Polinucleotídeos codificadores de genes do cromosso da bactéria mycoplasma synoviae, expressão e atividade desses polinucleotídeos e suas aplicações

  • Número do pedido da patente:
  • PI 0402981-0 A2
  • Data do depósito:
  • 26/02/2004
  • Data da publicação:
  • 01/08/2006
Inventores:
  • Classificação:
  • A61P 31/04
    Antiinfecciosos, i.e. antibi?ticos, antiss?pticos, quimioterap?uticos; / Agentes antibacterianos;
    ;
    G01N 33/569
    Investiga??o ou an?lise de materiais por m?todos espec?ficos n?o abrangidos pelos grupos ; / Material biol?gico, p. ex. sangue, urina; Hemocitr?metros; / An?lise qu?mica de material biol?gico, p. ex. sangue, urina; Testes por m?todos envolvendo a forma??o liga??es bioespec?ficas de ligantes; Testes imunol?gicos; / Imuno-ensaio; Ensaios envolvendo ligantes bioespec?ficos; Materiais para os mesmos; / para micro-organismos, p. ex. protozo?rios, bact?rias, v?rus;
    ;
    C12N 15/31
    Muta??o ou engenharia gen?tica; DNA ou RNA concernentes ? engenharia gen?tica, vetores, p. ex. plasm?deos ou seu isolamento, preparação ou purifica??o; Uso de seus hospedeiros; / Tecnologia do DNA recombinante; / Fragmentos de DNA ou RNA; Suas formas modificadas; / Genes que codificam prote?nas microbianas, p. ex. enterotoxinas;
    ;
    A61K 39/02
    Prepara??es medicinais contendo ant?genos ou anticorpos; / Ant?genos bacterianos;
    ;
    C07K 14/30
    Pept?deos tendo mais de 20 amino?cidos; Gastrinas; Somatoestatinas; Melanotropinas; Derivados dos mesmos; / de bact?rias; / de Mycoplasmatales, p. ex. organismos do tipo Pleuropneumonia (PPLO);
    ;

"POLINUCLEOTÍDEOS CODIFICADORES DE GENES DO CROMOSSOMO DA BACTÉRIA MYCOPLASMA SYNOVIAE, EXPRESSÃO E ATIVIDADE DESSES POLINUCLEOTÍDEOS E SUAS APLICAÇÕES". A invenção refere-se a polinucleotídeos constituídos pelas seqüências de nucleotídeos de um grupo que consiste de: a) polinucleotídeos idênticos, com identidade de pelo menos 70%, às seqüências de nucleotídeos que codificam polipeptídeos caracterizados pelas seqüências de aminoácidos e de fragmentos das mesmas; b) polinucleotídeos idênticos, em pelo menos 70%, a polinucleotídeos que codificam os polipeptídeos correspondentes às seqüências listadas, e que podem ser isolados, preferencialmente, do cromossomo da M. synoviae 53; c) polinucleotídeos que codificam polipeptídeos caracterizados por seqüências de aminoácidos idênticas, em pelo menos 70%, às seqüências de aminoácidos; d) polinucleotídeos que são complementares aos polinucleotídeos de a, b ou c; e) polinucleotídeos compreendendo bases nucleotídicas sucessivas das sequencias de polinucleotídeos a, b ou c; f) um processo de cultivo, preferencialmente de M. synoviae 53, em que os genes codificados pelas seqüências de polinucleotídeos listadas sejam amplificados.

Página de 4

Documento

POLINUCLEOTÍDEOS CODIFICADORES DE GENES DO

CROMOSSOMO DA BACTÉRIA Mycoplasma synoviae, EXPRESSÃO E ATIVIDADE DESSES POLINUCLEOTÍDEOS E SUAS APLICAÇÕES INTRODUÇÃO

5 Micoplasmas são Eubactérias pequenas, medindo de 0,2 a 0,5 micra, com genoma reduzido e apresentando baixo percentual de G+C. Estes organismos são as menores formas de vida livre, sendo que o Mycoplasma genitalium possui o menor genoma para uma célula conhecida (580 Kbp), contendo menos de 500 ORFs (Fraser et ai, 1995). ío O Mycoplasma synoviae (MS) foi descrito originalmente por Olson et al.

. (1964) como um agente patológico causador de sinovite em aves. Atualmente, os micoplasmas patogênicos são alvo de controle rigoroso na avicultura e geralmente contemplados em programas oficiais de controle de doenças. O MS é objeto de grande preocupação por causar doença 15    endêmica qué se propaga mediante a contaminação dos ovos por

poedeiras já infectadas. Essas características determinam a permanência 1    indefinida do patógeno em uma granja e ainda potencializam os efeitos da

i    infecção nos próximos extratos ou fases da produção, caso nenhum

programa de controle seja aplicado.

20 O impacto de uma infecção por micoplasmas na criação de aves pode ser considerável, tanto na redução da produtividade quanto nas transações comerciais que possivelmente envolvam progênie oriunda de plantei . infectado, sobretudo quando se trata do comércio internacional de aves vivas ou ovos férteis. No caso de MS, este efeito é às vezes claramente 25    percebível na forma de infecção das bainhas sinoviais e sacos aéreos,

porém na maioria das vezes a infecção por MS cursa na forma de aerossaculite assintomática e a mensuração de seu impacto econômico se torna difícil. Mesmo assim, a ausência de doença franca não implica • em desobrigação quanto às penalidades previstas no Plano Nacional de 30    Sanidade Avícola (PNSA), do Ministério da Agricultura, Pecuária e

Abastecimento, que prevê a eliminação de lotes básicos (linhas puras e avós) infectados por MS e impede o comércio internacional de aves infectadas ou ovos férteis oriundos de plantéis infectados por MS. DISPONIBILIDADE DE MATERIAL BIOLÓGICO PARA REALIZAR A

INVENÇÃO

A estirpe usada para o seqüenciamento dos genes objeto desta patente é a M. synoviae 53, isolada da traquéia de uma galinha matriz de corte com 27 semanas de idade, oriunda do estado do Paraná, Brasil (Fiorentin et 5    a/., 2003).

A bactéria foi isolada no Laboratório de Sanidade da Embrapa Suínos e Aves em Concórdia, SC, no qual se mantém estocada para as multiplicações necessárias. Seu isolamento primário e identificação foi baseado em técnicas rotineiras utilizadas em micoplasmologia, como os ío cultivos em caldo e agar Frey (Frey et al, 1968), a clonagem por três vezes através de filtração em 0,45pm e a identificação sorológica do organismo através de anticorpos fluorescentes (Bradbury, 1998) e molecular através de PCR (Lauerman et al, 1993), com técnicas padronizadas com base na cepa padrão M. synoviae WVU 1853 (ATCC 15 number 25204).

DESCRIÇÃO DO MÉTODO DE OBTENÇÃO DOS POLINUCLEOTÍDEOS E POLIPEPTÍDEOS Extração do DNA genômico

O M. synoviae 53 foi cultivado em caldo Frey a 379C e centrifugado a 20    12.000 x G por 15, lavado em salina fosfatada (PBS) por três vezes

através de suspensão do pellet e centrifugação como descrito acima. O sedimento celular final foi estocado a -70QC e o DNA genômico das bactérias foi extraído pelo método usual descrito por Sambrook & Russell (2001). Neste método, a membrana celular das bactérias é dissolvida 25 pelo detergente dodecil sulfato de sódio (SDS) e as proteínas e RNAs digeridos respectivamente por proteinase K e RNAse A. O lisado é então tratado com fenol para extração das proteínas e o DNA purificado através de precipitação com etanol. Este DNA foi então testado para sua pureza em espectrometria e confirmado como DNA de MS em PCR com primers 30 específicos para a espécie. Este DNA foi então utilizado para a construção das bibliotecas de “shotgun” e de cosmídeos.

Construção de bibliotecas “shotgun”

O DNA de M. synoviae foi fragmentado por nebulização, por 40 segundos numa pressão de 5 PSIs. Os fragmentos gerados na faixa de tamanho de

• • • ••• • * • •• • • * r\ iu r\    •    •••••*••    ••

3/19    : : :*•:*: : .* •

• ••• •• • •• •••• •

2,0 a 2,5 kb, foram recuperados de gel de agarose e posteriormente tiveram suas extremidades reparadas enzimaticamente com as enzimas Klenow e T4 DNA Polimerase seguidos da fosforilação das extremidades 5’ com polinucleotídeo quinase. Após recuperação destes fragmentos a 5 partir do gel de agarose, os mesmos foram ligados ao vetor pUC18/Smal com auxílio da enzima DNA ligase de T4 (Fermentas). O plasmídeo pUC18 foi digerido com a enzima de restrição SmaI (Gibco) e desfosforilado com a enzima fosfatase alcalina de camarão (SAP, Amersham). Após a ligação o material foi utilizado para transformação io de células de Escherichia coli estirpe XL1-Blue, através da técnica de eletroporação.

As células foram plaqueadas em meio Luria-Bertani (Sambrook & Russel, 2001) contendo ampicilina (100 pg/ml) (Sigma) e crescidas durante a noite a 379C. Os clones recombinantes produzidos foram, então, 15 transferidos para placas tipo ELISA de 96 poços, contendo meio liquido “Circle Grow” (BIO 101, Inc.) suplementado com ampicilina (100 pg/ml) (Sigma). Após o crescimento foi adicionado glicerol 87% para uma concentração final de 30% e os clones foram armazenados a -705C. Seqüenciamento dos clones

20 As colônias individuais das bibliotecas obtidas foram inoculadas em microplacas com 96 poços contendo meio “Circle Grow”, que depois de autoclavado, recebeu ampicilina (100 pg/ml, Sigma) previamente esterilizada por filtração (filtro 0.2 pm, Millipore). As colônias foram crescidas com agitação de 300 rpm, por 16 horas, a 37SC. O DNA foi 25 extraído pelo método usual de rompimento alcalino (Sambrook & Russel, 2001) com uma modificação no final do procedimento, que é o da passagem do sobrenadante por filtros múltipos (MultiScreen, Millipore) antes da precipitação do DNA. O DNA purificado foi ressuspenso em água e verificado em gel de agarose (Invitrogen) a 0,8%, conforme descrito por 30 Sambrook & Russel (2001).

O seqüenciamento do DNA precipitado foi realizado utilizando o “kit” “DYEnamic™ ET dye terminator cycle sequencing (MegaBACE™)” (Amersham) e as reações de PCR (“polymerase chain reaction”, reação em cadeia da polimerase) foram realizadas com os oligonucleotídeos

“Universal” e “Reverso” (Invitrogen). Os produtos da reação foram analisados em um seqüenciador (MegaBacelOOO, Amersham) pelo método dos terminadores fluorescentes.

As ORFs (“open reading frames”) foram obtidas pela análise das 5 sequências pela bioinformática. Os eletroferogramas foram transformados em seqüências de bases utilizando o programa “phred”, que também atribui valores de qualidade a cada base e identifica as seqüências repetitivas e aquelas pertencentes a vetores. A montagem das seqüências foi feita utilizando o programa “phrap” (Ewing and Green, 10    1998 Ewing et ai, 1998). A visualização e edição de montagens de

seqüências foi realizada usando os prpgramas “Consed” (Gordon et ai, 1998) e “phrapview”.

Para completar as descontinuidades do mapa foram seqüenciados plasmídeos, cujas pontas foram ancoradas nas seqüências próximas às 15 descontinuidades. Para seqüenciar os plasmídeos, foram construídas bibliotecas, pelo método “shotgun”, conforme já descrito. A clonagem e posterior seqüenciamento foram realizados como descrito anteriormente. As regiões codificadoras de genes presentes no genoma foram identificadas pelo programa “Glimmer” (Delcher et ai, 1999) e GenMark 20 por comparação com o banco de dados de seqüências do GenBank (Benson et ai, 1999), com a família BLAST (www.ncbi.nlm.nih.gov/BLAST). Os bancos de dados KEGG (Kanehisa & Goto 2000), COG (Tatusov et ai, 2000) INTERPRO (Apweiler et ai, 2001) e o programa PSORT (Nakai & Kanehisa, 1991) foram usados na 25 indentificaçao, predição e na localização das proteínas.

As leituras de bases de boa qualidade definiram o tamanho do genoma de M. synoviae 53, o número de ORFs validadas, hipotéticas e conservadas todas as informações sobre o genoma estão disponíveis no endereço http://www.brqene.lncc.br/indexMS.html.

30 ESTADO DO CONHECIMENTO OBTIDO PELO SEQÜENCIAMENTO DO GENOMA DE M. synoviae 53

A descrição de todos os genes encontrados em M. synoviae 53 estará disponível no endereço www.brgene.lncc.br, do Laboratório Nacional de Computação Científica, ligado ao Ministério de Ciência e Tecnologia/MCT.

« • • • • •• • *• «

• • •••*•« • • • •

•    ••••••    t •    •    •

•• • •• •••• • • • • •••

O genoma de M. synoviae cepa 53 tem 731.588 pares de bases, apresenta um conteúdo de G+C de 28% e potencialmente codifica 617 proteínas. Dessas, 395 têm função conhecida.

Aproximadamente 190 das proteínas putativas apresentam características 5 de localização na membrana celular, estando possivelmente expostas na superfície da bactéria. Algumas dessas proteínas podem ser importantes na interação com as células dos animais infectados e na indução de resposta imune.

IMPORTÂNCIA DOS PROCESSOS ENVOLVIDOS NO OBJETO DA 10 INVENÇÃO

O controle da M. synoviae é altamente dependente de ensaios sorológicos para detecção de aves infectadas. Entretanto, os testes, em geral, apresentam baixa sensibilidade e especificidade. A baixa especificidade é atribuida principalmente à reatividade cruzada com M.

15    ,gallisepticum (Kleven, 1997).

Diferentes reagentes, como preparações brutas de membrana, antígenos purificados de membranas e antígenos recombinates, têm sido utilizados em testes sorológicos para detecção de M. synoviae. Uma região específica da seqüência de hemaglutinina foi proposta para 20 .utilização em ELISA para detecção de anticorpos contra M. synoviae ‘(Noormohammadi et ai, 1999). Mais recentemente, demonstrou-se que esse antígeno não foi eficiente na detecção de anticorpos em aves vacinadas com uma outra cepa de M. synoviae. A clonagem da seqüência que codifica o antígeno da cepa vacinai mostrou que existe variação de 25 seqüência na região utilizada para o diagnóstico, quando comparada com a cepa utilizada anteriormente. Essa variação poderia ser a responsável pelas diferenças na detecção de anticorpos nas diferentes cepas (Noormohammadi et ai, 2002). Esses resultados mostraram que são necessários estudos adicionais visando à identificação de outros 30 antígenos que possam ser utilizados nos testes diagnósticos.

Dessa forma, os produtos gênicos identificados pelo seqüenciamento do genoma de M. synoviae cepa 53 abre novas possibilidades de utilização de novos antígenos na detecção da infecção pelo M. synoviae. Genes codificando antígenos sob controle de uma sequência reguladora de um vetor especial é expressada na bactéria Escherichia coli, e após purificação, a proteína é utilizada em testes diagnósticos para detecção de anticorpos.

SEQÜÊNCIAS DE NUCLEOTÍDEOS DOS GENES ENVOLVIDOS E 5 SEQÜÊNCIAS DE AMINOÁCIDOS DOS PRODUTOS CODIFICADOS 1. Seqüências de nucleotídeos e aminoácidos da Lactato desidrogenase - Idh

A enzima L-lactato desidrogenase atua na redução enzimática do piruvato a L-lactato.

ío Em M. hyopneumoniae, a L-lactato desidrogenase (LDH), pertence a um grupo de proteínas que induzem resposta imunogênica em suínos naturalmente ou experimentalmente infectados com a bactéria. A LDH recombinante de M. hyopneumoniae tem sido utilizada na detecção de M. hyopneumoniae por ELISA e Imunoblot (Frey et ai., 1994; Subramaniam 15 et ai., 2000).

A seqüência de aminoácidos da LDH de M. synoviae apresenta aproximadamente 40% de similaridade com a seqüência descrita de LDH de M. gallisepticum. LDH de M. synoviae pdoerá ser utilizada como reagente para a detecção de anticorpos em aves infectadas com M. 20 synoviae.

A invenção refere-se a polinucleotídeos constituídos pelas seqüências de nucleotídeos de um grupo que consiste de: a) polinucleotídeos idênticos, com identidade de pelo menos 70%, às seqüências de nucleotídeos que codificam polipeptídeos caracterizados pelas seqüência de aminoácidos 25 de número identificador SEQ ID No.1, listada abaixo, e de fragmentos das mesmas; b) polinucleotídeos idênticos, em pelo menos 70%, a polinucleotídeos que codificam os polipeptídeos correspondentes à seqüência listada abaixo, codificadora da L-lactato desidrogenase, e que podem ser isolados, preferencialmente, do cromossomo da estirpe 53 30 de M. synoviae, depositada na bacterioteca do Centro de Pesquisas em Suínos e Aves, EMBRAPA (CNPSA-EMBRAPA); c) polinucleotídeos que codificam polipeptídeos caracterizados por seqüências de aminoácidos idênticas, em pelo menos 70%, às três seqüências de aminoácidos listadas abaixo; d) polinucleotídeos que são complementares aos

7/19


5


polinucleotídeos de a, b ou c; e) polinucleotídeos compreendendo pelo menos 15 bases nucleotídicas sucessivas das seqüências de polinucleotídeos a, b ou c; f) um processo em que a seqüência do gene listada abaixo seja amplificada e possibilite a identificação de M. synoviae; g) um processo em que a seqüência do gene listada abaixo seja utilizada para produção de reagentes para diagnóstico sorológico de infecção por M. synoviae em aves.

SEQ ID No. 1 - L-lactato desidrogenase (MS02387 )

10 atgaaaaaaattattgttataggtatgggaaatgtaggtactacatttgt caatatagctttagctagaggtttgcaagcaaattttgtttttgttgata aaaatgaagaaatttgccaagctcatgtacatgattttcaagatatgatt gctctaatgcctcgtaataattctacttttaaagtaggcacattattaca agaagccaaggacgctgacatagtaattgttactgcatcaattcctgcta 15 ataaagattttagtgatcgtttaaaactagctgaggctaattcaaaatta atgaagtcttttggtgatcaattaaaagaagctaaattcaaaggtatagt tatagttgcggctaatccttgtgatgttatggcttcagtatttacttatg cgtcaaatttaccatttaaaaaagttatttctacaggaacattgttagat tccgcacgttttaaaaaatttattgctcaaaaatttaatgttaatgccga 20 ttctgtacaggcaagtattttaggagaacacggttcaagcgctattccac tttgatctactgtaaaaattggagatgctactttagaaaatttacttaaa agcaagaaacttaaatctaacgaattaaatcaaatattaaaacaaactat tgatgaagctttctatattttttcaagaaaaggcaatactcaatttggta ttggaacatctttatatgaaattactgatgctattttaaataataaaaaa 25 caagtaatgaatattggtgtaaaattacctgctaattacaaaaacgcagg aatttatatttcaataccagttattgttggaaaaaatggttatgagtatt taagtgttaaacctaattttaataataatgaattaaaacaatttgaagca tcaacatctcatatggctaaagtgcataaagatactttaaaattaataaa cattgatatggattttgaataa 30

MKKIIVIGMGNVGTTFVNIALARGLQANFVFVDKNEEICQAHVHDFQDMI ALMPRNNSTFKVGTLLQEAKDADIVIVTASIPANKDFSDRLKLAEANSKL MKSFGDQLKEAKFKGIVIVAANPCDVMASVFTYASNLPFKKVISTGTLLD SARFKKFIAQKFNVNADSVQASILGEHGSSAIPLWSTVKIGDATLENLLK 35 SKKLKSNELNQILKQTIDEAFYIFSRKGNTQFGIGTSLYEITDAILNNKK QVMNIGVKLPANYKNAGIYISIPVIVGKNGYEYLSVKPNFNNNELKQFEA STSHMAKVHKDTLKLINIDMDFE

2. Seqüências de nucleotídeos e aminoácidos da Fosfopantotenoilcisteina sintetase/decarboxilase - dfp

Coenzima A (CoA) é um co-fator indispensável em todos os organismos vivos, onde funciona como um carregador de grupo acila, participando de 5 importantes transformações bioquímicas. A biossíntese de CoA a partir de pantotenato envolve cinco etapas. Inicialmente, pantotenato é fosforilado por uma pantotenato quinase. O 4'-fosfopantotenato é conjugado com cisteína pela fosfopantotenoilcisteina sintetase (PPCS), e então convertido em 4'-fosfopanteteina pela fosfopantotenoilcisteina ío decarboxilase (PPCDC). As duas etapas finais são a adenilação da fosfopanteteína pela fosfopantetína adeniltransferase (PPAT) para fromar a defosfo-CoA e fosforilação pela defosfo-CoA quinase (DPCK) para formar CoA (Daugherty et ai, 2002).