagnóstico para LV. Com base na seqüência NCBI Z35273.1 de L. infantum disponível no BLAST-NCBI foram desenhados primers específicos para o complexo L. donovani. A combinação dos primers gerou sistemas de detecção, os processos de otimização efetuados no ABI PRISM 7000 (Applied Biosystems) resultaram nas seguintes condições de ciclagem: 95 C/15s, 60 C/1 min. Foi utilizado como padrão, 2 μl de DNA genômico de L. chagasi (MHOM/BR/1974/PP75) e controle negativo (amostra sem DNA); para um volume final de 50 μl foram adicionados 3 pmoles de cada primer e 25 μl de SYBR Green Master Mix (Applied Biosystems). Todas as amostras foram produzidas em duplicata, a reação foi efetuada com 40 ciclos. A curva-p. , Situação: Concluído; Natureza: Desenvolvimento. , Alunos envolvidos: Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Yara de Miranda Gomes - Integrante / Frederico Guilherme Coutinho Abath - Integrante / Wayne Vieira Souza - Integrante., Financiador(es): Centro de Pesquisas Aggeu Magalhães - Auxílio financeiro / Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa., Número de produções C, T & A: 9

  • 2005 - 2008

    Desenvolvimento e avaliação de PCR em tempo real para o diagnóstico da leishmaniose visceral em cães, Descrição: O diagnóstico precoce da leishmaniose visceral (LV) é importante para evitar danos severos que podem levar o paciente à morte. Neste contexto, os métodos convencionais apresentam limitações, existindo a necessidade de se desenvolver uma ferramenta que seja capaz de promover um diagnóstico acurado. Assim, há cerca de dez anos, os métodos moleculares vêm sendo desenvolvidos com destaque para a tecnologia da reação em cadeia da polimerase (PCR). A alta sensibilidade e especificidade, a habilidade de detectar e identificar o protozoário envolvido, e o fato de poder ser aplicada diretamente em amostras clínicas, produzindo um resultado confiável dentro de poucas horas, são vantagens indiscutíveis da PCR em relação aos métodos de diagnóstico tradicionais. Recentemente, a PCR apresentou um significativo avanço em sua tecnologia; é a PCR quantitativa em tempo real (qPCR), capaz de promover a quantificação acurada e o monitoramento, em tempo real, do produto amplificado. Objetivou-se desenvolver e avaliar um sistema baseado em qPCR para o diagnóstico da infecção por Leishmania infantum, bem como efetuar uma análise comparativa com a PCR convencional utilizada no Serviço de Referência em Leishmanioses de Pernambuco, visando a possibilidade de implantação nas rotinas de diagnóstico para LV. Com base na seqüência NCBI Z35273.1 de L. infantum disponível no BLAST-NCBI foram desenhados primers específicos para o complexo L. donovani. A combinação dos primers gerou sistemas de detecção, os processos de otimização efetuados no ABI PRISM 7000 (Applied Biosystems) resultaram nas seguintes condições de ciclagem: 95 C/15s, 60 C/1 min. Foi utilizado como padrão, 2 μl de DNA genômico de L. chagasi (MHOM/BR/1974/PP75) e controle negativo (amostra sem DNA); para um volume final de 50 μl foram adicionados 3 pmoles de cada primer e 25 μl de SYBR Green Master Mix (Applied Biosystems). Todas as amostras foram produzidas em duplicata, a reação foi efetuada com 40 ciclos. A curva-p. , Situação: Concluído; Natureza: Desenvolvimento. , Alunos envolvidos: Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Yara de Miranda Gomes - Integrante / Frederico Guilherme Coutinho Abath - Integrante / Wayne Vieira Souza - Integrante., Financiador(es): Centro de Pesquisas Aggeu Magalhães - Auxílio financeiro / Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa., Número de produções C, T & A: 9

  • 2005 - 2008

    Desenvolvimento e avaliação de PCR em tempo real para o diagnóstico da leishmaniose visceral em cães, Descrição: O diagnóstico precoce da leishmaniose visceral (LV) é importante para evitar danos severos que podem levar o paciente à morte. Neste contexto, os métodos convencionais apresentam limitações, existindo a necessidade de se desenvolver uma ferramenta que seja capaz de promover um diagnóstico acurado. Assim, há cerca de dez anos, os métodos moleculares vêm sendo desenvolvidos com destaque para a tecnologia da reação em cadeia da polimerase (PCR). A alta sensibilidade e especificidade, a habilidade de detectar e identificar o protozoário envolvido, e o fato de poder ser aplicada diretamente em amostras clínicas, produzindo um resultado confiável dentro de poucas horas, são vantagens indiscutíveis da PCR em relação aos métodos de diagnóstico tradicionais. Recentemente, a PCR apresentou um significativo avanço em sua tecnologia; é a PCR quantitativa em tempo real (qPCR), capaz de promover a quantificação acurada e o monitoramento, em tempo real, do produto amplificado. Objetivou-se desenvolver e avaliar um sistema baseado em qPCR para o diagnóstico da infecção por Leishmania infantum, bem como efetuar uma análise comparativa com a PCR convencional utilizada no Serviço de Referência em Leishmanioses de Pernambuco, visando a possibilidade de implantação nas rotinas de diagnóstico para LV. Com base na seqüência NCBI Z35273.1 de L. infantum disponível no BLAST-NCBI foram desenhados primers específicos para o complexo L. donovani. A combinação dos primers gerou sistemas de detecção, os processos de otimização efetuados no ABI PRISM 7000 (Applied Biosystems) resultaram nas seguintes condições de ciclagem: 95°C/15s, 60°C/1 min. Foi utilizado como padrão, 2 μl de DNA genômico de L. chagasi (MHOM/BR/1974/PP75) e controle negativo (amostra sem DNA); para um volume final de 50 μl foram adicionados 3 pmoles de cada primer e 25 μl de SYBR Green Master Mix (Applied Biosystems). Todas as amostras foram produzidas em duplicata, a reação foi efetuada com 40 ciclos. A curva-p. , Situação: Concluído; Natureza: Desenvolvimento. , Alunos envolvidos: Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Yara de Miranda Gomes - Integrante / Frederico Guilherme Coutinho Abath - Integrante / Wayne Vieira Souza - Integrante., Financiador(es): Centro de Pesquisas Aggeu Magalhães - Auxílio financeiro / Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa., Número de produções C, T & A: 9

  • 2005 - 2008

    Desenvolvimento e avaliação de PCR em tempo real para o diagnóstico da leishmaniose visceral em cães, Descrição: O diagnóstico precoce da leishmaniose visceral (LV) é importante para evitar danos severos que podem levar o paciente à morte. Neste contexto, os métodos convencionais apresentam limitações, existindo a necessidade de se desenvolver uma ferramenta que seja capaz de promover um diagnóstico acurado. Assim, há cerca de dez anos, os métodos moleculares vêm sendo desenvolvidos com destaque para a tecnologia da reação em cadeia da polimerase (PCR). A alta sensibilidade e especificidade, a habilidade de detectar e identificar o protozoário envolvido, e o fato de poder ser aplicada diretamente em amostras clínicas, produzindo um resultado confiável dentro de poucas horas, são vantagens indiscutíveis da PCR em relação aos métodos de diagnóstico tradicionais. Recentemente, a PCR apresentou um significativo avanço em sua tecnologia; é a PCR quantitativa em tempo real (qPCR), capaz de promover a quantificação acurada e o monitoramento, em tempo real, do produto amplificado. Objetivou-se desenvolver e avaliar um sistema baseado em qPCR para o diagnóstico da infecção por Leishmania infantum, bem como efetuar uma análise comparativa com a PCR convencional utilizada no Serviço de Referência em Leishmanioses de Pernambuco, visando a possibilidade de implantação nas rotinas de diagnóstico para LV. Com base na seqüência NCBI Z35273.1 de L. infantum disponível no BLAST-NCBI foram desenhados primers específicos para o complexo L. donovani. A combinação dos primers gerou sistemas de detecção, os processos de otimização efetuados no ABI PRISM 7000 (Applied Biosystems) resultaram nas seguintes condições de ciclagem: 95°C/15s, 60°C/1 min. Foi utilizado como padrão, 2 μl de DNA genômico de L. chagasi (MHOM/BR/1974/PP75) e controle negativo (amostra sem DNA); para um volume final de 50 μl foram adicionados 3 pmoles de cada primer e 25 μl de SYBR Green Master Mix (Applied Biosystems). Todas as amostras foram produzidas em duplicata, a reação foi efetuada com 40 ciclos. A curva-p. , Situação: Concluído; Natureza: Desenvolvimento. , Alunos envolvidos: Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Yara de Miranda Gomes - Integrante / Frederico Guilherme Coutinho Abath - Integrante / Wayne Vieira Souza - Integrante., Financiador(es): Centro de Pesquisas Aggeu Magalhães - Auxílio financeiro / Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa., Número de produções C, T & A: 9

  • 2005 - 2008

    Desenvolvimento e avaliação de PCR em tempo real para o diagnóstico da leishmaniose visceral em cães, Descrição: O diagnóstico precoce da leishmaniose visceral (LV) é importante para evitar danos severos que podem levar o paciente à morte. Neste contexto, os métodos convencionais apresentam limitações, existindo a necessidade de se desenvolver uma ferramenta que seja capaz de promover um diagnóstico acurado. Assim, há cerca de dez anos, os métodos moleculares vêm sendo desenvolvidos com destaque para a tecnologia da reação em cadeia da polimerase (PCR). A alta sensibilidade e especificidade, a habilidade de detectar e identificar o protozoário envolvido, e o fato de poder ser aplicada diretamente em amostras clínicas, produzindo um resultado confiável dentro de poucas horas, são vantagens indiscutíveis da PCR em relação aos métodos de diagnóstico tradicionais. Recentemente, a PCR apresentou um significativo avanço em sua tecnologia; é a PCR quantitativa em tempo real (qPCR), capaz de promover a quantificação acurada e o monitoramento, em tempo real, do produto amplificado. Objetivou-se desenvolver e avaliar um sistema baseado em qPCR para o diagnóstico da infecção por Leishmania infantum, bem como efetuar uma análise comparativa com a PCR convencional utilizada no Serviço de Referência em Leishmanioses de Pernambuco, visando a possibilidade de implantação nas rotinas de diagnóstico para LV. Com base na seqüência NCBI Z35273.1 de L. infantum disponível no BLAST-NCBI foram desenhados primers específicos para o complexo L. donovani. A combinação dos primers gerou sistemas de detecção, os processos de otimização efetuados no ABI PRISM 7000 (Applied Biosystems) resultaram nas seguintes condições de ciclagem: 95°C/15s, 60°C/1 min. Foi utilizado como padrão, 2 μl de DNA genômico de L. chagasi (MHOM/BR/1974/PP75) e controle negativo (amostra sem DNA); para um volume final de 50 μl foram adicionados 3 pmoles de cada primer e 25 μl de SYBR Green Master Mix (Applied Biosystems). Todas as amostras foram produzidas em duplicata, a reação foi efetuada com 40 ciclos. A curva-p. , Situação: Concluído; Natureza: Desenvolvimento. , Alunos envolvidos: Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Yara de Miranda Gomes - Integrante / Frederico Guilherme Coutinho Abath - Integrante / Wayne Vieira Souza - Integrante., Financiador(es): Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa / Centro de Pesquisas Aggeu Magalhães - Auxílio financeiro., Número de produções C, T & A: 9

  • 2005 - 2008

    Desenvolvimento e avaliação de PCR em tempo real para o diagnóstico da leishmaniose visceral em cães, Descrição: O diagnóstico precoce da leishmaniose visceral (LV) é importante para evitar danos severos que podem levar o paciente à morte. Neste contexto, os métodos convencionais apresentam limitações, existindo a necessidade de se desenvolver uma ferramenta que seja capaz de promover um diagnóstico acurado. Assim, há cerca de dez anos, os métodos moleculares vêm sendo desenvolvidos com destaque para a tecnologia da reação em cadeia da polimerase (PCR). A alta sensibilidade e especificidade, a habilidade de detectar e identificar o protozoário envolvido, e o fato de poder ser aplicada diretamente em amostras clínicas, produzindo um resultado confiável dentro de poucas horas, são vantagens indiscutíveis da PCR em relação aos métodos de diagnóstico tradicionais. Recentemente, a PCR apresentou um significativo avanço em sua tecnologia; é a PCR quantitativa em tempo real (qPCR), capaz de promover a quantificação acurada e o monitoramento, em tempo real, do produto amplificado. Objetivou-se desenvolver e avaliar um sistema baseado em qPCR para o diagnóstico da infecção por Leishmania infantum, bem como efetuar uma análise comparativa com a PCR convencional utilizada no Serviço de Referência em Leishmanioses de Pernambuco, visando a possibilidade de implantação nas rotinas de diagnóstico para LV. Com base na seqüência NCBI Z35273.1 de L. infantum disponível no BLAST-NCBI foram desenhados primers específicos para o complexo L. donovani. A combinação dos primers gerou sistemas de detecção, os processos de otimização efetuados no ABI PRISM 7000 (Applied Biosystems) resultaram nas seguintes condições de ciclagem: 95°C/15s, 60°C/1 min. Foi utilizado como padrão, 2 μl de DNA genômico de L. chagasi (MHOM/BR/1974/PP75) e controle negativo (amostra sem DNA); para um volume final de 50 μl foram adicionados 3 pmoles de cada primer e 25 μl de SYBR Green Master Mix (Applied Biosystems). Todas as amostras foram produzidas em duplicata, a reação foi efetuada com 40 ciclos. A curva-p. , Situação: Concluído; Natureza: Desenvolvimento. , Alunos envolvidos: Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Yara de Miranda Gomes - Integrante / Frederico Guilherme Coutinho Abath - Integrante / Wayne Vieira Souza - Integrante., Financiador(es): Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa / Centro de Pesquisas Aggeu Magalhães - Auxílio financeiro., Número de produções C, T & A: 9

  • 2005 - 2008

    Desenvolvimento e avaliação de PCR em tempo real para o diagnóstico da leishmaniose visceral em cães, Descrição: O diagnóstico precoce da leishmaniose visceral (LV) é importante para evitar danos severos que podem levar o paciente à morte. Neste contexto, os métodos convencionais apresentam limitações, existindo a necessidade de se desenvolver uma ferramenta que seja capaz de promover um diagnóstico acurado. Assim, há cerca de dez anos, os métodos moleculares vêm sendo desenvolvidos com destaque para a tecnologia da reação em cadeia da polimerase (PCR). A alta sensibilidade e especificidade, a habilidade de detectar e identificar o protozoário envolvido, e o fato de poder ser aplicada diretamente em amostras clínicas, produzindo um resultado confiável dentro de poucas horas, são vantagens indiscutíveis da PCR em relação aos métodos de diagnóstico tradicionais. Recentemente, a PCR apresentou um significativo avanço em sua tecnologia; é a PCR quantitativa em tempo real (qPCR), capaz de promover a quantificação acurada e o monitoramento, em tempo real, do produto amplificado. Objetivou-se desenvolver e avaliar um sistema baseado em qPCR para o diagnóstico da infecção por Leishmania infantum, bem como efetuar uma análise comparativa com a PCR convencional utilizada no Serviço de Referência em Leishmanioses de Pernambuco, visando a possibilidade de implantação nas rotinas de diagnóstico para LV. Com base na seqüência NCBI Z35273.1 de L. infantum disponível no BLAST-NCBI foram desenhados primers específicos para o complexo L. donovani. A combinação dos primers gerou sistemas de detecção, os processos de otimização efetuados no ABI PRISM 7000 (Applied Biosystems) resultaram nas seguintes condições de ciclagem: 95°C/15s, 60°C/1 min. Foi utilizado como padrão, 2 μl de DNA genômico de L. chagasi (MHOM/BR/1974/PP75) e controle negativo (amostra sem DNA); para um volume final de 50 μl foram adicionados 3 pmoles de cada primer e 25 μl de SYBR Green Master Mix (Applied Biosystems). Todas as amostras foram produzidas em duplicata, a reação foi efetuada com 40 ciclos. A curva-p. , Situação: Concluído; Natureza: Desenvolvimento. , Alunos envolvidos: Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Yara de Miranda Gomes - Integrante / Frederico Guilherme Coutinho Abath - Integrante / Wayne Vieira Souza - Integrante., Financiador(es): Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa / Centro de Pesquisas Aggeu Magalhães - Auxílio financeiro., Número de produções C, T & A: 9

  • 2005 - 2008

    Desenvolvimento e avaliação de PCR em tempo real para o diagnóstico da leishmaniose visceral em cães, Descrição: O diagnóstico precoce da leishmaniose visceral (LV) é importante para evitar danos severos que podem levar o paciente à morte. Neste contexto, os métodos convencionais apresentam limitações, existindo a necessidade de se desenvolver uma ferramenta que seja capaz de promover um diagnóstico acurado. Assim, há cerca de dez anos, os métodos moleculares vêm sendo desenvolvidos com destaque para a tecnologia da reação em cadeia da polimerase (PCR). A alta sensibilidade e especificidade, a habilidade de detectar e identificar o protozoário envolvido, e o fato de poder ser aplicada diretamente em amostras clínicas, produzindo um resultado confiável dentro de poucas horas, são vantagens indiscutíveis da PCR em relação aos métodos de diagnóstico tradicionais. Recentemente, a PCR apresentou um significativo avanço em sua tecnologia; é a PCR quantitativa em tempo real (qPCR), capaz de promover a quantificação acurada e o monitoramento, em tempo real, do produto amplificado. Objetivou-se desenvolver e avaliar um sistema baseado em qPCR para o diagnóstico da infecção por Leishmania infantum, bem como efetuar uma análise comparativa com a PCR convencional utilizada no Serviço de Referência em Leishmanioses de Pernambuco, visando a possibilidade de implantação nas rotinas de diagnóstico para LV. Com base na seqüência NCBI Z35273.1 de L. infantum disponível no BLAST-NCBI foram desenhados primers específicos para o complexo L. donovani. A combinação dos primers gerou sistemas de detecção, os processos de otimização efetuados no ABI PRISM 7000 (Applied Biosystems) resultaram nas seguintes condições de ciclagem: 95°C/15s, 60°C/1 min. Foi utilizado como padrão, 2 μl de DNA genômico de L. chagasi (MHOM/BR/1974/PP75) e controle negativo (amostra sem DNA); para um volume final de 50 μl foram adicionados 3 pmoles de cada primer e 25 μl de SYBR Green Master Mix (Applied Biosystems). Todas as amostras foram produzidas em duplicata, a reação foi efetuada com 40 ciclos. A curva-p. , Situação: Concluído; Natureza: Desenvolvimento. , Alunos envolvidos: Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Yara de Miranda Gomes - Integrante / Frederico Guilherme Coutinho Abath - Integrante / Wayne Vieira Souza - Integrante., Financiador(es): Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa / Centro de Pesquisas Aggeu Magalhães - Auxílio financeiro., Número de produções C, T & A: 9

  • 2005 - 2008

    Desenvolvimento e avaliação de PCR em tempo real para o diagnóstico da leishmaniose visceral em cães, Descrição: O diagnóstico precoce da leishmaniose visceral (LV) é importante para evitar danos severos que podem levar o paciente à morte. Neste contexto, os métodos convencionais apresentam limitações, existindo a necessidade de se desenvolver uma ferramenta que seja capaz de promover um diagnóstico acurado. Assim, há cerca de dez anos, os métodos moleculares vêm sendo desenvolvidos com destaque para a tecnologia da reação em cadeia da polimerase (PCR). A alta sensibilidade e especificidade, a habilidade de detectar e identificar o protozoário envolvido, e o fato de poder ser aplicada diretamente em amostras clínicas, produzindo um resultado confiável dentro de poucas horas, são vantagens indiscutíveis da PCR em relação aos métodos de diagnóstico tradicionais. Recentemente, a PCR apresentou um significativo avanço em sua tecnologia; é a PCR quantitativa em tempo real (qPCR), capaz de promover a quantificação acurada e o monitoramento, em tempo real, do produto amplificado. Objetivou-se desenvolver e avaliar um sistema baseado em qPCR para o diagnóstico da infecção por Leishmania infantum, bem como efetuar uma análise comparativa com a PCR convencional utilizada no Serviço de Referência em Leishmanioses de Pernambuco, visando a possibilidade de implantação nas rotinas de diagnóstico para LV. Com base na seqüência NCBI Z35273.1 de L. infantum disponível no BLAST-NCBI foram desenhados primers específicos para o complexo L. donovani. A combinação dos primers gerou sistemas de detecção, os processos de otimização efetuados no ABI PRISM 7000 (Applied Biosystems) resultaram nas seguintes condições de ciclagem: 95°C/15s, 60°C/1 min. Foi utilizado como padrão, 2 μl de DNA genômico de L. chagasi (MHOM/BR/1974/PP75) e controle negativo (amostra sem DNA); para um volume final de 50 μl foram adicionados 3 pmoles de cada primer e 25 μl de SYBR Green Master Mix (Applied Biosystems). Todas as amostras foram produzidas em duplicata, a reação foi efetuada com 40 ciclos. A curva-p. , Situação: Concluído; Natureza: Desenvolvimento. , Alunos envolvidos: Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Yara de Miranda Gomes - Integrante / Frederico Guilherme Coutinho Abath - Integrante / Wayne Vieira Souza - Integrante., Financiador(es): Centro de Pesquisas Aggeu Magalhães - Auxílio financeiro / Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa., Número de produções C, T & A: 9

  • 2005 - 2008

    Desenvolvimento e avaliação de PCR em tempo real para o diagnóstico da leishmaniose visceral em cães, Descrição: O diagnóstico precoce da leishmaniose visceral (LV) é importante para evitar danos severos que podem levar o paciente à morte. Neste contexto, os métodos convencionais apresentam limitações, existindo a necessidade de se desenvolver uma ferramenta que seja capaz de promover um diagnóstico acurado. Assim, há cerca de dez anos, os métodos moleculares vêm sendo desenvolvidos com destaque para a tecnologia da reação em cadeia da polimerase (PCR). A alta sensibilidade e especificidade, a habilidade de detectar e identificar o protozoário envolvido, e o fato de poder ser aplicada diretamente em amostras clínicas, produzindo um resultado confiável dentro de poucas horas, são vantagens indiscutíveis da PCR em relação aos métodos de diagnóstico tradicionais. Recentemente, a PCR apresentou um significativo avanço em sua tecnologia; é a PCR quantitativa em tempo real (qPCR), capaz de promover a quantificação acurada e o monitoramento, em tempo real, do produto amplificado. Objetivou-se desenvolver e avaliar um sistema baseado em qPCR para o diagnóstico da infecção por Leishmania infantum, bem como efetuar uma análise comparativa com a PCR convencional utilizada no Serviço de Referência em Leishmanioses de Pernambuco, visando a possibilidade de implantação nas rotinas de diagnóstico para LV. Com base na seqüência NCBI Z35273.1 de L. infantum disponível no BLAST-NCBI foram desenhados primers específicos para o complexo L. donovani. A combinação dos primers gerou sistemas de detecção, os processos de otimização efetuados no ABI PRISM 7000 (Applied Biosystems) resultaram nas seguintes condições de ciclagem: 95°C/15s, 60°C/1 min. Foi utilizado como padrão, 2 μl de DNA genômico de L. chagasi (MHOM/BR/1974/PP75) e controle negativo (amostra sem DNA); para um volume final de 50 μl foram adicionados 3 pmoles de cada primer e 25 μl de SYBR Green Master Mix (Applied Biosystems). Todas as amostras foram produzidas em duplicata, a reação foi efetuada com 40 ciclos. A curva-p. , Situação: Concluído; Natureza: Desenvolvimento. , Alunos envolvidos: Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Yara de Miranda Gomes - Integrante / Frederico Guilherme Coutinho Abath - Integrante / Wayne Vieira Souza - Integrante., Financiador(es): Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa / Centro de Pesquisas Aggeu Magalhães - Auxílio financeiro., Número de produções C, T & A: 9

  • 2005 - 2008

    Desenvolvimento e avaliação de PCR em tempo real para o diagnóstico da leishmaniose visceral em cães, Descrição: O diagnóstico precoce da leishmaniose visceral (LV) é importante para evitar danos severos que podem levar o paciente à morte. Neste contexto, os métodos convencionais apresentam limitações, existindo a necessidade de se desenvolver uma ferramenta que seja capaz de promover um diagnóstico acurado. Assim, há cerca de dez anos, os métodos moleculares vêm sendo desenvolvidos com destaque para a tecnologia da reação em cadeia da polimerase (PCR). A alta sensibilidade e especificidade, a habilidade de detectar e identificar o protozoário envolvido, e o fato de poder ser aplicada diretamente em amostras clínicas, produzindo um resultado confiável dentro de poucas horas, são vantagens indiscutíveis da PCR em relação aos métodos de diagnóstico tradicionais. Recentemente, a PCR apresentou um significativo avanço em sua tecnologia; é a PCR quantitativa em tempo real (qPCR), capaz de promover a quantificação acurada e o monitoramento, em tempo real, do produto amplificado. Objetivou-se desenvolver e avaliar um sistema baseado em qPCR para o diagnóstico da infecção por Leishmania infantum, bem como efetuar uma análise comparativa com a PCR convencional utilizada no Serviço de Referência em Leishmanioses de Pernambuco, visando a possibilidade de implantação nas rotinas de diagnóstico para LV. Com base na seqüência NCBI Z35273.1 de L. infantum disponível no BLAST-NCBI foram desenhados primers específicos para o complexo L. donovani. A combinação dos primers gerou sistemas de detecção, os processos de otimização efetuados no ABI PRISM 7000 (Applied Biosystems) resultaram nas seguintes condições de ciclagem: 95°C/15s, 60°C/1 min. Foi utilizado como padrão, 2 μl de DNA genômico de L. chagasi (MHOM/BR/1974/PP75) e controle negativo (amostra sem DNA); para um volume final de 50 μl foram adicionados 3 pmoles de cada primer e 25 μl de SYBR Green Master Mix (Applied Biosystems). Todas as amostras foram produzidas em duplicata, a reação foi efetuada com 40 ciclos. A curva-p. , Situação: Concluído; Natureza: Desenvolvimento. , Alunos envolvidos: Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Yara de Miranda Gomes - Integrante / Frederico Guilherme Coutinho Abath - Integrante / Wayne Vieira Souza - Integrante., Financiador(es): Centro de Pesquisas Aggeu Magalhães - Auxílio financeiro / Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa., Número de produções C, T & A: 9

  • 2005 - 2008

    Desenvolvimento e avaliação de PCR em tempo real para o diagnóstico da leishmaniose visceral em cães, Descrição: O diagnóstico precoce da leishmaniose visceral (LV) é importante para evitar danos severos que podem levar o paciente à morte. Neste contexto, os métodos convencionais apresentam limitações, existindo a necessidade de se desenvolver uma ferramenta que seja capaz de promover um diagnóstico acurado. Assim, há cerca de dez anos, os métodos moleculares vêm sendo desenvolvidos com destaque para a tecnologia da reação em cadeia da polimerase (PCR). A alta sensibilidade e especificidade, a habilidade de detectar e identificar o protozoário envolvido, e o fato de poder ser aplicada diretamente em amostras clínicas, produzindo um resultado confiável dentro de poucas horas, são vantagens indiscutíveis da PCR em relação aos métodos de diagnóstico tradicionais. Recentemente, a PCR apresentou um significativo avanço em sua tecnologia; é a PCR quantitativa em tempo real (qPCR), capaz de promover a quantificação acurada e o monitoramento, em tempo real, do produto amplificado. Objetivou-se desenvolver e avaliar um sistema baseado em qPCR para o diagnóstico da infecção por Leishmania infantum, bem como efetuar uma análise comparativa com a PCR convencional utilizada no Serviço de Referência em Leishmanioses de Pernambuco, visando a possibilidade de implantação nas rotinas de diagnóstico para LV. Com base na seqüência NCBI Z35273.1 de L. infantum disponível no BLAST-NCBI foram desenhados primers específicos para o complexo L. donovani. A combinação dos primers gerou sistemas de detecção, os processos de otimização efetuados no ABI PRISM 7000 (Applied Biosystems) resultaram nas seguintes condições de ciclagem: 95°C/15s, 60°C/1 min. Foi utilizado como padrão, 2 μl de DNA genômico de L. chagasi (MHOM/BR/1974/PP75) e controle negativo (amostra sem DNA); para um volume final de 50 μl foram adicionados 3 pmoles de cada primer e 25 μl de SYBR Green Master Mix (Applied Biosystems). Todas as amostras foram produzidas em duplicata, a reação foi efetuada com 40 ciclos. A curva-p. , Situação: Concluído; Natureza: Desenvolvimento. , Alunos envolvidos: Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Yara de Miranda Gomes - Integrante / Frederico Guilherme Coutinho Abath - Integrante / Wayne Vieira Souza - Integrante., Financiador(es): Centro de Pesquisas Aggeu Magalhães - Auxílio financeiro / Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa., Número de produções C, T & A: 9

  • 2005 - 2008

    Desenvolvimento e avaliação de PCR em tempo real para o diagnóstico da leishmaniose visceral em cães, Descrição: O diagnóstico precoce da leishmaniose visceral (LV) é importante para evitar danos severos que podem levar o paciente à morte. Neste contexto, os métodos convencionais apresentam limitações, existindo a necessidade de se desenvolver uma ferramenta que seja capaz de promover um diagnóstico acurado. Assim, há cerca de dez anos, os métodos moleculares vêm sendo desenvolvidos com destaque para a tecnologia da reação em cadeia da polimerase (PCR). A alta sensibilidade e especificidade, a habilidade de detectar e identificar o protozoário envolvido, e o fato de poder ser aplicada diretamente em amostras clínicas, produzindo um resultado confiável dentro de poucas horas, são vantagens indiscutíveis da PCR em relação aos métodos de diagnóstico tradicionais. Recentemente, a PCR apresentou um significativo avanço em sua tecnologia; é a PCR quantitativa em tempo real (qPCR), capaz de promover a quantificação acurada e o monitoramento, em tempo real, do produto amplificado. Objetivou-se desenvolver e avaliar um sistema baseado em qPCR para o diagnóstico da infecção por Leishmania infantum, bem como efetuar uma análise comparativa com a PCR convencional utilizada no Serviço de Referência em Leishmanioses de Pernambuco, visando a possibilidade de implantação nas rotinas de diagnóstico para LV. Com base na seqüência NCBI Z35273.1 de L. infantum disponível no BLAST-NCBI foram desenhados primers específicos para o complexo L. donovani. A combinação dos primers gerou sistemas de detecção, os processos de otimização efetuados no ABI PRISM 7000 (Applied Biosystems) resultaram nas seguintes condições de ciclagem: 95°C/15s, 60°C/1 min. Foi utilizado como padrão, 2 μl de DNA genômico de L. chagasi (MHOM/BR/1974/PP75) e controle negativo (amostra sem DNA); para um volume final de 50 μl foram adicionados 3 pmoles de cada primer e 25 μl de SYBR Green Master Mix (Applied Biosystems). Todas as amostras foram produzidas em duplicata, a reação foi efetuada com 40 ciclos. A curva-p. , Situação: Concluído; Natureza: Desenvolvimento. , Alunos envolvidos: Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Yara de Miranda Gomes - Integrante / Frederico Guilherme Coutinho Abath - Integrante / Wayne Vieira Souza - Integrante., Financiador(es): Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa / Centro de Pesquisas Aggeu Magalhães - Auxílio financeiro., Número de produções C, T & A: 9

  • 2005 - 2008

    Desenvolvimento e avaliação de PCR em tempo real para o diagnóstico da leishmaniose visceral em cães, Descrição: O diagnóstico precoce da leishmaniose visceral (LV) é importante para evitar danos severos que podem levar o paciente à morte. Neste contexto, os métodos convencionais apresentam limitações, existindo a necessidade de se desenvolver uma ferramenta que seja capaz de promover um diagnóstico acurado. Assim, há cerca de dez anos, os métodos moleculares vêm sendo desenvolvidos com destaque para a tecnologia da reação em cadeia da polimerase (PCR). A alta sensibilidade e especificidade, a habilidade de detectar e identificar o protozoário envolvido, e o fato de poder ser aplicada diretamente em amostras clínicas, produzindo um resultado confiável dentro de poucas horas, são vantagens indiscutíveis da PCR em relação aos métodos de diagnóstico tradicionais. Recentemente, a PCR apresentou um significativo avanço em sua tecnologia; é a PCR quantitativa em tempo real (qPCR), capaz de promover a quantificação acurada e o monitoramento, em tempo real, do produto amplificado. Objetivou-se desenvolver e avaliar um sistema baseado em qPCR para o diagnóstico da infecção por Leishmania infantum, bem como efetuar uma análise comparativa com a PCR convencional utilizada no Serviço de Referência em Leishmanioses de Pernambuco, visando a possibilidade de implantação nas rotinas de diagnóstico para LV. Com base na seqüência NCBI Z35273.1 de L. infantum disponível no BLAST-NCBI foram desenhados primers específicos para o complexo L. donovani. A combinação dos primers gerou sistemas de detecção, os processos de otimização efetuados no ABI PRISM 7000 (Applied Biosystems) resultaram nas seguintes condições de ciclagem: 95°C/15s, 60°C/1 min. Foi utilizado como padrão, 2 μl de DNA genômico de L. chagasi (MHOM/BR/1974/PP75) e controle negativo (amostra sem DNA); para um volume final de 50 μl foram adicionados 3 pmoles de cada primer e 25 μl de SYBR Green Master Mix (Applied Biosystems). Todas as amostras foram produzidas em duplicata, a reação foi efetuada com 40 ciclos. A curva-p. , Situação: Concluído; Natureza: Desenvolvimento. , Alunos envolvidos: Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Yara de Miranda Gomes - Integrante / Frederico Guilherme Coutinho Abath - Integrante / Wayne Vieira Souza - Integrante., Financiador(es): Centro de Pesquisas Aggeu Magalhães - Auxílio financeiro / Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa., Número de produções C, T & A: 9

  • 2005 - 2008

    Desenvolvimento e avaliação de PCR em tempo real para o diagnóstico da leishmaniose visceral em cães, Descrição: O diagnóstico precoce da leishmaniose visceral (LV) é importante para evitar danos severos que podem levar o paciente à morte. Neste contexto, os métodos convencionais apresentam limitações, existindo a necessidade de se desenvolver uma ferramenta que seja capaz de promover um diagnóstico acurado. Assim, há cerca de dez anos, os métodos moleculares vêm sendo desenvolvidos com destaque para a tecnologia da reação em cadeia da polimerase (PCR). A alta sensibilidade e especificidade, a habilidade de detectar e identificar o protozoário envolvido, e o fato de poder ser aplicada diretamente em amostras clínicas, produzindo um resultado confiável dentro de poucas horas, são vantagens indiscutíveis da PCR em relação aos métodos de diagnóstico tradicionais. Recentemente, a PCR apresentou um significativo avanço em sua tecnologia; é a PCR quantitativa em tempo real (qPCR), capaz de promover a quantificação acurada e o monitoramento, em tempo real, do produto amplificado. Objetivou-se desenvolver e avaliar um sistema baseado em qPCR para o diagnóstico da infecção por Leishmania infantum, bem como efetuar uma análise comparativa com a PCR convencional utilizada no Serviço de Referência em Leishmanioses de Pernambuco, visando a possibilidade de implantação nas rotinas de diagnóstico para LV. Com base na seqüência NCBI Z35273.1 de L. infantum disponível no BLAST-NCBI foram desenhados primers específicos para o complexo L. donovani. A combinação dos primers gerou sistemas de detecção, os processos de otimização efetuados no ABI PRISM 7000 (Applied Biosystems) resultaram nas seguintes condições de ciclagem: 95°C/15s, 60°C/1 min. Foi utilizado como padrão, 2 μl de DNA genômico de L. chagasi (MHOM/BR/1974/PP75) e controle negativo (amostra sem DNA); para um volume final de 50 μl foram adicionados 3 pmoles de cada primer e 25 μl de SYBR Green Master Mix (Applied Biosystems). Todas as amostras foram produzidas em duplicata, a reação foi efetuada com 40 ciclos. A curva-p. , Situação: Concluído; Natureza: Desenvolvimento. , Alunos envolvidos: Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Yara de Miranda Gomes - Integrante / Frederico Guilherme Coutinho Abath - Integrante / Wayne Vieira Souza - Integrante., Financiador(es): Centro de Pesquisas Aggeu Magalhães - Auxílio financeiro / Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa., Número de produções C, T & A: 9

  • 2005 - 2008

    Desenvolvimento e avaliação de PCR em tempo real para o diagnóstico da leishmaniose visceral em cães, Descrição: O diagnóstico precoce da leishmaniose visceral (LV) é importante para evitar danos severos que podem levar o paciente à morte. Neste contexto, os métodos convencionais apresentam limitações, existindo a necessidade de se desenvolver uma ferramenta que seja capaz de promover um diagnóstico acurado. Assim, há cerca de dez anos, os métodos moleculares vêm sendo desenvolvidos com destaque para a tecnologia da reação em cadeia da polimerase (PCR). A alta sensibilidade e especificidade, a habilidade de detectar e identificar o protozoário envolvido, e o fato de poder ser aplicada diretamente em amostras clínicas, produzindo um resultado confiável dentro de poucas horas, são vantagens indiscutíveis da PCR em relação aos métodos de diagnóstico tradicionais. Recentemente, a PCR apresentou um significativo avanço em sua tecnologia; é a PCR quantitativa em tempo real (qPCR), capaz de promover a quantificação acurada e o monitoramento, em tempo real, do produto amplificado. Objetivou-se desenvolver e avaliar um sistema baseado em qPCR para o diagnóstico da infecção por Leishmania infantum, bem como efetuar uma análise comparativa com a PCR convencional utilizada no Serviço de Referência em Leishmanioses de Pernambuco, visando a possibilidade de implantação nas rotinas de diagnóstico para LV. Com base na seqüência NCBI Z35273.1 de L. infantum disponível no BLAST-NCBI foram desenhados primers específicos para o complexo L. donovani. A combinação dos primers gerou sistemas de detecção, os processos de otimização efetuados no ABI PRISM 7000 (Applied Biosystems) resultaram nas seguintes condições de ciclagem: 95°C/15s, 60°C/1 min. Foi utilizado como padrão, 2 μl de DNA genômico de L. chagasi (MHOM/BR/1974/PP75) e controle negativo (amostra sem DNA); para um volume final de 50 μl foram adicionados 3 pmoles de cada primer e 25 μl de SYBR Green Master Mix (Applied Biosystems). Todas as amostras foram produzidas em duplicata, a reação foi efetuada com 40 ciclos. A curva-p. , Situação: Concluído; Natureza: Desenvolvimento. , Alunos envolvidos: Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Yara de Miranda Gomes - Integrante / Frederico Guilherme Coutinho Abath - Integrante / Wayne Vieira Souza - Integrante., Financiador(es): Centro de Pesquisas Aggeu Magalhães - Auxílio financeiro / Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa., Número de produções C, T & A: 9

  • 2005 - 2008

    Desenvolvimento e avaliação de PCR em tempo real para o diagnóstico da leishmaniose visceral em cães, Descrição: O diagnóstico precoce da leishmaniose visceral (LV) é importante para evitar danos severos que podem levar o paciente à morte. Neste contexto, os métodos convencionais apresentam limitações, existindo a necessidade de se desenvolver uma ferramenta que seja capaz de promover um diagnóstico acurado. Assim, há cerca de dez anos, os métodos moleculares vêm sendo desenvolvidos com destaque para a tecnologia da reação em cadeia da polimerase (PCR). A alta sensibilidade e especificidade, a habilidade de detectar e identificar o protozoário envolvido, e o fato de poder ser aplicada diretamente em amostras clínicas, produzindo um resultado confiável dentro de poucas horas, são vantagens indiscutíveis da PCR em relação aos métodos de diagnóstico tradicionais. Recentemente, a PCR apresentou um significativo avanço em sua tecnologia; é a PCR quantitativa em tempo real (qPCR), capaz de promover a quantificação acurada e o monitoramento, em tempo real, do produto amplificado. Objetivou-se desenvolver e avaliar um sistema baseado em qPCR para o diagnóstico da infecção por Leishmania infantum, bem como efetuar uma análise comparativa com a PCR convencional utilizada no Serviço de Referência em Leishmanioses de Pernambuco, visando a possibilidade de implantação nas rotinas de diagnóstico para LV. Com base na seqüência NCBI Z35273.1 de L. infantum disponível no BLAST-NCBI foram desenhados primers específicos para o complexo L. donovani. A combinação dos primers gerou sistemas de detecção, os processos de otimização efetuados no ABI PRISM 7000 (Applied Biosystems) resultaram nas seguintes condições de ciclagem: 95°C/15s, 60°C/1 min. Foi utilizado como padrão, 2 μl de DNA genômico de L. chagasi (MHOM/BR/1974/PP75) e controle negativo (amostra sem DNA); para um volume final de 50 μl foram adicionados 3 pmoles de cada primer e 25 μl de SYBR Green Master Mix (Applied Biosystems). Todas as amostras foram produzidas em duplicata, a reação foi efetuada com 40 ciclos. A curva-p. , Situação: Concluído; Natureza: Desenvolvimento. , Alunos envolvidos: Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Yara de Miranda Gomes - Integrante / Frederico Guilherme Coutinho Abath - Integrante / Wayne Vieira Souza - Integrante., Financiador(es): Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa / Centro de Pesquisas Aggeu Magalhães - Auxílio financeiro., Número de produções C, T & A: 9

  • 2005 - 2008

    Desenvolvimento e avaliação de PCR em tempo real para o diagnóstico da leishmaniose visceral em cães, Descrição: O diagnóstico precoce da leishmaniose visceral (LV) é importante para evitar danos severos que podem levar o paciente à morte. Neste contexto, os métodos convencionais apresentam limitações, existindo a necessidade de se desenvolver uma ferramenta que seja capaz de promover um diagnóstico acurado. Assim, há cerca de dez anos, os métodos moleculares vêm sendo desenvolvidos com destaque para a tecnologia da reação em cadeia da polimerase (PCR). A alta sensibilidade e especificidade, a habilidade de detectar e identificar o protozoário envolvido, e o fato de poder ser aplicada diretamente em amostras clínicas, produzindo um resultado confiável dentro de poucas horas, são vantagens indiscutíveis da PCR em relação aos métodos de diagnóstico tradicionais. Recentemente, a PCR apresentou um significativo avanço em sua tecnologia; é a PCR quantitativa em tempo real (qPCR), capaz de promover a quantificação acurada e o monitoramento, em tempo real, do produto amplificado. Objetivou-se desenvolver e avaliar um sistema baseado em qPCR para o diagnóstico da infecção por Leishmania infantum, bem como efetuar uma análise comparativa com a PCR convencional utilizada no Serviço de Referência em Leishmanioses de Pernambuco, visando a possibilidade de implantação nas rotinas de diagnóstico para LV. Com base na seqüência NCBI Z35273.1 de L. infantum disponível no BLAST-NCBI foram desenhados primers específicos para o complexo L. donovani. A combinação dos primers gerou sistemas de detecção, os processos de otimização efetuados no ABI PRISM 7000 (Applied Biosystems) resultaram nas seguintes condições de ciclagem: 95°C/15s, 60°C/1 min. Foi utilizado como padrão, 2 l de DNA genômico de L. chagasi (MHOM/BR/1974/PP75) e controle negativo (amostra sem DNA); para um volume final de 50 l foram adicionados 3 pmoles de cada primer e 25 l de SYBR Green Master Mix (Applied Biosystems). Todas as amostras foram produzidas em duplicata, a reação foi efetuada com 40 ciclos. A curva-p. , Situação: Concluído; Natureza: Desenvolvimento. , Alunos envolvidos: Doutorado: (1) . , Integrantes: Milena de Paiva Cavalcanti - Coordenador / Yara de Miranda Gomes - Integrante / Frederico Guilherme Coutinho Abath - Integrante / Wayne Vieira Souza - Integrante., Financiador(es): Centro de Pesquisas Aggeu Magalhães - Auxílio financeiro / Conselho Nacional de Desenvolvimento Científico e Tecnológico - Bolsa., Número de produções C, T & A: 9

Seção coletada automaticamente pelo Escavador

Prêmios

2019

Co-Orientação do 1 Lugar (Mestrado BBS) 7 Jornada da Pós-Graduação da FIOCRUZ PE. Aluna: Cíntia Nascimento da Costa Oliveira. DIAGNÓSTICO MOLECULAR PARA CARACTERIZAÇÃO DO SURTO AGUDO DE DC, IAM FIOCRUZ-PE.

2019

Orientação do trabalho 2 lugar da categoria Poster na XIII Jornada de Medicina Tropical da UFPE - Potencial em vacinologia de Antígenos de L. infantum, UFPE.

2018

Prêmio Frederico Abath - Orientação do trabalho- 1 Lugar na RAIC 2018 Aluna: Maria Gabriella N. de Melo, IAM FIOCRUZ-PE.

2018

Menção Honrosa: Orientação do trabalho 6 lugar na RAIC. Aluno: Victor Souza, IAM FIOCRUZ-PE.

2018

Prêmio Jovem Pesquisador, 3 lugar na categoria Doutorado - Orientação da aluna Rayana Carla Silva de Morais, SBMT.

2017

Orientação do terceiro melhor trabalho apresentado na 5ª Jornada Científica da Fiocruz Pernambuco (Aluna: Lays Adrianne M. Trajano Silva), IAM FIOCRUZ-PE.

2016

Orientação da aluna Rayana Carla Silva de Morais, 2 lugar na categoria Doutorado para o Prêmio Jovem Pesquisador, Sociedade Brasileira de Medicina Tropical.

2016

Orientação do Melhor trabalho apresentado na Semana de Biociências e Biotecnologia em Saúde, IAM FIOCRUZ-Pernambuco.

2014

Orientação do Melhor trabalho apresentado na IX Semana de Medicina Tropical da UFPE, UFPE.

2014

Orientação do 5 melhor trabalho apresentado na XXII Reunião Anual de Iniciação Científica, FIOCRUZ.

2014

Menção honrosa - Trabalho apresentado na II Semana de Biociências e Biotecnologia em Saúde, CPqAM/FIOCRUZ-PE.

2012

Orientação de um dos cinco melhores trabalhos apresentados no III Congresso de Biomedicina e Farmácia, ASCES_ Associação Caruaruense de Ensino Superior.

2011

Orientação de um dos cinco melhores trabalhos de Iniciação Científica, USP.

2011

Orientação da estudante (Suênia da Cunha Gonçalves) com melhor desempenho (Mensão Honrosa) no VIII Curso de Verão em Biologia Celular e Molecular, USP.

2008

Ph.D em Saúde Pública, FIOCRUZ.

2004

Mestre em Ciência Veterinária, UFRPE.

2001

Honra ao Mérito Laurea Acadêmica média 9,23, UFRPE.

2001

Médica Veterinária, UFRPE.

Histórico profissional

Seção coletada automaticamente pelo Escavador

Endereço profissional

  • Centro de Pesquisas Aggeu Magalhães, Imunologia. , Av. Moraes Rego s/n, Cidade Universitária, 50670-420 - Recife, PE - Brasil - Caixa-postal: 7472, Telefone: (81) 21012679, Fax: (81) 21012640, URL da Homepage:

Seção coletada automaticamente pelo Escavador

Experiência profissional

2020 - Atual

Universidade Federal Rural de Pernambuco

Vínculo: , Enquadramento Funcional:

2018 - Atual

Fundação Osvaldo Cruz

Vínculo: , Enquadramento Funcional:

2020 - Atual

Fundação Oswaldo Cruz PE

Vínculo: Servidor Público, Enquadramento Funcional: Membro da Comissão de Ética no Uso de Animais, Carga horária: 20

2012 - Atual

Fundação Oswaldo Cruz PE

Vínculo: Servidor Público, Enquadramento Funcional: Professor Orientador no PPGBBS, Carga horária: 40

2010 - Atual

Fundação Oswaldo Cruz PE

Vínculo: Servidor Público, Enquadramento Funcional: Professor-Orientador, Carga horária: 40

2006 - Atual

Fundação Oswaldo Cruz PE

Vínculo: Servidor Público, Enquadramento Funcional: Tecnologista Pleno, Carga horária: 40

Outras informações:
Serviço de Referência em Leishmanioses- Gerente de Qualidade (até 2013). Docente do Programa de Pós-Graduação em Saúde Pública do CPqAM/FIOCRUZ. Docente do Programa de Pós-Graduação em Biociências e Biotecnologia do CPqAM/FIOCRUZ (atual)

2013 - 2015

Fundação Oswaldo Cruz PE

Vínculo: Servidor Público, Enquadramento Funcional: Coordenador de Disciplina

Outras informações:
Ferramentas moleculares e imunológicas aplicadas ao diagnóstico, epidemiologia e controle das doenças parasitárias

Atividades

  • 08/2010

    Pesquisa e desenvolvimento , CPqAM, .,Linhas de pesquisa

  • 03/2005

    Pesquisa e desenvolvimento , CPqAM, .,Linhas de pesquisa

  • 03/2005

    Pesquisa e desenvolvimento , CPqAM, .,Linhas de pesquisa

  • 10/2015 - 04/2016

    Serviços técnicos especializados , CPqAM, .,Serviço realizado, Responsabilidade técnica biotério de Animais Silvestres.

  • 03/2012 - 11/2015

    Ensino, Biociências e Biotecnologia em Saúde, Nível: Pós-Graduação,Disciplinas ministradas, Ferramentas moleculares e imunológicas aplicadas ao diagnóstico, epidemiologia e controle das doenças parasitárias

  • 03/2009 - 12/2011

    Ensino, Saúde Pública, Nível: Pós-Graduação,Disciplinas ministradas, Docente colaborador

2006 - Atual

Centro de Pesquisas Aggeu Magalhães

Vínculo: Servidor Público, Enquadramento Funcional: Tecnologista, Carga horária: 40, Regime: Dedicação exclusiva.

2005 - 2008

Centro de Pesquisas Aggeu Magalhães

Vínculo: Doutoranda, Enquadramento Funcional: Bolsista, Carga horária: 40, Regime: Dedicação exclusiva.

Atividades

  • 12/2014

    Conselhos, Comissões e Consultoria, CPqAM, .,Cargo ou função, Membro do Comitê de Ética no uso de Animais em Pesquisa - CEUA.

  • 10/2006

    Pesquisa e desenvolvimento , Imunologia, .,Linhas de pesquisa

2013 - Atual

Universidade Federal de Pernambuco

Vínculo: Professor, Enquadramento Funcional: Colaborador

Outras informações:
Professor colaborador na disciplina da Pós-Graduação em Inovação Terapêutica (PPGIT): Imunologia Aplicada ao Estudo e Desenvolvimento de Fármacos

2004 - 2005

LaborVet-Laboratório Veterinário

Vínculo: Médica Veterinária, Enquadramento Funcional: Diagnóstico laboratorial e análises clínicas, Carga horária: 20

Atividades

  • 05/2004 - 03/2005

    Serviços técnicos especializados , LaborVet, .,Serviço realizado, Exames laboratoriais, incluindo análises clínicas e exames parasitológicos das várias espécies de animais domésticos (caninos, felinos, bovinos, eqüinos, entre outros)..

2004 - 2005

Biogene Indústria e Comércio - PE

Vínculo: Médica Veterinária, Enquadramento Funcional: Responsável Técnica, Carga horária: 20

Atividades

  • 05/2004 - 03/2005

    Serviços técnicos especializados , Laboratório de Produção e Desenvolvimento, .,Serviço realizado, Médica Veterinária - Responsável técnica.